Methods of modifying cells

Abstract

A method of modifying a cell, the method comprising: transfecting a cell to be modified with a transfection composition to cause the cell to comprise and / or express a foreign gene, the transfection composition containing a foreign nucleic acid molecule comprising the foreign gene, at least a portion of the foreign nucleic acid molecule being obtained from a host cell; and, in the portion of the foreign nucleic acid molecule obtained from the host cell, the content of genomic DNA of the host cell is about 10% (w / w) or less.

Description

Technical Field

[0001] This application relates to the field of biomedicine, specifically to a method for modifying cells. Background Technology

[0002] Enhancing cell function through gene modification is a crucial method for improving the efficacy of cell therapy. Currently, the field of cell therapy primarily utilizes viral vector transfection to achieve stable expression of various molecules, thereby realizing the therapeutic goal. However, viral vector transfection involves lengthy design time, complex preparation processes, long experimental cycles, and high costs. Furthermore, introducing viral sequences into the human host may trigger host immunogenicity, insertional mutations, and create unpredictable safety risks.

[0003] There have been reports of attempts to use non-viral systems for cell modification or transfection to achieve cell therapy. However, non-viral system-mediated transfection has low efficiency and high cytotoxicity to the transfected cells, severely affecting cell viability. In particular, non-viral transfection of immune cells, stem cells, and fibroblasts (especially primary cells) has resulted in even greater cytotoxicity, leading to high cell death rates and low expansion rates, thus preventing the transfection efficiency and viable cell recovery rates from meeting the requirements of cell therapy. Given the limitations of existing non-viral methods, achieving the required cell volume for cell therapy necessitates prolonged in vitro targeted cell expansion. However, prolonged in vitro targeted expansion inevitably alters cell phenotype and function, significantly limiting the therapeutic effect of the transfected cells.

[0004] Therefore, there is an urgent need to obtain a safe, highly efficient, and viable non-viral cell modification method that can produce enough cells for clinical treatment in a short period of time, thereby improving the above-mentioned problems. Summary of the Invention

[0005] This application provides a non-viral cell transfection method. It novelly and significantly improves upon current non-viral plasmid electroporation techniques, which suffer from low transfection efficiency, low expression levels of exogenous nucleic acid molecules, poor cell viability and amplification rates, and an inability to produce sufficient cell quantities for clinical cell therapy in a short period, making direct use in cell therapy difficult. The inventors of this application were surprised to discover that residual host genomic DNA in plasmids extracted from the host is one of the main reasons for the limitations of existing non-viral plasmid electroporation techniques. When the inventors attempted to reduce the host genomic DNA content in these plasmids, they were surprised to find that when using the optimized plasmid for cell transfection, cell amplification capacity was significantly enhanced, and the number of cells required for clinical treatment could be produced within a few days. The expression rate of exogenous nucleic acid molecules was also greatly increased, and the transfected cells significantly and specifically enhanced the inhibitory effect on the growth of target tumor cells in vivo.

[0006] Stability and reproducibility of transfecting cells from different donors or batches are crucial factors to consider in the production of cell therapy products. The inventors of this application have discovered that when the host genomic DNA (e.g., microorganisms) in the plasmid used for transfection is reduced to a certain threshold, the negative impact on cell viability and expression rates during transfection is reduced to a minimum. This allows for highly efficient, reproducible, and stable transfection of cells from different batches and donor sources (e.g., T cells). Furthermore, the transfected cells can reproducibly and specifically inhibit the growth of target tumor cells in vivo, making it possible to produce the required number of cells for clinical tumor treatment in a short period for effective cell therapy. This invention opens up significant application prospects for cell transfection using non-viral DNA plasmids in the field of cell therapy. The inventors have also discovered that reducing the host genomic DNA in the transfection composition to a certain threshold can significantly reduce its cytotoxicity. The method described in this application has one or more of the following effects: 1) improved transfection efficiency; 2) improved gene editing efficiency; 3) improved DNA homologous recombination efficiency; 4) improved cell viability of transfected cells (e.g., improved cell survival rate, cell expansion capacity, cell killing capacity, cell secretion capacity, cell preservation (especially cryopreservation) capacity and / or cell resuscitation capacity), and the in vivo specific target cell killing capacity necessary for cell therapy; 5) rapid preparation of the number of cells required for clinical treatment; 6) can be used (during preparation) to control and / or judge the quality of the transfection composition (e.g., containing DNA plasmids); 7) simple operation; 8) low cost; 9) good reproducibility; 10) high safety.

[0007] On one hand, this application provides a method for modifying cells. The method may include: transfecting cells to be modified with a transfection composition to enable the cells to contain and / or express a foreign gene, the transfection composition containing a foreign nucleic acid molecule containing the foreign gene, at least a portion of the foreign nucleic acid molecule being derived from a host cell; and in the portion of the foreign nucleic acid molecule derived from the host cell, the content of the host cell's genomic DNA is less than about 10% (w / w).

[0008] In some embodiments, the cells to be modified are eukaryotic cells. In some embodiments, the cells to be modified are mammalian cells. In some embodiments, the cells to be modified are human cells. In some embodiments, the cells to be modified include stem cells, immune cells, fibroblasts, fibroblasts, and / or muscle cells. In some embodiments, the cells to be modified include pluripotent stem cells (or multipotent stem cells), hematopoietic stem cells, and / or mesenchymal stem cells. In some embodiments, the cells to be modified include immune effector cells. In some embodiments, the cells to be modified include T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes, and / or mast cells. In some embodiments, the cells to be modified include peripheral blood lymphocytes. In some embodiments, the cells to be modified are primary cells. In some embodiments, the cells to be modified are autologous cells derived from the subject.

[0009] In some embodiments, the transfected cells to be modified are activated cells. In some embodiments, activation includes contacting the cells to be modified with an activating composition. In some embodiments, the cells to be modified comprise immune cells, and the activating composition comprises anti-CD3 and / or anti-CD28 antibodies. In some embodiments, activation includes contacting the cells to be modified with the activating composition for no more than about 3 days. In some embodiments, the method includes performing the transfection while contacting the cells to be transfected with the activating composition for a period of about 2 days or less.

[0010] In some embodiments, the transfection includes electroporation of the cells to be modified.

[0011] In some embodiments, the exogenous nucleic acid molecule obtained from the host cell is a plasmid.

[0012] In some embodiments, the exogenous nucleic acid molecules include circular nucleic acid molecules, supercoiled nucleic acid molecules, and / or linear nucleic acid molecules.

[0013] In some embodiments, the exogenous nucleic acid molecule includes DNA molecules and / or RNA molecules.

[0014] In some embodiments, the exogenous nucleic acid molecule includes single-stranded nucleic acid molecules and / or double-stranded nucleic acid molecules.

[0015] In some embodiments, the concentration of the exogenous nucleic acid molecule in the transfection composition is from about 5 μg / mL to about 3000 μg / mL. In some embodiments, the concentration of the exogenous nucleic acid molecule in the transfection composition is from about 200 μg / mL to about 800 μg / mL.

[0016] In some embodiments, the exogenous nucleic acid molecule is obtained from the host cell.

[0017] In some embodiments, the size of the exogenous nucleic acid molecule is at least about 3 kb. In some embodiments, the size of the exogenous nucleic acid molecule is at least about 4 kb.

[0018] In some embodiments, the host is a microbial host. In some embodiments, the host is selected from one or more of the group consisting of bacteria, fungi, actinomycetes, mycoplasma, chlamydia, rickettsia, and spirochetes. In some embodiments, the host includes Gram-negative bacteria. In some embodiments, the host includes Escherichia coli.

[0019] In some embodiments, the size of the host cell's genomic DNA is at least about 10 kb.

[0020] In some embodiments, the genomic DNA content of the host cell accounts for less than about 10% (w / w) of the exogenous nucleic acid molecules obtained from the host cell, for example, less than about 1% (w / w). In some embodiments, the genomic DNA content of the host cell accounts for less than about 9‰ (w / w) of the exogenous nucleic acid molecules obtained from the host cell, for example, less than about 5‰ (w / w), less than about 2‰ (w / w), or less than 1‰ (w / w).

[0021] In some embodiments of the method of this application, the content of genomic DNA in the host cell is determined by qPCR.

[0022] In some embodiments, the host cell's genomic DNA is not included in the exogenous nucleic acid molecule portion.

[0023] In some embodiments, the exogenous nucleic acid molecule portion obtained from the host cell is processed to reduce the amount of genomic DNA in the host cell.

[0024] In some embodiments, the method further includes determining the content of the host cell's genomic DNA in the exogenous nucleic acid molecule portion obtained from the host cell, and determining whether to process the exogenous nucleic acid molecule portion to reduce the content of the host cell's genomic DNA based on the content.

[0025] For example, when the genomic DNA content of the host cell accounts for about 10% (w / w) of the exogenous nucleic acid molecules obtained from the host cell (e.g., about 9% (w / w), about 8% (w / w), about 7% (w / w), about 6% (w / w), about 5% (w / w), about 4% (w / w), about 3% (w / w), about 2.5% (w / w), about 2% (w / w), about 1.5% (w / w), about 1% (w / w), about 9‰ (w / w), about 8‰ (w / w) of the exogenous nucleic acid molecules obtained from the host cell), When the concentration of saturation is approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4.5‰ (w / w), approximately 4‰ (w / w), approximately 3.5‰ (w / w), approximately 3‰ (w / w), approximately 2.5‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), or approximately 0.001‰ (w / w) or higher, the aforementioned treatment is performed.

[0026] In some embodiments, the method further includes determining the content of the host cell's genomic DNA in the exogenous nucleic acid molecule portion obtained from the host cell, wherein the content of the host cell's genomic DNA is about 10% (w / w) (e.g., about 9% (w / w), about 8% (w / w), about 7% (w / w), about 6% (w / w), about 5% (w / w), about 4% (w / w), about 3% (w / w), about 2.5% (w / w), about 2% (w / w), about 1.5% (w / w), about 1% (w / w), about 9‰ (w / w), about 8‰). When the concentration of the exogenous nucleic acid molecule is approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4.5‰ (w / w), approximately 4‰ (w / w), approximately 3.5‰ (w / w), approximately 3‰ (w / w), approximately 2.5‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), or approximately 0.001‰ (w / w) or higher, the exogenous nucleic acid molecule is treated to reduce the content of genomic DNA in the host cell.

[0027] In some embodiments, the treatment includes contacting the exogenous nucleic acid molecule moiety with one or more reagents selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. In some embodiments, the DNase is capable of nonspecifically cleaving linear DNA. In some embodiments, the DNase comprises an exonuclease. In some embodiments, the treatment includes Mg 2+ and Ca 2+ The presence of the reagent allows the exogenous nucleic acid molecule to come into contact with the reagent.

[0028] In some embodiments, the exogenous gene encodes one or more exogenous proteins. In some embodiments, the exogenous protein includes one or more of the following: antibody or antigen-binding fragments, chimeric antigen receptors (CARs), cytokines, and chemokines.

[0029] In some embodiments, the CAR includes a target-binding domain that targets a tumor-associated antigen. In some embodiments, the tumor-associated antigen is selected from GPC3, CD19, BCMA, Claudin18.2, and Mesothelin. In some embodiments, the antibody or antigen-binding fragment includes a multispecific antibody or an antigen-binding fragment thereof. In some embodiments, the multispecific antibody or antigen-binding fragment thereof includes a bispecific T-cell connective (BiTE). In some embodiments, the BiTE includes a CD3 binding domain. In some embodiments, the BiTE also includes a tumor-associated antigen binding domain.

[0030] In some embodiments, the cytokines include interleukins. In some embodiments, the interleukins include IL15, IL7, or functionally active fragments thereof.

[0031] In some embodiments, the chemokine includes CCL19 or a functionally active fragment thereof.

[0032] In some embodiments, the exogenous protein comprises a polyprotein. In some embodiments, a cleavable portion is included between two or more proteins in the polyprotein. In some embodiments, the cleavable portion comprises a 2A peptide. In some embodiments, the 2A peptide comprises P2A, T2A, F2A, or E2A.

[0033] In some embodiments, the exogenous nucleic acid molecule further comprises one or more homologous regions. In some embodiments, each homologous region comprises at least 10 nucleotides. In some embodiments, in the exogenous nucleic acid molecule, the homologous region is located at the 3' end and / or 5' end of the exogenous gene.

[0034] In some embodiments, the exogenous gene is integrated into the genome of the cell.

[0035] In some embodiments, after the exogenous gene is integrated into the genome of the cell, its expression is regulated by an endogenous promoter or an exogenous promoter.

[0036] In some embodiments, the homologous region is homologous to a target region of the cell's genomic DNA. In some embodiments, the target region is located in a TCR-α subunit constant (TRAC) gene or at the AAVS-I site.

[0037] In some embodiments, the transfection composition does not contain a viral vector.

[0038] In some embodiments, the transfection composition further comprises a gene editing system capable of integrating the foreign gene into a specific location in the cell genome. In some embodiments, the gene editing system comprises a site-specific enzyme or a nucleic acid molecule encoding it. In some embodiments, the site-specific enzyme is selected from: transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), transposases, integrases, and Cas proteins. In some embodiments, the Cas protein is the Cas9 protein. In some embodiments, the transposase comprises PiggyBac (PB) transposase and / or Sleeping Beauty (SB) transposase.

[0039] In some embodiments, the gene editing further includes the knockout of one or more genes in the cell. The knocked-out genes may include PD-1 and / or CD95.

[0040] In some embodiments, the gene editing system further includes one or more guide RNAs.

[0041] For example, the gene editing system may include one or more guide RNAs that target the gene to be knocked out. For example, the gene editing system may include guide RNA that targets PD-1. For example, the gene editing system may include guide RNA that targets CD95.

[0042] In some embodiments, the guide RNA is complementary to a nucleic acid sequence in a target region of the cell genome. In some embodiments, the gene editing system comprises a ribonucleoprotein complex (RNP), and the RNP comprises the Cas protein and the guide RNA.

[0043] On the other hand, this application provides a method for improving the transfection efficiency of exogenous nucleic acid molecules obtained from host cells to cells, the method comprising: reducing the content of host cell genomic DNA in the exogenous nucleic acid molecule obtained from the host cell.

[0044] In some embodiments, the cells to be transfected are eukaryotic cells. In some embodiments, the cells to be transfected are mammalian cells. In some embodiments, the cells to be transfected are human cells. In some embodiments, the cells to be transfected include stem cells, immune cells, fibroblasts, fibroblasts, and / or muscle cells. In some embodiments, the cells to be transfected include pluripotent stem cells, hematopoietic stem cells, and / or mesenchymal stem cells. In some embodiments, the cells to be transfected include immune effector cells. In some embodiments, the cells to be transfected include T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes, and / or mast cells. In some embodiments, the cells to be transfected include peripheral blood lymphocytes. In some embodiments, the cells to be transfected are primary cells. In some embodiments, the cells to be transfected are autologous cells derived from the subject.

[0045] In some embodiments, the transfected cells to be modified are activated cells. In some embodiments, activation includes contacting the cells to be modified with an activating composition. In some embodiments, the cells comprise immune cells, and the activating composition comprises anti-CD3 and / or anti-CD28 antibodies. In some embodiments, activation includes contacting the cells to be modified with the activating composition for no more than about 4 days.

[0046] In some embodiments, the method includes performing the transfection while exposing the cells to be transfected to the activation composition for a period of about 2 days or less.

[0047] In some embodiments, the transfection includes electroporation of the cells to be modified.

[0048] In some embodiments, the exogenous nucleic acid molecule is a plasmid. In some embodiments, the exogenous nucleic acid molecule includes circular nucleic acid molecules, supercoiled nucleic acid molecules, and / or linear nucleic acid molecules. In some embodiments, the exogenous nucleic acid molecule includes DNA molecules and / or RNA molecules. In some embodiments, the exogenous nucleic acid molecule includes single-stranded nucleic acid molecules and / or double-stranded nucleic acid molecules. In some embodiments, the concentration of the exogenous nucleic acid molecule in the transfection composition is from about 5 μg / mL to about 3000 μg / mL. In some embodiments, the concentration of the exogenous nucleic acid molecule in the transfection composition is from about 200 μg / mL to about 800 μg / mL. In some embodiments, the exogenous nucleic acid molecule is obtained from the host cell. In some embodiments, the size of the exogenous nucleic acid molecule is at least about 3 kb.

[0049] In some embodiments, the host is a microbial host. In some embodiments, the host is selected from one or more of the group consisting of bacteria, fungi, actinomycetes, mycoplasma, chlamydia, rickettsia, and spirochetes. In some embodiments, the host includes Gram-negative bacteria. In some embodiments, the host includes Escherichia coli.

[0050] In some embodiments, the size of the host cell's genomic DNA is at least about 10 kb.

[0051] In some embodiments, after the reduction, the genomic DNA content of the host cell is less than about 10% (w / w). In some embodiments, after the reduction, the genomic DNA content of the host cell is less than about 1% (w / w). In some embodiments, after the reduction, the genomic DNA content of the host cell is less than about 0.9% (w / w).

[0052] In some embodiments, the genomic DNA content of the host cell is determined by qPCR.

[0053] In some embodiments, reducing the content of host cell genomic DNA includes contacting the exogenous nucleic acid molecule derived from the host cell with one or more reagents selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. In some embodiments, the DNase is capable of nonspecifically cleaving linear DNA. In some embodiments, the DNase comprises an exonuclease.

[0054] In some embodiments, reducing the content of the host cell genomic DNA includes Mg 2+ and Ca 2+The presence of the reagent allows the exogenous nucleic acid molecules obtained from the host cell to come into contact with the reagent.

[0055] In some embodiments, the exogenous nucleic acid molecule comprises the exogenous gene described in any aspect of this application.

[0056] In some embodiments, the exogenous nucleic acid molecule further comprises one or more homologous regions as described in any aspect of this application.

[0057] In some embodiments, the exogenous nucleic acid molecule does not contain a viral vector.

[0058] In some embodiments, the transfection composition further comprises a gene editing system capable of integrating the foreign gene into a specific location in the cell genome. In some embodiments, the gene editing system is as described in any aspect of this application.

[0059] On the other hand, this application provides a method for improving the transfection efficiency of exogenous nucleic acid molecules obtained from host cells, the method comprising: treating the exogenous nucleic acid molecules with DNase. In some embodiments, the DNase is capable of nonspecifically cleaving linear DNA. In some embodiments, the DNase comprises an exonuclease. In some embodiments, the treatment includes Mg... 2+ and Ca 2+ The presence of [a substance] allows the exogenous nucleic acid molecule to come into contact with the DNase.

[0060] In some embodiments, the transfection includes electroporation of the cells.

[0061] In some embodiments, the exogenous nucleic acid molecule is as described in any aspect of this application.

[0062] In some embodiments, the cells are as described in any aspect of this application.

[0063] On the other hand, this application provides a method for optimizing a transfection composition comprising a foreign nucleic acid molecule derived from a host cell, the method comprising: reducing the content of host cell genomic DNA in the portion of the foreign nucleic acid molecule derived from the host cell. In some embodiments, the transfection composition is as described in any aspect of this application. In some embodiments, the host is as described in any aspect of this application.

[0064] In some embodiments, after optimization, the genomic DNA content of the host cell is less than about 10% (w / w). In some embodiments, after optimization, the genomic DNA content of the host cell is less than about 1% (w / w). In some embodiments, after optimization, the genomic DNA content of the host cell is less than about 0.9% (w / w). In some embodiments, the genomic DNA content of the host cell is determined by qPCR.

[0065] In some embodiments, the optimization includes contacting the exogenous nucleic acid molecule derived from the host cell with one or more reagents selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. In some embodiments, the DNase is capable of nonspecifically cleaving linear DNA. In some embodiments, the DNase comprises an exonuclease. In some embodiments, the optimization includes Mg 2+ and Ca 2+ The presence of the reagent allows the exogenous nucleic acid molecule derived from the host cell to come into contact with the reagent.

[0066] On the other hand, this application provides a method for optimizing a transfection composition comprising a foreign nucleic acid molecule moiety derived from a host cell, the method comprising treating the foreign nucleic acid molecule moiety derived from the host cell with a DNase. In some embodiments, the DNase is capable of nonspecifically cleaving linear DNA. In some embodiments, the DNase comprises an exonuclease. In some embodiments, the treatment includes Mg... 2+ and Ca 2+ In the presence of [the substance], the exogenous nucleic acid molecule derived from the host cell comes into contact with the DNase. In some embodiments, the transfection composition is as described in any aspect of this application.

[0067] On the other hand, this application provides a method for determining the quality of a transfection composition comprising a foreign nucleic acid molecule portion obtained from a host cell. The method includes: determining the content of genomic DNA of the host cell in the foreign nucleic acid molecule portion obtained from the host cell, and determining the quality of the transfection composition based on the content. In some embodiments, the transfection composition is as described in any aspect of this application. In some embodiments, the host is as described in any aspect of this application.

[0068] In some embodiments, the quality of the transfection composition is deemed to meet the standard when the content of genomic DNA in the host cell is less than about 10% (w / w).

[0069] In some embodiments, the quality of the transfection composition is deemed to meet the standard when the content of genomic DNA in the host cell is less than about 1% (w / w).

[0070] In some embodiments, the quality of the transfection composition is deemed to meet the standard when the content of genomic DNA in the host cell is less than about 9‰ (w / w).

[0071] In some embodiments, the genomic DNA content of the host cell is determined by qPCR.

[0072] In some embodiments, the method described in this application is an in vitro method or an ex vivo method.

[0073] On the other hand, this application provides the use of the aforementioned reagents (e.g., deoxyribonuclease (DNase), SDS, TX-100, CTAB and / or cesium chloride-ethidium bromide) for optimizing transfection compositions.

[0074] On the other hand, this application provides a kit for cell transfection (e.g., electroporation). The kit comprises: 1) an exogenous nucleic acid molecule derived from a host cell as described in any aspect of this application; and 2) a reagent capable of reducing or degrading the genomic DNA of the host cell. In some embodiments, the reagent 2) comprises one or more selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. In some embodiments, the DNase is capable of nonspecifically cleaving linear DNA. In some embodiments, the DNase comprises an exonuclease. In some embodiments, the kit further comprises Mg... 2+ and Ca 2+ The reagent.

[0075] On the other hand, this application provides a kit comprising: 1) an exogenous nucleic acid molecule portion derived from a host cell as described in any aspect of this application; and 2) an instruction manual describing the treatment of the exogenous nucleic acid molecule portion derived from the host cell of 1) by the method of this application and / or the determination of the quality of the transfection composition containing the exogenous nucleic acid molecule portion derived from the host cell by the method of this application.

[0076] On the other hand, this application provides a transfection composition comprising exogenous nucleic acid molecules treated by the methods described in this application.

[0077] On the other hand, this application provides cells transfected with the transfection composition described in this application. In some embodiments, the transfection includes electroporation of the cells.

[0078] On the other hand, this application provides cells modified by the methods described in this application.

[0079] On the other hand, this application provides a cell population comprising the cells described in this application and / or their descendants.

[0080] On the other hand, this application provides a pharmaceutical composition comprising the transfection composition described in this application, the cells described in this application, and / or the cell population described in this application. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant.

[0081] On the other hand, this application provides the use of the transfection composition, cells, cell populations, and / or pharmaceutical compositions described in this application for the preparation of a medicament. In some embodiments, the medicament is used for the prevention, treatment, and / or alleviation of cancer. In some embodiments, the medicament is used to modulate an immune response.

[0082] On the other hand, this application provides a method for preventing, treating, and / or alleviating a disease or condition in a subject, the method comprising administering to the subject an effective amount of the transfection composition described in this application, the cells described in this application, the cell population described in this application, and / or the pharmaceutical composition described in this application. In some embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is related to the subject's immune response.

[0083] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Attached Figure Description

[0084] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and drawings described in detail below. A brief description of the drawings is as follows:

[0085] Figure 1 The results displayed show the detection results of multiple parameters for plasmids from different sources.

[0086] Figure 2 The display shows the determination of the content of host genomic DNA in plasmids from different sources.

[0087] Figures 3A-3C The display shows the cell survival rate, cell proliferation capacity, and cell protein expression capacity after transfection with plasmids containing different amounts of host genomic DNA.

[0088] Figure 4 The display shows the cell survival rate and protein expression capacity (i.e., overall expression level) after cells are transfected with plasmids containing different amounts of host genomic DNA.

[0089] Figures 5A-5C The results show the cell viability, cell proliferation capacity, and protein expression capacity after cells were transfected with plasmids containing different amounts of host genomic DNA.

[0090] Figure 6 The results show the killing ability of CAR-T cells against tumor cells in vitro, prepared using plasmids containing different amounts of host genomic DNA.

[0091] Figure 7 The results show the ability of CAR-T cells prepared using plasmids containing varying amounts of host genomic DNA to kill non-solid tumor cells in vivo.

[0092] Figures 8A-8C The results show cell survival rate and cell proliferation capacity after transfection with a plasmid containing less host genomic DNA; as well as the results of CAR-T-specific killing of tumor cells prepared using the plasmid.

[0093] Figures 9A-9C The results show the cell survival rate, cell expansion capacity, and protein expression capacity after transfecting cells with plasmids containing less host genomic DNA.

[0094] Figure 10 The results show that cells expressing CAR and BiTE, prepared using plasmids containing less host genomic DNA, specifically killed tumor cells.

[0095] Figure 11 The results show that the culture supernatant of CAR and BiTE-expressing cells prepared with plasmids containing less host genomic DNA specifically killed tumor cells.

[0096] Figure 12 The results show the effects of cells expressing CAR and BiTE, prepared using plasmids containing less host genomic DNA, specifically killing tumor cells in vivo.

[0097] Figures 13A-13D The results show that reducing the amount of host genomic DNA in the plasmid can significantly improve cell survival rate, cell proliferation capacity, and cell protein expression capacity after transfection with the plasmid.

[0098] Figure 14 The image shows the in vivo tumor-suppressing effect of cells expressing CAR and IL15 prepared using plasmids containing less host genomic DNA.

[0099] Figure 15 The image shows the in vivo tumor-suppressing effect of cells expressing CAR and IL15 prepared using plasmids containing less host genomic DNA, when the exogenous gene is integrated into the AAVS-I site.

[0100] Figure 16 The results show the in vivo tumor-suppressing effect of cells expressing CAR, IL7, and CCL19 prepared using plasmids containing less host genomic DNA.

[0101] Figures 17A-17D The results show the transfection efficiency of non-activated T cells transfected with plasmids containing less host genomic DNA.

[0102] Figures 18A-18D The results show the transfection efficiency of activated T cells transfected with plasmids containing less host genomic DNA.

[0103] Figures 19A-19B The results show that T cells transfected with plasmids containing less host genomic DNA, which simultaneously express CAR and have CD95 and PD-1 knocked out, can specifically kill tumor cells. Detailed Implementation

[0104] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.

[0105] Terminology Definition

[0106] In this application, the term "transfection efficiency" generally refers to the relative amount of material introduced into and / or expressed by the transfected cells. In this application, transfection may refer to the introduction of one or more materials (e.g., polynucleotides) into cells. The introduced material may be stably or transiently retained in the transfected cells. In this application, the transfection efficiency can be measured by the amount of the introduced material.

[0107] In this application, the term "deoxyribonuclease (DNase)" generally refers to an enzyme capable of cleaving phosphodiester bonds on the DNA backbone. The DNase can be a type of nuclease. The DNase can (e.g., under weakly alkaline conditions) digest double-stranded DNA into deoxynucleotides. For example, the DNase may be substantially inactive (e.g., unable to cleave) circular or supercoiled nucleic acid molecules or fragments thereof (e.g., closed circular double-stranded DNA and / or supercoiled DNA). For example, the DNase can cleave linear double-stranded DNA. For example, the DNase can be a DNA exonuclease. For example, the DNase can be exonuclease V. For example, the DNase can be an ATP-Dependent DNase, such as Plasmid-Safe. TM ATP-Dependent DNase.

[0108] In this application, the term "nucleic acid molecule or fragment thereof" generally refers to a nucleotide (e.g., ribonucleotide, deoxyribonucleic acid, and / or modified forms of both) or a fragment thereof. The nucleic acid molecule or fragment thereof may comprise polymeric forms of nucleotides or fragments thereof. The nucleic acid molecule or fragment thereof may, in some cases, be interchangeable with "polynucleotide". The nucleic acid molecule may include DNA, RNA, cDNA, sense and antisense strands of genomic DNA, and their synthetic forms, mixtures, and / or polymers. The nucleic acid molecule or fragment thereof may include any topological conformation, such as single-stranded, double-stranded, partially double-stranded, triple-stranded, hairpin, circular, and / or padlock conformations. The nucleotides in the nucleic acid molecule or fragment thereof may be native or modified. The nucleotides in the nucleic acid molecule or fragment thereof may be linked together by naturally occurring and / or non-naturally occurring nucleotide bonds.

[0109] In this application, the term "exogenous nucleic acid molecule" generally refers to a nucleic acid molecule that is not directly produced within an organism, tissue, or cell. For example, the nucleic acid molecule is introduced into the organism, tissue, or cell from the external environment in some form. The structure, composition, or function of the nucleic acid molecule may be the same as or different from the corresponding endogenously expressed nucleic acid molecule. For example, in some cases, the exogenous nucleic acid molecule may have the same nucleotide sequence as the corresponding endogenously expressed nucleic acid molecule. In other cases, the exogenous nucleic acid molecule is not the same as any endogenously expressed nucleic acid molecule.

[0110] In this application, the terms "transfection composition" and "transfection mixture" are used interchangeably and generally refer to a mixture required for transfection. In this application, the transfection mixture may include one or more materials (e.g., polynucleotides or exogenous nucleic acid molecules) to be introduced. For example, the transfection mixture may contain exogenous nucleic acid molecules encoding the exogenous gene to be transfected. For example, the transfection mixture may include a vector containing the nucleic acid molecule. For example, the transfection mixture may also include impurities (in some cases, the impurities may include nucleic acid molecules or fragments thereof). In this application, the impurities may include nucleic acid molecules or fragments thereof of microbial origin. Impurities carried by the vector may include impurities carried by the vector itself (e.g., nucleic acid molecules or fragments thereof homologous or heterologous to the backbone of the vector).

[0111] In this application, the terms "total nucleic acid molecule content" and "total DNA amount" are used interchangeably and generally refer to the total mass of all nucleotide-containing substances in the transfection mixture. For example, the nucleotide-containing substances may include the nucleic acid molecules or fragments thereof and the material.

[0112] In this application, the term "editing efficiency of gene editing" generally refers to the proportion of nucleic acid molecules cleaved at a target location by gene editing techniques out of all nucleic acid molecules processed by the gene editing. The editing efficiency of gene editing reflects the ability of the gene editing to act at that target location.

[0113] In this application, the term "DNA homologous recombination efficiency" generally refers to the proportion of individuals (e.g., cells) undergoing DNA homologous recombination out of the total number of individuals used for DNA homologous recombination. This DNA homologous recombination efficiency can be verified by methods such as gene sequencing and detection of corresponding protein expression.

[0114] In this application, the term "cell viability" generally refers to the ability of cells to survive and / or perform biological functions (e.g., division, proliferation, secretion, killing, preservation, and / or resuscitation) under certain conditions. In some cases, cell viability can be measured by the proportion of cells surviving under specific time and conditions to the total number of surviving and dead cells at that time. In this application, cell viability can also be measured by the proportion of cells possessing a certain biological function and / or activity under specific time and conditions to the total number of cells at that time.

[0115] In this application, the term "host" generally refers to an organism used to carry, amplify, or produce the exogenous nucleic acid molecule to be transfected, and may include host cells, such as microbial or mammalian cells.

[0116] In this application, the term "microorganism" generally refers to eukaryotic and prokaryotic microbial species from the domains Archaea, Bacteria, and / or Eukarya. For example, said microorganisms may include bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasmas, chlamydiae, and / or spirochetes. In this application, the term "bacteria" generally refers to any type of prokaryote, including prokaryotes from all phyla in the kingdom Prokaryotes. Said bacteria may include cocci, bacilli, spirillae, protoplasts, and protoplasts. Said bacteria may include Gram-positive and Gram-negative bacteria. "Gram-negative" and "Gram-positive" refer to staining patterns using Gram staining methods well known in the art (see, for example, Finegold and Martin, Diagnostic Microbiology, 6th edition, CV. Mosby St. Louis, pp. 13-15 (1982)).

[0117] In this application, the term "host cell genomic DNA" generally refers to the genomic DNA molecule or fragment thereof of a host cell.

[0118] In this application, the term "nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism)" is used interchangeably with "host genomic DNA" and generally refers to a nucleic acid molecule or fragment thereof derived from the genome of the microorganism. Information on genomes derived from a host (e.g., a microorganism) can be found in Agenomic Catalogue of Earth's Microbiomes, Nature Biotechnology (2020).

[0119] In this application, the term "Gram-negative bacteria" generally refers to bacteria that are not stained by the primary dye used in Gram staining but are stained by a counterstain. Therefore, Gram-negative bacteria typically appear red in Gram staining methods. The cell walls of said Gram-negative bacteria have a low content of peptidoglycan and a high content of lipids. For example, the cell walls of said Gram-negative bacteria may have a lipopolysaccharide layer. For example, said Gram-negative bacteria may include *Escherichia coli*, *Pseudomonas aeruginosa*, *Proteus*, *Shigella*, *Klebsiella pneumoniae*, *Brucella*, *Haemophilus influenzae*, *Haemophilus parainfluenzae*, *Moraxella catarrhalis*, *Acinetobacter* spp., *Yersinia* spp., *Legionella pneumophila*, *Bordetella pertussis*, *Bordetella parapertussis*, *Shigella* spp., *Pasteurella* spp., *Vibrio cholerae*, *Bacillus parahaemolyticus*, and / or *Shigella pyridomonas*.

[0120] In this application, the term "Escherichia coli" generally refers to Escherichia coli. Escherichia coli belongs to the genus Escherichia of the family Enterobacteriaceae.

[0121] In this application, the term "transient transfection" generally refers to a transfection method in which a foreign gene transfected into a cell is not integrated into the cell's own genome. The transient transfection enables rapid expression of the foreign gene over a short period (e.g., at least about 1 day, at least about 2 days). The foreign gene transfected into the cell may be gradually lost as the cell grows and / or divides. The transient transfection may have advantages selected from the group consisting of: ease of operation, short experimental cycle, high expression efficiency, safety, and no need for gene selection. The procedures for the transient transfection are known to those skilled in the art. For example, the transient transfection can be performed using liposome-mediated transfection. For example, the transient transfection can include electroporation transfection. The transient transfection can use transfection reagents, such as FuGENE6.

[0122] In this application, the term "stable transfection" generally refers to the introduction and integration of a foreign nucleic acid molecule into the genome of a transfected cell. For example, the integration of the foreign gene into the genome of a transfected cell.

[0123] In this application, the term "stem cell" generally refers to a type of undifferentiated cell that possesses the ability to self-renew while retaining varying degrees of potential to form differentiated cells and tissues. The stem cells can be apotent stem cells, pluripotent stem cells, or totipotent stem cells. Apotent stem cells are derived stem cells that have lost their differentiation capacity. Totipotent stem cells can form all the cells and tissues found in a complete organism. For example, totipotent stem cells can form a complete organism.

[0124] In this application, the terms "pluripotent stem cell" and "multipotent stem cell" are used interchangeably and generally refer to stem cells capable of forming the cells and tissues eventually found in a complete organism, but not capable of forming a complete organism. For example, said multipotent stem cells can proliferate extensively or virtually indefinitely in vitro while maintaining their undifferentiated state and exhibiting a normal karyotype (chromosomes). The multipotent stem cells may have the ability to differentiate into all three germ layers (ectoderm, mesoderm, and endoderm) under suitable conditions. For example, said multipotent stem cells may include ES cells isolated from early embryos and / or EG cells isolated from fetal primordial germ cells.

[0125] In this application, the term "mesenchymal stem cell" generally refers to cells capable of generating mesenchymal lineages. The mesenchymal stem cells can be considered to belong to the category of pluripotent stem cells. The mesenchymal stem cells can generate one or more mesenchymal lineages. The cells of the mesenchymal lineage can be derived from various tissues, such as bone marrow tissue, adipose tissue, muscle tissue, reproductive tissue (e.g., amnion, amniotic fluid, or umbilical cord tissue), skin tissue, bone tissue, and / or dental tissue.

[0126] In this application, the term "immune cell" generally refers to cells that play a role in an immune response. The immune cells may include lymphocytes, monocytes, and / or granulocytes, as well as their precursors and / or mature derivatives. The immune cells may include T cells, B cells, Th cells, natural killer cells, monocytes, macrophages, eosinophils, basophils, mast cells, dendritic cells, and / or granulocytes. The immune cells may include immune effector cells. The immune effector cells may participate in immune responses, such as promoting immune effector responses. The immune effector cells may include T cells, such as α / β T cells and γ / δ T cells, B cells, natural killer (NK) cells, natural killer T (NTK) cells, mast cells, and bone marrow-derived phagocytes.

[0127] In this application, the term "fibroblast" generally refers to a non-functional fibroblast. The fibroblast can transform into a fibroblast (e.g., it can participate in the repair process when tissue is damaged). The fibroblast (also referred to as a fibroblast) can secrete structural proteins that constitute the extracellular matrix. The fibroblast can be closely associated with physiological or pathological processes such as wound healing and fibrosis.

[0128] In this application, the term "muscle cell" generally refers to a single cell or group of cells derived from muscle. The muscle cell may be derived from cells and tissues of skeletal muscle, smooth muscle (e.g., from the digestive tract, bladder, and blood vessels), and cardiac muscle. The muscle cell may include in vitro and in vivo muscle cells. The muscle cell may also include muscle cells and muscle tissue derived from differentiated and undifferentiated muscle cells such as myocytes (e.g., myotubes), dividing and differentiated myoblasts, cardiomyocytes, and cardiac myoblasts.

[0129] In this application, the term "plasmid" generally refers to a construct containing genetic material. The plasmid can be designed to deliver genetic material (e.g., one or more nucleic acid sequences) into a cell. The plasmid can contain autonomously replicating sequences of single-stranded or double-stranded nucleic acids (e.g., DNA or RNA) derived from any source. The term "plasmid" is used interchangeably with the term "vector" in this application. The plasmid can have different conformations, such as linear plasmids, circular plasmids, or supercoiled plasmids. The linear plasmid can be a linear DNA molecule. The supercoiled plasmid can contain two intact nucleic acid strands (e.g., it can contain covalently closed circular DNA, cccDNA) in a supercoiled conformation. The circular plasmid can have at least one nucleic acid strand maintaining an intact circular structure. The plasmid may not be integrated into the genome of a cell.

[0130] In this application, the term "multiple cloning site" or "MCS" generally refers to a nucleic acid sequence containing at least one restriction site. The multiple cloning site can link nucleic acid molecules to the vector described in this application; for example, the restriction site can be used to achieve the insertion of nucleic acid molecules at a designated site. The restriction site can be a restriction endonuclease recognition site. For example, the restriction endonuclease may be AclUHindIII, Sspl, MLuCI, Tsp509I, Pcil, AgeKBspMI, BfuAI, SexAI, MLuI, BceAI, HpyCH4IV, HpyCH4III, Bael, BsaXI, SpeI, Bsrl, Bmrl, BglII, AfeI, Alul, StuI, Seal, Clal, BspDI, PI-SceI, NsiI, Asel, Swal, CspCI, MfeI, BssSI, BmgBI, PmLl, Dralll, Alel, EcoP15I, PvuII, AlwNI, or BtsMutI.

[0131] In this application, the term "exogenous promoter" generally refers to a promoter that does not originate from its host. The exogenous promoter may be transfected and / or inserted into the cells of its host (e.g., the genome of the cell). The promoter may be a recognition site of a polynucleotide (DNA or RNA) to which an RNA polymerase binds. The RNA polymerase can efficiently catalyze the assembly of messenger RNA complementary to the appropriate DNA strand of the coding region. The number of promoters may be one or more.

[0132] In this application, the term "gene editing" generally refers to the operation of inserting, deleting, and / or replacing nucleic acids in the genome. The gene editing can be achieved through homology-directed repair (HDR), non-homologous end joining (NHEJ), or single-base alteration. The gene editing can be performed using gene editing tools familiar to those skilled in the art, such as zinc finger nuclease systems (ZFN), TALEN systems, and / or CRISPR technology.

[0133] In this application, the term "gene editing knock-in" generally refers to a genetic engineering process (e.g., a knock-in) involving the one-to-one replacement of DNA sequence information at a genetic site or the insertion of sequence information not found at an endogenous site. The gene editing knock-in can utilize homologous recombination. For example, in some cases, homologous recombination can be used to transfer a foreign functional gene (a gene not originally present in the genome or that has been inactivated) into a cell and perform homologous recombination with a homologous sequence in the genome, causing it to insert into the genome and be expressed within the cell. For example, the gene editing knock-in can cause a foreign gene to at least partially replace the cellular genome. The gene editing knock-in can use CRISPR technology to achieve targeted knock-in. As another example, the gene editing knock-in can use transposon and transposase systems, such as PiggyBac (PB) transposase and / or Sleeping Beauty (SB) transposase.

[0134] In this application, the term "donor plasmid" generally refers to a plasmid that can be transcribed and / or translated into a foreign gene encoded in a cell into which it is introduced. For example, the donor plasmid may be suitable for the gene-editing knock-in. For example, the donor plasmid may contain a nucleic acid molecule encoding the foreign gene. The donor plasmid may also contain elements such as a promoter to regulate the expression of the foreign gene (e.g., production and / or accumulation at the transcriptional and / or translational levels). The donor plasmid may be a plasmid suitable for eukaryotic expression systems.

[0135] In this application, the term "exogenous gene to be knocked in" generally refers to a heterologous gene that can be introduced through gene editing knock-in. The exogenous gene to be knocked in can be integrated into the object to which it is introduced (e.g., a cell, or a subject). The exogenous gene to be knocked in can include genes integrated into the genome of the object to which it is introduced. The exogenous gene to be knocked in can be a naturally occurring gene from a different species; it can also be an engineered gene (e.g., a chimeric gene).

[0136] In this application, the term "antibody" generally refers to an immunoglobulin that reacts to a specified protein or peptide or fragment thereof. Antibodies can be from any class, including but not limited to IgG, IgA, IgM, IgD, and IgE, and antibodies from any subclass (e.g., IgG1, IgG2, IgG3, and IgG4). Antibodies may have a heavy chain constant region selected from, for example, IgG1, IgG2, IgG3, or IgG4. Antibodies may also have a light chain selected from, for example, kappa (κ) or lambda (λ). The antibodies of this application can be derived from any species.

[0137] In this application, the term "antigen-binding fragment" generally refers to a portion of an antibody molecule containing amino acid residues that interact with an antigen and confer specificity and affinity of the antibody for the antigen. Examples of antigen-binding fragments may include, but are not limited to, Fab, Fab', F(ab)2, Fv fragments, F(ab')2, scFv, di-scFv, and / or dAb. In this application, the term "Fab" generally refers to a fragment containing a variable domain of the heavy chain and a variable domain of the light chain, and also containing a constant domain of the light chain and a first constant domain (CH1) of the heavy chain; the term "Fab'" generally refers to a fragment different from Fab by adding a small number of residues (including one or more cysteine ​​residues from the hinge region of the antibody) to the carboxyl terminus of the CH1 domain of the heavy chain; the term "F(ab')2" generally refers to a dimer of Fab', comprising an antibody fragment containing two Fab fragments connected by a disulfide bridge on the hinge region. The term "Fv" generally refers to the smallest antibody fragment containing a complete antigen recognition and binding site. In some cases, the fragment may consist of a dimer composed of a heavy chain variable region and a light chain variable region tightly non-covalently linked; the term "dsFv" generally refers to a disulfide-bonded Fv fragment, in which the bond between a single light chain variable region and a single heavy chain variable region is a disulfide bond. The term "dAb fragment" generally refers to an antibody fragment composed of a VH domain. In this application, the term "scFv" generally refers to a monovalent molecule formed by the covalent pairing of a heavy chain variable domain and a light chain variable domain of an antibody via a flexible peptide linker; such scFv molecules may have a general structure: NH2-VL-linker-VH-COOH or NH2-VH-linker-VL-COOH.

[0138] In this application, the term "bispecific antibody" generally refers to an antibody having a variable region that recognizes one or more epitopes on one or more antigens. Bispecific antibodies include, but are not limited to, full-length antibodies, antibodies having two or more VL and VH domains, antibody fragments such as Fab, Fv, dsFv, scFv, biantibodies, and antibody fragments that are covalently or non-covalently linked. In some cases, the bispecific antibody can recognize two different epitopes on the same or different antigens. In some cases, the bispecific antibody can recognize two different antigens. In this application, multispecific antibodies include bispecific or trispecific antibodies, or their antigen-binding fragments.

[0139] In this application, the term "antigen-binding domain" generally refers to a domain capable of binding to a target antigen. An antigen-binding domain may include a chimeric antigen receptor and its fragment capable of specifically binding to an antigen, an antibody, or its antigen-binding fragment. An antigen-binding domain may be a domain capable of binding to tumor-associated antigens. In this application, the tumor-associated antigens may include, but are not limited to: CD19, CD20, CD22, CD123, CD33 / IL3Ra, CD138, CD33, BCMA, CS1, C-Met, EGFRvIII, CEA, Her2, GD2, MAG3, GPC3, Claudin18.2, Mesothelin, and NY-ESO-1.

[0140] In this application, the term "chimeric antigen receptor" generally refers to a fusion protein comprising an extracellular domain capable of binding antigens and at least one intracellular domain. A CAR is a core component of a chimeric antigen receptor T cell (CAR-T), which may include an antigen-binding domain (e.g., tumor-specific antigens and / or tumor-associated antigens), a transmembrane domain, a co-stimulatory domain, and an intracellular signaling domain. In this application, the CAR may be combined with the T cell receptor-activating intracellular domain based on the antigen specificity of an antibody (e.g., CD19). Genetically modified T cells expressing CAR can specifically recognize and eliminate malignant cells expressing target antigens. For descriptions of CAR and CAR-T cells, see, for example, Sadelain M, Brentjens R, Rivi`ere I. The basic principles of chimeric antigen receptor design. CancerDiscov. 2013; 3(4):388-398; Turtle CJ, Hudecek M, Jensen MC, Riddell SR. Engineered T cells for anti-cancer therapy. Curr Opin Immunol. 2012; 24(5):633-639; Dotti G, Gottschalk S, Savoldo B, Brenner MK. Design and development of therapies using chimeric antigen receptor-expressing T cells. Immunol Rev. 2014; 257(1):107-126.

[0141] In this application, the term "BiTE" generally refers to a bispecific T-cell enager. The BiTE can be a single polypeptide chain molecule having two antigen-binding domains, one of which binds to a T-cell antigen and the second to an antigen present on the surface of a target cell (see WO05 / 061547; Baeuerle, P et al. (2008)). A New Class Of Antibodies That Recruit T Cells Drugs of the Future 33:137-147; or Bargou et al. (2008) "Tumor Regression in Cancer Patients by Very Low Doses of a T Cell-Engaging Antibody / 'Science 321:974-977).

[0142] In this application, the term "multi-protein" generally refers to a polypeptide chain containing multiple protein molecules that may be present in series within the polypeptide chain. In the polypeptide chain, any two protein molecules may optionally be separated by a cleavable portion (e.g., a 2A peptide).

[0143] In this application, the term "homologous arm" generally refers to a polynucleotide suitable for targeting a foreign gene to be knocked into the genome in a donor plasmid via homologous recombination. Homologous recombination can refer to recombination occurring between sister chromatids or between or within DNA molecules containing homologous sequences on the same chromosome. There can be two homologous arms (e.g., a 5' homologous arm and / or a 3' homologous arm). The homologous arms can be located upstream and downstream of the foreign gene to be knocked into in the donor plasmid. In some cases, the target site of the foreign gene to be knocked into the genome can be broken due to the action of nucleases. The homologous arm can be identical to or have at least 80% identity with the DNA sequence at both ends (i.e., the 5' and / or 3' ends) of the break at the target site. For example, the homologous arm may have at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identity with the DNA sequences at both ends of the break at the target site. In this application, the donor plasmid may contain a 5' homologous arm and / or a 3' homologous arm.

[0144] In this application, the term "cell viability" generally refers to the ability of cells to survive under certain conditions. Cell viability can be measured by the proportion of live cells to the total number of cells present under those conditions over a given period of time. Cell viability can reflect the effect of certain conditions on cells. For example, a higher cell viability indicates that the condition is more favorable to cell survival.

[0145] In this application, the term "cell proliferation capacity" generally refers to the ability of cells to proliferate and / or self-replicate. The cell proliferation capacity can be measured by the total number of cells produced by cell proliferation over a given period of time. For example, the greater the increase in cell number over a given period, the higher the cell proliferation capacity. The cell proliferation capacity can also be reflected in improved cell function (e.g., proliferation).

[0146] In this application, the term "cytotoxic capacity" generally refers to the ability of a cell to kill its target cells. For example, immune effector cells (e.g., T cells, NK cells) can mediate and kill target cells (e.g., tumor cells). This mediation can, for example, include the localization of the immune effector cell to the target cell (e.g., through mutual recognition of molecules and / or epitopes expressed by the immune effector cell and the target cell). The cytotoxic capacity can be measured by the number of target cells that die as a result of cell-mediated killing of target cells under certain time and conditions.

[0147] In this application, the term "cell secretory capacity" generally refers to the ability of a cell to secrete and produce secretory factors. For example, the secretory factor can be a molecule that leaves the cell upon secretion. The secretory factor may include a protein encoded by a foreign gene. Cellular secretory capacity can be measured by the amount of secretory factors produced by the cell under certain time and conditions.

[0148] In this application, the term "cell preservation capacity" generally refers to the ability of cells to survive and / or retain their original functions under preservation conditions. For example, preservation conditions may include long-term preservation at ambient temperature or low temperature (e.g., non-refrigerated temperature or refrigerated temperature, such as under liquid nitrogen conditions). Preservation can reduce the metabolic level of the cells and temporarily remove them from a growth state. The cells can be revived after preservation. The cell preservation capacity can be measured by the ratio of the number of cells after preservation to the number of cells before preservation under certain time and conditions.

[0149] In this application, the term "cell resuscitation capability" generally refers to the ability of cells to resume growth after reculture. Reculture can refer to thawing cells frozen in liquid nitrogen or a -80°C freezer and then reculturing them. Cell resuscitation capability can be measured by the ratio of the number of cells that resume growth after reculture under certain time and conditions to the total number of cells recultured.

[0150] In this application, the term "cell line" generally refers to a clonal population of cells capable of continuing to divide. For example, said cell line may have acquired the ability to proliferate indefinitely in vitro.

[0151] In this application, the term "complementary" generally refers to Watson-Crick base pairing between nucleotides, and specifically to nucleotides that are hydrogen-bonded to each other, wherein thymine or uracil residues are linked to adenine residues by two hydrogen bonds, and cytosine and guanine residues are linked by three hydrogen bonds. Typically, nucleic acids comprise nucleotide sequences described as having "percent complementarity" with a specified second nucleotide sequence. For example, a nucleotide sequence may have 80%, 90%, or 100% complementarity with a specified second nucleotide sequence, meaning that 8 out of 10 nucleotides, 9 out of 10 nucleotides, or 10 out of 10 nucleotides of the sequence are complementary to the specified second nucleotide sequence. For example, the nucleotide sequence 3'-TCGA-5' is 100% complementary to the nucleotide sequence 5'-AGCT-3'. Furthermore, a region of the nucleotide sequence 3'-TCGA- is 100% complementary to the nucleotide sequence 5'-TTAGCTGG-3'. Those skilled in the art will recognize that two complementary nucleotide sequences include sense strands and antisense strands.

[0152] In this application, the terms "homology," "identity," or "similarity" generally refer to the sequence similarity between two peptides or two nucleic acid molecules. The term "homologous region" generally refers to a region on a donor molecule that shares a certain degree of homology with a target sequence. Homology can be determined by comparing positions in individual sequences. For example, sequence alignment can be used to determine homology between sequences. When a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of shared matching or homologous positions. An "unrelated" or "non-homologous" sequence shares less than 40% identity with one of the sequences of this application, although preferably less than 25%. A percentage (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%) of “sequence identity” or “homology” between a polynucleotide or polynucleotide region (or polypeptide or polypeptide region) and another sequence means that, at the time of alignment, that percentage of bases (or amino acids) are identical in the two sequences being compared. This alignment and percentage homology or sequence identity can be determined using software programs known in the art, such as those described in Ausubel et al. (2007) Current Protocols in Molecular Biology.

[0153] In this application, the term "transfection" generally refers to a method for introducing a biologically active substance (e.g., nucleic acid, protein, enzyme, or small molecule) into a cell. Nucleic acid can be DNA (delivered as a plasmid or oligomer) and / or RNA or a combination thereof.

[0154] In this application, the term "electroporation" generally refers to a transfection method in which an external electric field is applied to cells. In some embodiments, the electroporation method used is electrostatic poration.

[0155] Unless the context otherwise requires, the terms “comprising,” “having,” and “including” are used interchangeably in this application and generally refer to the inclusion of other components, elements, values, steps, etc. In some cases, “comprising” covers the meaning of “is” or “consisting of,” for example, based on the description of a composition “comprising” component “A,” those skilled in the art would infer that in some cases, the composition may consist of component A alone.

[0156] In this application, the term "about" generally refers to a specified value or numerical range within 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.05% of the value or range involved in this application. In this application, when the term "about" precedes the first of two or more values, it applies to each value in that series. Invention Details

[0158] On one hand, this application provides a method for improving transfection (e.g., electrotransfer) efficiency, comprising the following steps: making the size at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 Mb, to The content of nucleic acid molecules or fragments thereof of at least about 10 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb or greater, accounts for less than 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 9‰, less than about 8‰, less than about 7‰, less than about 6‰, less than about 5.5‰, less than about 5‰, less than about 4.5‰, less than about 4‰, less than about 3.5‰, less than about 3‰, less than about 2.5‰, less than about 2‰, less than about 1.5‰, less than about 1‰, less than about 0.5‰, less than about 0.1‰, less than about 0.01‰, less than about 0.001‰ or lower). The percentage can be a weight percentage (w / w%).

[0159] On the other hand, this application provides a method for improving the editing efficiency of gene editing (e.g., in vitro gene editing of cells), which includes the following steps: making a size of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least...). The content of nucleic acid molecules or fragments thereof of approximately 9 Mb, at least approximately 10 Mb, at least approximately 20 Mb, at least approximately 50 Mb, at least approximately 100 Mb, at least approximately 200 Mb or greater, constitutes less than 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than approximately 10%, less than approximately 9%, less than approximately 8%, less than approximately 7%, less than approximately 6%, less than approximately 5%, less than approximately 4%, less than approximately 3%, less than approximately 2.5%, less than approximately 2%). Below, approximately 1.5%, approximately 1%, approximately 9‰, approximately 8‰, approximately 7‰, approximately 6‰, approximately 5.5‰, approximately 5‰, approximately 4.5‰, approximately 4‰, approximately 3.5‰, approximately 3‰, approximately 2.5‰, approximately 2‰, approximately 1.5‰, approximately 1‰, approximately 0.5‰, approximately 0.1‰, approximately 0.01‰, approximately 0.001‰ or lower). The percentages may be weight percentages (w / w%).

[0160] On the other hand, this application provides a method for improving the efficiency of DNA homologous recombination (e.g., homologous recombination in vitro and in cells), comprising the steps of: making a size of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb). The content of nucleic acid molecules or fragments thereof at least approximately 9 Mb, at least approximately 10 Mb, at least approximately 20 Mb, at least approximately 50 Mb, at least approximately 100 Mb, at least approximately 200 Mb or greater, constitutes less than 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than approximately 10%, less than approximately 9%, less than approximately 8%, less than approximately 7%, less than approximately 6%, less than approximately 5%, less than approximately 4%, less than approximately 3%, less than approximately 2.5%, or less than approximately 2%). The percentages are as follows: below 1.5%, below 1%, below 9‰, below 8‰, below 7‰, below 6‰, below 5.5‰, below 5‰, below 4.5‰, below 4‰, below 3.5‰, below 3‰, below 2.5‰, below 2‰, below 1.5‰, below 1‰, below 0.5‰, below 0.1‰, below 0.01‰, below 0.001‰ or lower. The percentages may be weight percentages (w / w%).

[0161] On the other hand, this application provides a method for avoiding a decrease in cell viability after transfection, comprising the following steps: making cells at least about 10 kb in size (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 Mb). The content of nucleic acid molecules or fragments thereof of at least about 10 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb or greater, accounts for less than 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 9‰, less than about 8‰, less than about 7‰, less than about 6‰, less than about 5.5‰, less than about 5‰, less than about 4.5‰, less than about 4‰, less than about 3.5‰, less than about 3‰, less than about 2.5‰, less than about 2‰, less than about 1.5‰, less than about 1‰, less than about 0.5‰, less than about 0.1‰, less than about 0.01‰, less than about 0.001‰ or lower). The percentage can be a weight percentage (w / w%).

[0162] On the other hand, this application provides a method for preparing a transfection mixture, comprising the following steps: making a sample at least about 10 kb in size (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 Mb, at least about 1 ... The content of nucleic acid molecules or fragments thereof of 0 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb or greater, accounts for less than about 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 9‰, less than about 8‰, less than about 7‰, less than about 6‰, less than about 5.5‰, less than about 5‰, less than about 4.5‰, less than about 4‰, less than about 3.5‰, less than about 3‰, less than about 2.5‰, less than about 2‰, less than about 1.5‰, less than about 1‰, less than about 0.5‰, less than about 0.1‰, less than about 0.01‰, less than about 0.001‰ or lower). The percentage can be a weight percentage (w / w%).

[0163] On the other hand, this application provides a method for determining the quality of a transfection mixture, comprising the following steps: determining a size of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 M ...1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about 1 Mb, at least about Whether the content of nucleic acid molecules or fragments of 10 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb or greater, accounts for less than about 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 9‰, less than about 8‰, less than about 7‰, less than about 6‰, less than about 5.5‰, less than about 5‰, less than about 4.5‰, less than about 4‰, less than about 3.5‰, less than about 3‰, less than about 2.5‰, less than about 2‰, less than about 1.5‰, less than about 1‰, less than about 0.5‰, less than about 0.1‰, less than about 0.01‰, less than about 0.001‰ or lower). The percentage can be a weight percentage (w / w%).

[0164] On the other hand, this application provides a method for improving transfection efficiency (e.g., an in vitro method), comprising the following steps: ensuring that the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) accounts for less than about 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 9‰, less than about 8‰, less than about 7‰, less than about 6‰, less than about 5.5‰, less than about 5‰, less than about 4.5‰, less than about 4‰, less than about 3.5‰, less than about 3‰, less than about 2.5‰, less than about 2‰, less than about 1.5‰, less than about 1‰, less than about 0.5‰, less than about 0.1‰, less than about 0.01‰, less than about 0.001‰ or lower). The percentage can be a weight percentage (w / w%).

[0165] On the other hand, this application provides a method (e.g., an in vitro method) for improving the editing efficiency of gene editing, comprising the following steps: making the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) account for less than about 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 9‰, less than about 8‰, less than about 7‰, less than about 6‰, less than about 5.5‰, less than about 5‰, less than about 4.5‰, less than about 4‰, less than about 3.5‰, less than about 3‰, less than about 2.5‰, less than about 2‰, less than about 1.5‰, less than about 1‰, less than about 0.5‰, less than about 0.1‰, less than about 0.01‰, less than about 0.001‰ or lower). The percentage can be a weight percentage (w / w%).

[0166] On the other hand, this application provides a method (e.g., an in vitro method) for improving the efficiency of DNA homologous recombination, comprising the following steps: ensuring that the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) is less than about 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 9‰, less than about 8‰, less than about 7‰, less than about 6‰, less than about 5.5‰, less than about 5‰, less than about 4.5‰, less than about 4‰, less than about 3.5‰, less than about 3‰, less than about 2.5‰, less than about 2‰, less than about 1.5‰, less than about 1‰, less than about 0.5‰, less than about 0.1‰, less than about 0.01‰, less than about 0.001‰ or lower). The percentage may be a weight percentage (w / w%).

[0167] On the other hand, this application provides a method for improving the cell viability of transfected cells (e.g., a method for avoiding a decrease in cell viability after transfection), which includes the following steps: making the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) account for less than about 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 9‰, less than about 8‰, less than about 7‰, less than about 6‰, less than about 5.5‰, less than about 5‰, less than about 4.5‰, less than about 4‰, less than about 3.5‰, less than about 3‰, less than about 2.5‰, less than about 2‰, less than about 1.5‰, less than about 1‰, less than about 0.5‰, less than about 0.1‰, less than about 0.01‰, less than about 0.001‰ or lower). The percentage can be a weight percentage (w / w%).

[0168] On the other hand, this application provides a method for preparing a transfection mixture, comprising the following steps: making the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) account for less than about 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 9‰, less than about 8‰, less than about 7‰, less than about 6‰, less than about 5.5‰, less than about 5‰, less than about 4.5‰, less than about 4‰, less than about 3.5‰, less than about 3‰, less than about 2.5‰, less than about 2‰, less than about 1.5‰, less than about 1‰, less than about 0.5‰, less than about 0.1‰, less than about 0.01‰, less than about 0.001‰ or lower). The percentage can be a weight percentage (w / w%).

[0169] On the other hand, this application provides a method for determining the quality of a transfection mixture, comprising the following steps: determining whether the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) accounts for less than about 10% of the total nucleic acid molecule content of the transfection mixture (e.g., less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 9‰, less than about 8‰, less than about 7‰, less than about 6‰, less than about 5.5‰, less than about 5‰, less than about 4.5‰, less than about 4‰, less than about 3.5‰, less than about 3‰, less than about 2.5‰, less than about 2‰, less than about 1.5‰, less than about 1‰, less than about 0.5‰, less than about 0.1‰, less than about 0.01‰, less than about 0.001‰ or lower). The percentage can be a weight percentage (w / w%).

[0170] On one hand, this application provides a method for modifying cells. This method can be an in vitro method or an ex vivo method. The method may include: transfecting cells to be modified with a transfection composition to cause the cells to contain and / or express a foreign gene, wherein the transfection composition contains a foreign nucleic acid molecule containing the foreign gene, at least a portion (e.g., at least 1 w / w%, at least 5 w / w%, at least 10 w / w%, at least 15 w / w%, at least 20 w / w%, at least 25 w / w%, at least 30 w / w%, at least 35 w / w%, at least 40 w / w%, at least 45 w / w%, at least 50 w / w%, at least 55 w / w%, at least 60 w / w%, at least 65 w / w%, at least 70 w / w%, at least 75 w / w%, at least 80 w / w%, at least 85 w / w%, at least 90 w / w%, at least 95 w / w%, at least 99 w / w%, at least 100 w / w%) of the foreign nucleic acid molecule is obtained from a host cell, and the genomic DNA of the host cell accounts for a percentage of the DNA obtained from the host cell. The amount of the exogenous nucleic acid molecule is less than approximately 10% (w / w) (e.g., less than approximately 9% (w / w), less than approximately 8% (w / w), less than approximately 7% (w / w), less than approximately 6% (w / w), less than approximately 5% (w / w), less than approximately 4% (w / w), less than approximately 3% (w / w), less than approximately 2% (w / w), less than approximately 1.5% (w / w), less than approximately 1% (w / w), less than approximately 0.9% (w / w), less than approximately 0.8% (w / w), less than approximately 0.8% (w / w). Below / w), approximately 7‰ (w / w) or less, approximately 6‰ (w / w) or less, approximately 5‰ (w / w) or less, approximately 4‰ (w / w) or less, approximately 3‰ (w / w) or less, approximately 2‰ (w / w) or less, approximately 1.5‰ (w / w) or less, approximately 1‰ (w / w) or less, approximately 0.5‰ (w / w) or less, approximately 0.1‰ (w / w) or less, approximately 0.01‰ (w / w) or less, approximately 0.001‰ (w / w) or less (or lower).

[0171] On the other hand, this application provides a method for improving the transfection efficiency of exogenous nucleic acid molecules obtained from host cells to cells, the method comprising: reducing the content of host cell genomic DNA in the exogenous nucleic acid molecule obtained from the host cell.

[0172] In some embodiments, the composition used for transfection contains a foreign nucleic acid molecule to be transfected into the cells, and at least a portion (e.g., at least 1 w / w%, at least 5 w / w%, at least 10 w / w%, at least 15 w / w%, at least 20 w / w%, at least 25 w / w%, at least 30 w / w%, at least 35 w / w%, at least 40 w / w%, at least 45 w / w%, at least 50 w / w%, at least 55 w / w%, at least 60 w / w%, at least 65 w / w%, at least 70 w / w%, at least 75 w / w%, at least 80 w / w%, at least 85 w / w%, at least 90 w / w%, at least 95 w / w%, at least 99 w / w%, at least 100 w / w%) of the foreign nucleic acid molecule is the foreign nucleic acid molecule obtained from the host cell (e.g., extracted from the host cell).

[0173] In some embodiments, after the reduction, the content of genomic DNA in the host cell is less than about 10% (w / w) (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w), less than about 5% (w / w), less than about 4% (w / w), less than about 3% (w / w), less than about 2% (w / w), less than about 1.5% (w / w), less than about 1% (w / w), less than 9‰ (w / w). Below / w), approximately 8‰ (w / w) or less, approximately 7‰ (w / w) or less, approximately 6‰ (w / w) or less, approximately 5‰ (w / w) or less, approximately 4‰ (w / w) or less, approximately 3‰ (w / w) or less, approximately 2‰ (w / w) or less, approximately 1.5‰ (w / w) or less, approximately 1‰ (w / w) or less, approximately 0.5‰ (w / w) or less, approximately 0.1‰ (w / w) or less, approximately 0.01‰ (w / w) or less, approximately 0.001‰ (w / w) or less (or lower).

[0174] On the other hand, this application provides a method for improving the transfection efficiency of exogenous nucleic acid molecules obtained from host cells, the method comprising: treating the exogenous nucleic acid molecules with DNase. In some embodiments, the DNase is capable of nonspecifically cleaving linear DNA. In some embodiments, the DNase comprises an exonuclease. In some embodiments, the treatment includes Mg... 2+ and Ca 2+ The presence of [a substance] allows the exogenous nucleic acid molecule to come into contact with the DNase.

[0175] On the other hand, this application provides a method for optimizing a transfection composition, the transfection composition comprising a foreign nucleic acid molecule obtained from a host cell, the method comprising: reducing the content of the host cell genomic DNA in the portion of the foreign nucleic acid molecule obtained from the host cell.

[0176] In some embodiments, after the optimization, the content of the host cell's genomic DNA is less than about 10% (w / w) (e.g., less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2.5%, less than about 2%, less than about 1.5%, less than about 1%, less than about 9‰, less than about 8‰, less than about 7‰, less than about 6‰, less than about 5.5‰, less than about 5‰, less than about 4.5‰, less than about 4‰, less than about 3.5‰, less than about 3‰, less than about 2.5‰, less than about 2‰, less than about 1.5‰, less than about 1‰, less than about 0.5‰, less than about 0.1‰, less than about 0.01‰, less than about 0.001‰ or lower; all are mass percentages).

[0177] On the other hand, this application provides a method for optimizing a transfection composition comprising a foreign nucleic acid molecule moiety derived from a host cell, the method comprising treating the foreign nucleic acid molecule moiety derived from the host cell with a DNase. In some embodiments, the DNase is capable of nonspecifically cleaving linear DNA. In some embodiments, the DNase comprises an exonuclease. In some embodiments, the treatment includes Mg... 2+ and Ca 2+ The presence of this allows the exogenous nucleic acid molecule derived from the host cell to come into contact with the DNase.

[0178] In this application, compared with exogenous nucleic acid molecules that have not been treated with the deoxyribonuclease (DNase), the transfection efficiency of cells transfected with exogenous nucleic acid molecules treated with the deoxyribonuclease (DNase) can be increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 1.0%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 1000%, or more.

[0179] The method in this application can be an in vitro method or an ex vivo method.

[0180] In this application, the transfection efficiency of the transfection composition (exogenous nucleic acid molecule or plasmid) on cells can be determined by the following methods: 1) measuring the proportion of transfected cells expressing the exogenous gene, wherein the transfection composition (or plasmid) contains an exogenous nucleic acid molecule containing the exogenous gene; and / or 2) measuring the proportion of transfected cells containing the exogenous gene, wherein the transfection composition contains an exogenous nucleic acid molecule containing the exogenous gene.

[0181] On the other hand, this application provides the use of the aforementioned reagents (e.g., deoxyribonuclease (DNase), SDS, TX-100, CTAB and / or cesium chloride-ethidium bromide) for optimizing transfection compositions.

[0182] On the other hand, this application provides a transfection (e.g., electroporation) kit. The kit comprises: 1) a foreign nucleic acid molecule derived from a host cell as described in any aspect of this application; and 2) a reagent capable of reducing or degrading the genomic DNA of the host cell. In some embodiments, the reagent 2) comprises one or more selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. In some embodiments, the DNase is capable of nonspecifically cleaving linear DNA. In some embodiments, the DNase comprises an exonuclease. In some embodiments, the kit further comprises Mg... 2+ and Ca 2+ The reagent.

[0183] On the other hand, this application provides a kit for improving plasmid transfection efficiency, comprising deoxyribonuclease (DNase) and reagents and / or instruments required for transient transfection. In this application, the reagents required for transient transfection may include reagents required for electroporation. For example, the reagents required for electroporation may include ddH2O and / or glycerol. For example, the instruments required for electroporation may include an electroporator, an electroporation cuvette, and / or a centrifuge.

[0184] In this application, the kit may further include reagents and / or instruments required to obtain the transformed cells needed for the electroporation. For example, the transformed cells may be stored at ultra-low temperatures (e.g., -70°C). In this application, the voltage of the electroporator may be approximately 1500-2500V when performing the electroporation. In this application, the electroporation cuvette may be adapted to be placed under ultra-low temperature conditions for performing the electroporation.

[0185] In this application, the DNase can cleave single-stranded DNA and / or double-stranded DNA. For example, the DNase can non-specifically cleave linear DNA. For example, the DNase may include an exonuclease. For example, the DNase may contain no RNase. In some embodiments, the DNase cannot cleave circular DNA. In some embodiments, the DNase cannot cleave single-stranded DNA.

[0186] In this application, the kit may further include a buffer solution, which may contain Mg 2+ and Ca 2+ For example, the buffer solution can be the reaction buffer corresponding to the DNase. In this application, the kit may also contain deionized water (e.g., DEPC-treated) required for DNase hydrolysis of DNA.

[0187] On the other hand, this application provides a kit comprising: 1) an exogenous nucleic acid molecule portion derived from a host cell as described in any aspect of this application; and 2) an instruction manual describing the treatment of the exogenous nucleic acid molecule portion derived from the host cell of 1) by the method of this application and / or the determination of the quality of the transfection composition containing the exogenous nucleic acid molecule portion derived from the host cell by the method of this application.

[0188] On the other hand, this application provides a transfection composition comprising exogenous nucleic acid molecules treated by the methods described in this application.

[0189] On the other hand, this application provides cells transfected with the transfection composition described in this application.

[0190] On the other hand, this application provides cells modified by the methods described in this application.

[0191] On the other hand, this application provides a cell population comprising the cells described in this application and / or their descendants. For example, the cell population may contain at least 10 3 (e.g., at least 10) 4 One, at least 10 5 One, at least 10 6 One, at least 10 7 One, at least 10 8 One, at least 10 9 One, at least 10 10 (one or more) cells.

[0192] On the other hand, this application provides a pharmaceutical composition comprising the transfection composition described in this application, the cells described in this application, and / or the cell population described in this application. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant. The pharmaceutically acceptable adjuvant may include, for example, a substance that does not cause significant irritation to the organism and does not significantly negatively affect the biological activity and properties of the administered active ingredient (e.g., the modified cells or cell population). For example, the pharmaceutically acceptable adjuvant may include, but is not limited to: diluents, buffers, binders, surfactants, humectants, adsorbents, lubricants, fillers, and / or disintegrants.

[0193] On the other hand, this application provides the use of the transfection composition, cells, cell populations, and / or pharmaceutical compositions described in this application for the preparation of a medicament. In some embodiments, the medicament is used for the prevention, treatment, and / or alleviation of cancer. In some embodiments, the medicament is used to modulate an immune response.

[0194] On the other hand, this application provides a method for preventing, treating, and / or alleviating a disease or condition in a subject, the method comprising administering to the subject an effective amount of the transfection composition described in this application, the cells described in this application, the cell population described in this application, and / or the pharmaceutical composition described in this application. In some embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is related to the subject's immune response.

[0195] On the other hand, this application provides an electroporation method (e.g., a plasmid electroporation method), the method comprising: electroporating cells with a transfection composition containing a plasmid encoding one or more exogenous genes, so that the cells contain and / or express the one or more exogenous genes, wherein the plasmid is extracted from a host cell, and the content of the host cell's genomic DNA in the transfection composition is less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w), less than about 5% (w / w), less than 4% (w / w). Below w), approximately 3% (w / w), approximately 2% (w / w), approximately 1.5% (w / w), approximately 1% (w / w), approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower.

[0196] On the other hand, this application provides an electroporation method, the method comprising: electroporating cells with a transfection composition containing a plasmid encoding a foreign gene, so that the cells contain and / or express the foreign gene, wherein the size of the foreign gene is at least about 3 kb (e.g., at least about 3.5 kb, at least about 4 kb, at least about 4.5 kb, at least about 5 kb, at least about 5.5 kb, at least about 6 kb, at least about 6.5 kb, at least about 7 kb, at least about 7.5 kb, at least about 8 kb, at least about 8.5 kb, at least about 9 kb or greater), the plasmid being extracted from a host cell, and the content of the host cell's genomic DNA contained in the transfection composition being about 10% (w / w) or less (e.g., about 9% (w / w) of the plasmid DNA content in the transfection composition). Below w), approximately 8% (w / w), approximately 7% (w / w), approximately 6% (w / w), approximately 5% (w / w), approximately 4% (w / w), approximately 3% (w / w), approximately 2% (w / w), approximately 1.5% (w / w), approximately 1% (w / w), approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w) (Approximately 6‰ (w / w) or less, approximately 5‰ (w / w) or less, approximately 4‰ (w / w) or less, approximately 3‰ (w / w) or less, approximately 2‰ (w / w) or less, approximately 1.5‰ (w / w) or less, approximately 1‰ (w / w) or less, approximately 0.5‰ (w / w) or less, approximately 0.1‰ (w / w) or less, approximately 0.01‰ (w / w) or less, approximately 0.001‰ (w / w) or less).

[0197] On the other hand, this application provides an electroporation method (e.g., a plasmid electroporation method), the method comprising: electroporating cells (e.g., immune cells, such as T cells) with a transfection composition containing a plasmid encoding a chimeric antigen receptor (CAR), such that the cells (e.g., immune cells, such as T cells) contain and / or express the CAR, wherein the plasmid is extracted from a host cell, and the content of the host cell's genomic DNA contained in the transfection composition is less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w), less than about 5% (w / w). Below / w), approximately 4% (w / w), approximately 3% (w / w), approximately 2% (w / w), approximately 1.5% (w / w), approximately 1% (w / w), approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower).

[0198] On the other hand, this application provides an electroporation method (e.g., a plasmid electroporation method), the method comprising: electroporating cells (e.g., immune cells, such as T cells) with a transfection composition containing a plasmid encoding a chimeric antigen receptor (CAR) and one or more second proteins (e.g., cytokines, antibodies, and / or chemokines), such that the cells (e.g., immune cells, such as T cells) contain and / or express the CAR and the one or more second proteins, wherein the plasmid is extracted from a host cell, and the content of the host cell's genomic DNA contained in the transfection composition is less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), or less than 7% (w / w). Below, approximately 6% (w / w), approximately 5% (w / w), approximately 4% (w / w), approximately 3% (w / w), approximately 2% (w / w), approximately 1.5% (w / w), approximately 1% (w / w), approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower).

[0199] On the other hand, this application provides an electroporation method (e.g., a plasmid electroporation method), the method comprising: electroporating cells (e.g., immune cells, such as T cells) with a transfection composition containing a plasmid encoding a chimeric antigen receptor (CAR) and a multispecific antibody or an antigen-binding fragment thereof (e.g., BiTE), such that the cells (e.g., immune cells, such as T cells) contain and / or express the CAR and the multispecific antibody or an antigen-binding fragment thereof, wherein the plasmid is extracted from a host cell, and the content of the host cell's genomic DNA contained in the transfection composition is less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), or less than 7% (w / w). Below, approximately 6% (w / w), approximately 5% (w / w), approximately 4% (w / w), approximately 3% (w / w), approximately 2% (w / w), approximately 1.5% (w / w), approximately 1% (w / w), approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower).

[0200] On the other hand, this application provides an electroporation method (e.g., a plasmid electroporation method), the method comprising: electroporating cells (e.g., immune cells, such as T cells) with a transfection composition containing a plasmid encoding a multispecific antibody or an antigen-binding fragment thereof (e.g., BiTE), such that the cells (e.g., immune cells, such as T cells) contain and / or express the multispecific antibody or the antigen-binding fragment thereof, wherein the plasmid is extracted from a host cell, and the content of the host cell's genomic DNA contained in the transfection composition is less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w). Below / w), approximately 5% (w / w), approximately 4% (w / w), approximately 3% (w / w), approximately 2% (w / w), approximately 1.5% (w / w), approximately 1% (w / w), approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower).

[0201] On the other hand, this application provides an electroporation method (e.g., a plasmid electroporation method), the method comprising: electroporating cells (e.g., immune cells, such as T cells) with a transfection composition containing a plasmid encoding a chimeric antigen receptor (CAR), one or more cytokines and / or chemokines, and a multispecific antibody or an antigen-binding fragment thereof (e.g., BiTE), such that the cells (e.g., immune cells, such as T cells) contain and / or express the CAR, the one or more cytokines and / or chemokines, and the multispecific antibody or an antigen-binding fragment thereof, wherein the plasmid is extracted from a host cell, and the content of the host cell's genomic DNA contained in the transfection composition is less than or equal to about 10% (w / w) (e.g., about 9% (w / w)) of the plasmid DNA content in the transfection composition. Below, approximately 8% (w / w) or less, approximately 7% (w / w) or less, approximately 6% (w / w) or less, approximately 5% (w / w) or less, approximately 4% (w / w) or less, approximately 3% (w / w) or less, approximately 2% (w / w) or less, approximately 1.5% (w / w) or less, approximately 1% (w / w) or less, approximately 9‰ (w / w) or less, approximately 8‰ (w / w) or less, approximately 7‰ (w / w) or less, approximately Below 6‰ (w / w), below approximately 5‰ (w / w), below approximately 4‰ (w / w), below approximately 3‰ (w / w), below approximately 2‰ (w / w), below approximately 1.5‰ (w / w), below approximately 1‰ (w / w), below approximately 0.5‰ (w / w), below approximately 0.1‰ (w / w), below approximately 0.01‰ (w / w), below approximately 0.001‰ (w / w) or lower.

[0202] On the other hand, this application provides an electroporation method (e.g., a plasmid electroporation method), the method comprising: electroporating cells (e.g., immune cells, such as T cells) with a transfection composition containing a plasmid encoding one or more cytokines and / or chemokines, and a multispecific antibody or its antigen-binding fragment (e.g., BiTE), such that the cells (e.g., immune cells, such as T cells) contain and / or express the one or more cytokines and / or chemokines, and the multispecific antibody or its antigen-binding fragment, wherein the plasmid is extracted from a host cell, and the content of the host cell's genomic DNA contained in the transfection composition is less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), about 8% (w / w)). Below, approximately 7% (w / w), below 6% (w / w), below 5% (w / w), below 4% (w / w), below 3% (w / w), below 2% (w / w), below 1.5% (w / w), below 1% (w / w), below 9‰ (w / w), below 8‰ (w / w), below 7‰ (w / w), below 6‰ (w / w), below 5‰ (w / w), below 4‰ (w / w), below 3‰ (w / w), below 2‰ (w / w), below 1.5‰ (w / w), below 1‰ (w / w), below 0.5‰ (w / w), below 0.1‰ (w / w), below 0.01‰ (w / w), below 0.001‰ (w / w) or lower).

[0203] On the other hand, this application provides a one-step electroporation method, the method comprising: electroporating cells with a transfection composition containing a plasmid encoding a foreign gene, such that the cells contain and / or express the foreign gene (e.g., the foreign gene is knocked into the genome of the cell) and one or more endogenous genes in the cell genome are knocked out, the foreign gene being at least about 3 kb in size (e.g., at least about 3.5 kb, at least about 4 kb, at least about 4.5 kb, at least about 5 kb, at least about 5.5 kb, at least about 6 kb, at least about 6.5 kb, at least about 7 kb, at least about 7.5 kb, at least about 8 kb, at least about 8.5 kb, at least about 9 kb or greater). In some embodiments, the plasmid is extracted from a host cell. In some embodiments, the content of the host cell genomic DNA contained in the transfection composition is less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w), less than about 5% (w / w), less than about 4% (w / w), less than about 3% (w / w), less than about 2% (w / w), less than about 1.5% (w / w), or less than 1% (w / w). Below, approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower.

[0204] On the other hand, this application provides a one-step electroporation method, the method comprising: electroporating cells with a transfection composition containing a plasmid encoding a foreign gene, such that the cells contain and / or express the foreign gene (e.g., the foreign gene is knocked into the cell's genome) and one or more endogenous genes in the cell's genome are knocked out, the foreign gene encoding a CAR. In some embodiments, the plasmid is extracted from a host cell. In some embodiments, the content of the host cell's genomic DNA contained in the transfection composition is less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w), less than about 5% (w / w), less than about 4% (w / w), less than about 3% (w / w), less than about 2% (w / w), less than about 1.5% (w / w), or less than 1% (w / w). Below, approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower.

[0205] On the other hand, this application provides a one-step electroporation method, the method comprising: electroporating cells with a transfection composition containing a plasmid encoding a foreign gene, such that the cells contain and / or express the foreign gene (e.g., the foreign gene is knocked into the cell's genome) and one or more endogenous genes in the cell's genome are knocked out, the foreign gene encoding a multispecific antibody or an antigen-binding fragment thereof (e.g., BiTE). In some embodiments, the plasmid is extracted from a host cell. In some embodiments, the genomic DNA of the host cell contained in the transfection composition accounts for less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w), less than about 5% (w / w), less than about 4% (w / w), less than about 3% (w / w), less than about 2% (w / w), less than about 1.5% (w / w), or less than 1% (w / w). Below, approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower.

[0206] On the other hand, this application provides a one-step electroporation method, the method comprising: electroporating cells with a transfection composition containing a plasmid encoding a foreign gene, such that the cells contain and / or express the foreign gene (e.g., the foreign gene is knocked into the cell's genome) and one or more endogenous genes in the cell's genome are knocked out, the foreign gene encoding a CAR and one or more cytokines and / or chemokines. In some embodiments, the plasmid is extracted from a host cell. In some embodiments, the genomic DNA of the host cell contained in the transfection composition accounts for less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w), less than about 5% (w / w), less than about 4% (w / w), less than about 3% (w / w), less than about 2% (w / w), less than about 1.5% (w / w), or less than 1% (w / w). Below, approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower.

[0207] On the other hand, this application provides a one-step electroporation method, the method comprising: electroporating cells with a transfection composition containing a plasmid encoding a foreign gene, such that the cells contain and / or express the foreign gene (e.g., the foreign gene is knocked into the cell's genome) and one or more endogenous genes in the cell's genome are knocked out, the foreign gene encoding a CAR and a multispecific antibody or its antigen-binding fragment (e.g., BiTE). In some embodiments, the plasmid is extracted from host cells. In some embodiments, the genomic DNA of the host cells contained in the transfection composition accounts for less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w), less than about 5% (w / w), less than about 4% (w / w), less than about 3% (w / w), less than about 2% (w / w), less than about 1.5% (w / w), or less than 1% (w / w). Below, approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower.

[0208] On the other hand, this application provides a one-step electroporation method, the method comprising: electroporating cells with a transfection composition containing a plasmid encoding a foreign gene, such that the cells contain and / or express the foreign gene (e.g., the foreign gene is knocked into the genome of the cell) and one or more endogenous genes in the cell genome are knocked out, the foreign gene encoding a CAR, one or more cytokines and / or chemokines, and a multispecific antibody or its antigen-binding fragment (e.g., BiTE). In some embodiments, the plasmid is extracted from host cells. In some embodiments, the content of the host cell genomic DNA contained in the transfection composition is less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w), less than about 5% (w / w), less than about 4% (w / w), less than about 3% (w / w), less than about 2% (w / w), less than about 1.5% (w / w), or less than 1% (w / w). Below, approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower.

[0209] On the other hand, this application provides a one-step electroporation method, the method comprising: electroporating cells with a transfection composition containing a plasmid encoding a foreign gene, such that the cells contain and / or express the foreign gene (e.g., the foreign gene is knocked into the genome of the cell) and one or more endogenous genes in the cell genome are knocked out, the foreign gene encoding one or more cytokines and / or chemokines and multispecific antibodies or antigen-binding fragments thereof (e.g., BiTE). In some embodiments, the plasmid is extracted from host cells. In some embodiments, the content of the host cell genomic DNA contained in the transfection composition is less than about 10% (w / w) of the plasmid DNA content in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w), less than about 5% (w / w), less than about 4% (w / w), less than about 3% (w / w), less than about 2% (w / w), less than about 1.5% (w / w), or less than 1% (w / w). Below, approximately 9‰ (w / w), approximately 8‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w) or lower.

[0210] In some embodiments, the electroporation method described in this application is a one-step electroporation method, that is, the knock-in and / or knock-out of the exogenous gene is completed in one electroporation transfection step.

[0211] Host genomic DNA

[0212] The host cell in this application can be a prokaryotic or eukaryotic cell, including any transformable organism capable of replicating a vector or expressing a heterologous gene encoded by the vector. The host cell can and has been used as a recipient of exogenous nucleic acid molecules.

[0213] For example, the host can be a microbial host. For example, the host can be selected from one or more of the following groups: bacteria, fungi, actinomycetes, mycoplasma, chlamydia, rickettsia, and spirochetes. For example, the host can include Gram-negative bacteria. For example, the host can include Escherichia coli (e.g., competent Escherichia coli cells).

[0214] In this application, the genomic DNA of the host cell may not be included in the exogenous nucleic acid molecule.

[0215] In this application, the content of genomic DNA in the host cell can be determined by qPCR.

[0216] In this application, the size of the host cell's genomic DNA (e.g., the nucleic acid molecule or fragment thereof of this application) can be at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 Mb, at least about 10 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb, or greater. For example, the size of the nucleic acid molecule or its fragment (e.g., the genomic DNA of the host cell in this application) can be at least about 10 kb. In this application, the size of the fragment of the nucleic acid molecule derived from the genome of a host (e.g., a microorganism) (e.g., the genomic DNA of the host cell in this application) can be at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about...). 350kb, at least about 400kb, at least about 450kb, at least about 500kb, at least about 600kb, at least about 700kb, at least about 800kb, at least about 900kb, at least about 1Mb, at least about 2Mb, at least about 3Mb, at least about 4Mb, at least about 5Mb, at least about 6Mb, at least about 7Mb, at least about 8Mb, at least about 9Mb, at least about 10Mb, at least about 20Mb, at least about 50Mb, at least about 100Mb, at least about 200Mb or greater.

[0217] In this application, the nucleic acid molecule or fragment thereof may be derived from microorganisms (e.g., the genomic DNA of the host cell of this application). For example, the microorganism may be selected from one or more of the following groups: bacteria, fungi, actinomycetes, mycoplasma, chlamydia, rickettsia, and spirochetes.

[0218] In this application, the microorganism may include Gram-negative bacteria. For example, the microorganism may be a microorganism suitable for preparing a vector skeleton. For example, the microorganism may include Escherichia coli.

[0219] In this application, the content of nucleic acid molecules or fragments thereof (e.g., the genomic DNA of the host cell in this application) of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or greater) in the transfection mixture may be less than about 10 (w / w)%, less than about 9 (w / w), less than about 8 (w / w), less than about 7 (w / w), or less than 6 (w / w) of the content of exogenous nucleic acid molecules (e.g., plasmids) derived from the host cell in the transfection mixture. Below 5%, below 4%, below 3%, below 2.5%, below 2%, below 1.5%, below 1%, below 9%, below 8%, below 7%, below 6%, below 5%, below 4%, below 3%, below 2%, below 1%, below 0.1%, below 0.01%, below 0.001%, or lower. For example, the content of nucleic acid molecules or fragments thereof (e.g., the genomic DNA of the host cell of this application) of at least about 48 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or larger) may be less than about 2% of the plasmid content in the transfection mixture; may be less than about 0.5% of the plasmid content in the transfection mixture; may be less than about 0.1% of the plasmid content in the transfection mixture.

[0220] transfection

[0221] Transfection is a method of intentionally introducing nucleic acids into cells. In some implementations, transfection is non-viral, meaning that the sequence used in the plasmid context is non-viral and the exogenous nucleic acid molecule does not enter the cell via a viral mechanism. Transfection of animal cells typically involves opening transient pores, or “pores,” in the cell membrane to allow material uptake. Transfection can be performed using methods known in the art and those described below.

[0222] In this application, the transfection may include transient transfection. For example, the transfection may include electroporation. For example, the transfection may include electroporation of the cells to be modified. The electroporation can refer to cell electrotransfection or cell electroporation. The electroporation can utilize the effect of a powerful transient battery to allow charged substances to enter the cell through a cell membrane with a certain degree of permeability. The electroporation can produce very little cytotoxicity. Compared with chemical transfection methods and / or viral transfection methods, the cytotoxicity produced by electroporation is significantly reduced. The electroporation can be applied to almost all types of eukaryotic cells. The electroporation can be used for transient or stable expression of exogenous proteins.

[0223] In this application, the transfection may include transfection of a transposon subsystem (e.g., the Sleeping Beauty transposon subsystem or the PiggyBac (PB) transposon subsystem).

[0224] In this application, the transfection may include transfected cells (e.g., the cells to be transfected or modified as described in this application). In this application, the cells may include eukaryotic cells. The eukaryotic cells may include plant cells, fungal cells, and / or animal cells. The animal cells may include mammalian cells (e.g., human cells, such as immune cells, like T cells, such as human PBMCs).

[0225] This application may also include other transfection methods known in the art, such as chemical-based and non-chemical-based transfection methods. Chemical-based transfection methods may include, for example, methods using calcium phosphate, dendritic polymers, liposome transfection, and cationic polymers (e.g., DEAE-dextrose or polyethyleneimine). Non-chemical methods may include cell squeezing, sonication, optical transfection, impale transfection, and hydrodynamic delivery. Particle-based methods are also included, such as transfection methods using gene guns, magnetic transfection (i.e., magnetically assisted transfection), and particle bombardment.

[0226] In some embodiments, electroporation is used to facilitate the entry of one or more nucleic acid molecules into host cells. In this application, "electroporation" or "electroloading" generally refers to applying an electric current or field to cells to facilitate the entry of nucleic acid molecules. For example, flow cytometry can be used to perform flow electroporation. In some embodiments, electroporation may be employed.

[0227] In the method of this application, transfection efficiency of more than about 35%, more than about 40%, more than about 50%, more than about 60%, more than about 70%, about about 80%, or more than about 90% (or any range thereof) can be achieved after transfection by electroporation. Transfection efficiency can be measured by the percentage of cells expressing the gene product or by the secretion level of the gene-expressed product. Cells maintain high viability during and after the electroporation process. Viability is typically greater than about 40% or higher. The viability of electroporated cells can be at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or higher.

[0228] Cell extrusion is a transfection method that delivers molecules into cells by gently squeezing the cell membrane. Cell extrusion is a high-productivity carrier-free microfluidic platform for intracellular delivery. Cell extrusion does not rely on exogenous materials or electric fields.

[0229] Ultrasonic perforation uses high-intensity ultrasound to induce pore formation in the cell membrane. This pore formation is primarily attributed to the interaction of bubble cavities with the nearby cell membrane, which is enhanced by the addition of an ultrasound contrast agent (the source of the cavitation nucleus).

[0230] Optical transfection is a method that uses a highly focused laser to instantaneously create tiny pores (approximately 1 μm in diameter) in the cell membrane. This technique processes one cell at a time, making it particularly suitable for single-cell analysis.

[0231] Hydrodynamic delivery is performed in mice and rats, but to a lesser extent in larger animals. Hydrodynamic injection can deliver DNA (including transposons) that is normally in plasmids to the liver, involving the infusion of a relatively large volume into the bloodstream in less than 10 seconds; almost all of the DNA is expressed in the liver through this process.

[0232] Chemical-based transfection can be categorized into several types: cyclodextrins, polymers, liposomes, or nanoparticles (with or without chemical or viral involvement). For example, in the calcium phosphate method, a HEPES-buffered saline solution (HeBS) containing phosphate ions is combined with a calcium chloride solution containing the DNA to be transfected. When combined, a fine precipitate of positively charged calcium and negatively charged phosphate forms, binding the DNA to be transfected to its surface. The suspension of the precipitate is then added to the cells to be transfected (typically monolayer cell cultures). The cells will take up some of the precipitate along with the DNA attached. Other methods use highly branched organic compounds (so-called dendritic polymers) to bind DNA and bring it into the cells. A very efficient method is to encapsulate the DNA to be transfected in liposomes, small membrane-bound bodies that are in some ways similar to cell structures and can actually fuse with the cell membrane, releasing the DNA into the cell. For eukaryotic cells, transfection is better achieved using cationic liposomes (or mixtures thereof) because the cells are more sensitive. Another approach is to use cationic polymers, such as DEAE-dextrose or polyethyleneimine. Negatively charged DNA binds to the polycation, and the complex is accepted by the cell via endocytosis.

[0233] In some implementations, the direct transfection method uses a gene gun, in which DNA is coupled to nanoparticles of an inert solid (usually gold) and then "shot" directly into the nucleus of a target cell.

[0234] Magnetic transfection, or magnetically assisted transfection, is a transfection method that uses magnetic force to deliver DNA into target cells. First, nucleic acids are associated with magnetic nanoparticles. Then, a magnetic force is applied to deliver the nucleic acid-particle complex to the target cells, where the payload is released.

[0235] Puncture transfection is performed by puncturing cells with elongated nanostructures and arrays of such nanostructures, such as carbon nanofibers or silicon nanowires that have been functionalized with plasmid DNA.

[0236] Another particle-based transfection method is called particle bombardment. It delivers nucleic acids, typically linked to microelectrodes, through membrane permeation at high speed.

[0237] In this application, the transfection may include stable transfection. For example, the transfection may enable the transfected cells to stably express the foreign protein encoded by the foreign gene. For example, the transfection may enable the foreign gene to be integrated into the genome of the transfected cells. In this application, the integration may occur at a specific location in the genome.

[0238] Cells to be transfected or modified

[0239] In this application, the terms “cell,” “cell line,” and “cell culture” are used interchangeably. All these terms also include freshly isolated cells, as well as cells that have been cultured, activated, or expanded in vitro. All these terms also include their progeny, i.e., any and all descendants. It should be understood that progeny cells may differ due to intentional or unintentional mutations.

[0240] In this application, the cells to be modified or transfected can be eukaryotic cells. For example, the cells can be mammalian cells. For example, the cells can be human cells.

[0241] For example, the cells may be stem cells, immune cells, fibroblasts, fibroblasts, and / or muscle cells. For example, the cells may be pluripotent stem cells, hematopoietic stem cells, and / or mesenchymal stem cells.

[0242] For example, the cells may be immune effector cells. For example, the cells may be T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes, and / or mast cells. For example, the cells may be peripheral blood lymphocytes.

[0243] For example, the cells may be primary cells. For example, the cells may be autologous cells derived from the subject.

[0244] For example, the cells to be modified may be activated cells. For example, activation may include contacting the cells to be modified with an activating composition.

[0245] For example, the cells may comprise immune cells (e.g., immune effector cells, such as T cells or NK cells, such as PBMCs, such as primary or autologous T cells or NK cells, such as primary or autologous PBMCs), and the activating composition may comprise anti-CD3 and / or anti-CD28 antibodies (e.g., the antibodies may be provided on magnetic beads).

[0246] Reagents or kits for activating T cells are also commercially available. Exemplary kits contain avidin particles (e.g., MACSiBead or Dynabead) and biotinylated antibodies against human CD2, CD3, and CD28. The avidin particles loaded with biotinylated antibodies are used to mimic antigen-presenting cells and activate resting T cells from PBMCs, as well as purified T cells. T cell expansion is achieved by culturing and reactivating on day 14 of culture. T cells can also be activated, for example, by mitogens (e.g., ConA, PHA, and PWM).

[0247] For example, activation may include contacting the cells to be modified with the activation composition for no more than about 4 days (e.g., within about 96 hours, within about 90 hours, within about 85 hours, within about 80 hours, within about 75 hours, within about 72 hours, within about 70 hours, within about 65 hours, within about 60 hours, within about 55 hours, within about 50 hours, within about 48 hours, within about 45 hours, within about 40 hours, within about 36 hours, within about 30 hours, within about 24 hours, within about 20 hours, within about 15 hours, within about 12 hours, within about 8 hours, or less). For example, activation may include contacting the cells to be modified with the activation composition for about 10 hours to about 48 hours (e.g., from about 12 hours to about 24 hours). For example, the method may include performing the transfection while contacting the cells to be transfected with the activation composition for a period of about 2 days or less.

[0248] In some embodiments, transfection can be performed on any prokaryotic or eukaryotic cell. In some aspects, electroporation involves transfecting human cells. In other aspects, electroporation involves transfecting animal cells. In some aspects, transfection involves transfecting cell lines or hybrid cell types. In some aspects, the cells to be transfected are cancer cells, tumor cells, or immortalized cells. In some cases, tumors, cancers, immortalized cells, or cell lines are induced; in other cases, tumors, cancers, immortalized cells, or cell lines naturally enter their respective states or conditions. In some respects, the cells or cell lines may be A549, B cells, B16, BHK-21, C2C12, C6, CaCo-2, CAP / , CAP-T, CHO, CHO2, CHO-DG44, CHO-K1, COS-1, Cos-7, CV-1, dendritic cells, DLD-1, embryonic stem (ES) cells or derivatives, H1299, HEK, 293, 293T, 293FT, Hep G2, hematopoietic stem cells, HOS, Huh-7, induced pluripotent stem cells (iPSCs) or derivatives thereof, Jurkat, K562, L5278Y, LNCaP, MCF7, MDA-MB-231, MDCK, mesenchymal cells, Min-6, monocytes, Neuro2a, NIH 3T3, NIH3T3L1, K562, NK cells, NSO, Panc-1, PC12, PC-3, peripheral blood cells, plasma cells, primary fibroblasts, RBL, Renca, RLE, SF21, SF9, SH-SY5Y, SK-MES-1, SK-N-SH, SL3, SW403, Stimulus-triggered Acquisition of Pluripotency (STAP) cells or their derivatives SW403, T cells, THP-1, tumor cells, U2OS, U937, peripheral blood lymphocytes, expanded T cells, hematopoietic stem cells, or Vero cells. In some embodiments, the cells are peripheral blood lymphocytes, expanded T cells, natural killer cells (NK cells), stem cells, hematopoietic stem cells, or primary cells. In some embodiments, the cells are hematopoietic stem cells. In other embodiments, the cells are peripheral blood lymphocytes and / or peripheral blood mononuclear cells (PBMCs).

[0249] In some embodiments, the cells are known in the art as difficult-to-transfect cells. Such cells are known in the art and include, for example, primary cells, insect cells, SF9 cells, Jurkat cells, CHO cells, stem cells, slowly dividing cells, T cells, and non-dividing cells. In some embodiments, the cells are T cells. In some embodiments, the cells are primary cells. In some embodiments, the cells are stem cells. In some embodiments, the cells are hematopoietic stem cells, including bone marrow and lymphoid progenitor cells. In some embodiments, the cells are mesenchymal stem cells. In some embodiments, the cells are germ cells, such as oocytes or sperm cells. In some embodiments, the cells are fertilized embryos. In some embodiments, the cells are human fertilized embryos.

[0250] In some embodiments, cells can be cultured before or after transfection. For example, cells can be cultured during a post-transfection selection phase, during maintenance and clonal selection and initial expansion phases, during a screening phase, and / or during large-scale production. Methods for culturing suspension and adherent cells are known to those skilled in the art. In some embodiments, commercially available cell culture containers and cell culture media can be used to culture cells. Examples include ADME / TOX plates, cell chamber slides and coverslips, cell counting devices, cell culture surfaces, Corning HyperFlask cell culture containers, coated culture dishes, Nalgene Cryoware, culture chambers, culture dishes, glass culture flasks, plastic culture flasks, 3D culture formats, multi-well culture plates, culture plate inserts, glass culture tubes, plastic culture tubes, stackable cell culture containers, hypoxic culture chambers, petri dishes and bottle carriers, rapid culture containers, large-scale cell culture using roller bottles, rotary flasks, 3D cell culture or cell culture bags, etc.

[0251] In this application, the cells may include stem cells, immune cells, fibroblasts, and / or muscle cells. For example, the stem cells may include pluripotent stem cells. For example, the pluripotent stem cells may include embryonic stem cells (ESCs). The embryonic stem cells can differentiate into three primitive germ layers (e.g., ectoderm, mesoderm, and endoderm), and these three germ layers can eventually form organs and tissues. The pluripotent stem cells may include epiblast stem cells (EpiSCs). The pluripotent stem cells may also include induced pluripotent stem cells (e.g., iPS cells), which can be dedifferentiated from mammalian adult cells (e.g., skin cells from the mouse tail) after transfection with transcription factors (e.g., Oct4, SOX2, c-Myc, and Klf4).

[0252] In this application, the stem cells may include hematopoietic stem cells and / or mesenchymal stem cells. The hematopoietic stem cells can differentiate into hemorrhagic cells (e.g., hematopoietic cells from the bone marrow population and hematopoietic cells from the lymphatic population). The hematopoietic stem cells may possess pluripotency and self-renewal characteristics. The hematopoietic stem cells can differentiate into cells selected from the group consisting of: monocytes, macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes, platelets, T cells, B cells, and NK cells.

[0253] The mesenchymal stem cells (MSCs) can be adult stem cells derived from the mesoderm in early embryonic development, possessing self-renewal and multi-directional differentiation potential, and capable of maintaining their biological characteristics even after large-scale in vitro expansion. The MSCs can express HLA-I antigens. The MSCs may not express or express low levels of HLA-II antigens. The MSCs can differentiate into adipocytes, osteoblasts, and chondrocytes; they can also support the differentiation of hematopoietic stem cells into granulocytes, macrophages, and megakaryocytes. The MSCs can secrete cytokines, such as CSF-1, GM-CSF, G-CSF, IL-6, c-kitligand, and / or IL-3.

[0254] In this application, the immune cells may include immune effector cells. For example, the immune effector cells may include lymphocytes (e.g., cytotoxic T cells, memory T cells), macrophages, dendritic cells, and NK cells. For example, the immune cells may be selected from the group consisting of: T lymphocytes (e.g., activated or inactive T lymphocytes), B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes, and mast cells.

[0255] Transfection composition

[0256] In this application, the transfection mixture may contain exogenous nucleic acid molecules (e.g., plasmids). For example, the plasmid may be a circular plasmid, a supercoiled plasmid, or a linear plasmid. In this application, the plasmid (e.g., a linear plasmid) may be treated (e.g., with a deoxyribonuclease, such as an exonuclease, such as Exonuclease V) to achieve the following conditions: a content of nucleic acid molecules or fragments thereof of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, or greater) (e.g., host genomic DNA, which may be linear nucleic acid molecules or fragments thereof) and / or a content of nucleic acid molecules or fragments thereof derived from the host (e.g., microorganism) genome (e.g., linear nucleic acid molecules or fragments thereof) that meets the conditions described in this application. In this application, the treatment may not affect nucleic acid molecules with circular structures.

[0257] For example, the transfection composition described in this application may substantially not contain any viral vector, for example, wherein the viral vector content is less than about 2 (w / w)%, less than about 1 (w / w)%, less than about 0.9 (w / w)%, less than about 0.8 (w / w)%, less than about 0.7 (w / w)%, less than about 0.6 (w / w)%, less than about 0.5 (w / w)%, less than about 0.4 (w / w)%, less than about 0.3 (w / w)%, less than about 0.2 (w / w)%, less than about 0.1 (w / w)% or less.

[0258] In this application, the plasmid can be a DNA plasmid. For example, the DNA plasmid can be a double-stranded, closed circular DNA molecule. For example, the DNA plasmid can be a double-stranded, linear DNA molecule.

[0259] In this application, the plasmid may contain a multiple cloning site. The plasmid may encode at least one foreign gene. The foreign gene may encode one or more antigen-binding fragments (e.g., antibodies), chimeric antigen receptors, cytokines, and / or chemokines. The foreign gene may also encode any one or more functional proteins. For example, the functional protein may be used to treat diseases related to gene defects. For example, the functional protein may be a protein missing and / or mutated in the organism in which the transfected cell resides. For example, the foreign gene expressing the functional protein may be transfected into the fibroblasts (e.g., primary fibroblasts), muscle cells, and / or stem cells (e.g., iPSC cells).

[0260] In this application, the exogenous gene can be expressed using either an endogenous promoter or an exogenous promoter. For example, the plasmid may contain the exogenous promoter.

[0261] In this application, the host's genomic DNA (e.g., at least about 10 kb in size, e.g., can be at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about 500 kb) The nucleic acid molecule or fragment thereof, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 Mb, at least about 10 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb or greater, may be present in different nucleic acid molecules from the plasmid. For example, the host's genomic DNA (e.g., the nucleic acid molecule or fragment thereof, at least about 10 kb in size (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or greater) is free in the transfection composition. For example, the host's genomic DNA (e.g., a nucleic acid molecule or fragment thereof of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or larger) is free in the plasmid. This free state can be isolated, existing in a form independent of the plasmid.

[0262] On the other hand, this application provides a transfection mixture prepared using the method described in this application.

[0263] In this application, the transfection mixture can significantly improve transfection efficiency. The transfection mixture can significantly reduce cytotoxicity caused by transfection. The transfection mixture can be directly used for cell transfection. The method described in this application can serve as a quality control standard for preparing and / or quality inspecting the transfection mixture.

[0264] Optimization of transfection compositions

[0265] For example, the method may further include treating the exogenous nucleic acid molecule (e.g., plasmid) derived from the host cell prior to the transfection to reduce the amount of genomic DNA in the host cell.

[0266] For example, the treatment includes contacting the exogenous nucleic acid molecule (e.g., plasmid) derived from the host cell with one or more reagents selected from the group consisting of: deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. For example, the DNase is capable of nonspecifically cleaving linear DNA. For example, the DNase includes an exonuclease. For example, the treatment includes Mg... 2+ and Ca 2+ The presence of the reagent allows the exogenous nucleic acid molecule (e.g., plasmid) derived from the host cell to come into contact with the reagent.

[0267] The method described in this application may include the step of reducing the content of host genomic DNA in the transfection mixture. In this application, "reducing" may refer to reducing the content of host genomic DNA in the transfection mixture to meet the requirements of the method described in this application.

[0268] In this application, the reduction may include purifying the transfection mixture. That is, the purification can reduce the content of the nucleic acid molecules or fragments thereof in the transfection mixture to meet the requirements of the method described in this application. In this application, the purification can remove nucleic acid molecules or fragments thereof of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or larger); and / or, remove nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism). For example, the purification may include reducing the content of the nucleic acid molecules or fragments thereof in the transfection mixture using DNA purification methods well known to those skilled in the art. In this application, the purification may not affect the integrity and / or activity of the plasmid DNA. In this application, the reduction may include purifying the transfection mixture using reagents selected from the group consisting of: DNase, SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. For example, the reduction may use DNase. For example, a DNase can be used to reduce the content of nucleic acid molecules or fragments thereof of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or larger) in the transfection mixture to meet the requirements of the method described in this application; and / or, to reduce the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) to meet the requirements of the method described in this application. For example, the DNase may not affect the integrity and / or activity of the DNA in the circular plasmid.

[0269] In this application, the DNase is capable of cleaving double-stranded DNA. For example, the DNase is capable of non-specifically cleaving linear DNA.

[0270] The DNase may not affect the integrity and / or activity of the DNA in the plasmid described in this application. The DNase may not affect the integrity and / or activity of the foreign gene in the plasmid (e.g., the circular plasmid) described in this application.

[0271] In this application, the DNase can (e.g., nonspecifically) cleave linear (e.g., double-stranded linear) DNA. For example, the DNase may not affect the structure and / or activity of the plasmid (e.g., circular plasmid). In this application, the DNase may include a deoxyribonuclease. In this application, the DNase may include a DNA exonuclease. In this application, the DNase may include the exonuclease Exonuclease V. In this application, the DNase may include an ATP-dependent DNase, such as a Plasmid-Safe DNase. TM ATP-Dependent DNase.

[0272] For example, the method described in this application may include the step of contacting the DNase with the plasmid (or transfection composition) described in this application. In this application, the contact may include contacting in the presence of a buffer solution (e.g., the buffer solution may be a buffer solution from a kit sold with the DNase). In this application, the buffer solution may include Mg... 2+ and Ca 2+ For example, the buffer solution may contain Mg. 2+ and Ca 2+ It also no longer contains any other cations. The buffer solution can improve the DNase cleavage efficiency.

[0273] In the method described in this application, the DNase treatment may include the following steps: purifying the plasmid after contact.

[0274] Treatment with the DNase may result in the content of nucleic acid molecules or fragments thereof of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or larger) in the transfection mixture containing the plasmid containing the foreign gene being less than about 10% of the total nucleic acid molecules in the transfection mixture; and / or, treatment with the DNase may result in the content of nucleic acid molecules or fragments thereof derived from the host (e.g., microorganism) genome in the transfection mixture containing the plasmid containing the foreign gene being less than about 10% of the total nucleic acid molecules in the transfection mixture.

[0275] In this application, treatment with the DNase can bring the content of large fragments (at least about 10 kb in size, for example at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or larger) and / or fragments of nucleic acid molecules or derived from the host (e.g., microorganism) genome in the transfection mixture containing the plasmid containing the exogenous gene to the content range requirements described in this application.

[0276] In this application, the contact may further include contact with RNase.

[0277] In this application, nuclease or DNase is an enzyme that hydrolyzes nucleic acids. Nucleases can be classified as endonucleases or exonucleases. Endonucleases are any group of enzymes that catalyze the hydrolysis of bonds between nucleic acids within DNA or RNA molecules. Exonucleases are any group of enzymes that catalyze the hydrolysis of single nucleotides from the ends of DNA or RNA chains. Nucleases can also be classified according to whether they specifically digest DNA or RNA. Nucleases that specifically catalyze the hydrolysis of DNA can be called deoxyribonucleases or DNases, while nucleases that specifically catalyze the hydrolysis of RNA can be called ribonucleases or RNases. Some nucleases are specific to single-stranded or double-stranded nucleic acid sequences. Some enzymes possess both exonucleases and endonucleases. Furthermore, some enzymes are capable of digesting both DNA and RNA sequences.

[0278] Optimal reaction conditions vary among different nucleases. Factors to consider include temperature, pH, enzyme cofactors, salt composition, ionic strength, and stabilizers. Suppliers of commercially available nucleases (e.g., Promega Corp.; New England Biolabs, Inc.) provide information on optimal conditions for various enzymes. Most nucleases are used between pH 7.2 and pH 8.5, as measured at incubation temperature. Furthermore, most nucleases exhibit maximum activity at 37°C; however, a few enzymes require higher or lower temperatures to achieve optimal activity (e.g., Taq I, 65°C; Sma I, 25°C). DNA concentration can also be a factor, as high DNA concentrations can decrease enzyme activity, while excessively diluted DNA concentrations can fall below the enzyme's Km and also affect enzyme activity. Non-restrictive examples of nucleases include DNase I, Benzonase, exonuclease I, exonuclease III, Mung Bean Nuclease, BAL 31 nuclease, RNase I, S1 nuclease, Lambda Exonuclease, RecJ, and T7 exonucleases. DNase I is an endonuclease that non-specifically cleaves DNA to release dinucleotide, trinucleotide, and oligonucleotide products with 5'-phosphorylated and 3'-hydroxylated ends. DNase I acts on single-stranded and double-stranded DNA, chromatin, and RNA:DNA hybrids. Exonuclease I catalyzes the removal of nucleotides from single-stranded DNA along the 3' to 5' direction. Exonuclease III catalyzes the stepwise removal of mononucleotides from the 3'-hydroxyl end of double-stranded DNA. Exonuclease III also acts on nicks in double-stranded DNA to create single-stranded gaps. Single-stranded DNA is resistant to exonuclease III. Mung Bean Nuclease degrades single-stranded extensions from the DNA ends. Mung bean nuclease is also an RNA endonuclease. Nuclease BAL 31 degrades both the 3' and 5' ends of double-stranded DNA. BAL 31 is also a highly specific single-stranded endonuclease that cuts at nicks, gaps, and single-stranded regions in both double-stranded DNA and RNA. RNase I is a single-stranded specific RNA endonuclease that cuts at all RNA dinucleotides. S1 nucleases degrade single-stranded DNA and RNA by endonucleases to obtain 5'-phosphoryl-terminated products. Double-stranded nucleic acids (DNA:DNA, DNA:RNA, or RNA:RNA) are resistant to S1 nuclease degradation unless at extremely high concentrations. λ exonucleases catalyze the removal of 5' mononucleotides from double-stranded DNA. Their preferred substrate is 5'-phosphorylated double-stranded DNA, although λ exonucleases will also degrade single-stranded and non-phosphorylated substrates at a significantly reduced rate. λ exonucleases cannot induce DNA digestion at cuts or nicks. RecJ is a single-stranded DNA-specific exonuclease that catalyzes the removal of deoxynucleotide monophosphates from DNA along the 5' to 3' direction.T7 exonuclease catalyzes the removal of 5' single nucleotides from double-stranded DNA. T7 exonuclease catalyzes the removal of nucleotides from the 5' end or at nicks and breaks in double-stranded DNA.

[0279] In this application, the reduction may include using methods selected from the group consisting of: artificial DNA synthesis of the plasmid described in this application and HPLC detection of the transfection mixture described in this application. For example, DNA can be artificially synthesized directly based on the nucleotide sequence of the plasmid, so that the obtained plasmid contains only the nucleotide sequence of the plasmid. For example, the transfection mixture described in this application can be detected by HPLC, and based on the HPLC detection results, the characteristic peak corresponding to the plasmid can be selected, and the component corresponding to the characteristic peak can be collected, so that the obtained plasmid contains only the nucleotide sequence of the plasmid.

[0280] Gene editing system

[0281] In this application, the transfection composition further comprises a gene editing system capable of integrating the exogenous gene into a specific location in the cell genome. For example, the gene editing system comprises a site-specific enzyme or a nucleic acid molecule encoding it. For example, the site-specific enzyme is selected from: transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), transposases, integrases, and Cas proteins. For example, the Cas protein is the Cas9 protein. For example, the gene editing system further comprises one or more guide RNAs. For example, the guide RNA is complementary to a nucleic acid sequence in a target region of the cell genome.

[0282] For example, the gene editing system may also include one or more guide RNAs that target one or more genes to be knocked out.

[0283] In some embodiments, the gene editing system may also include one or more guide RNAs that target PD-1.

[0284] In some embodiments, the gene editing system may also include one or more guide RNAs that target CD95.

[0285] For example, the gene editing system includes a ribonucleoprotein complex (RNP), and the RNP includes the Cas protein and the guide RNA.

[0286] For example, the gene editing system and method can be known to those skilled in the art, as long as the gene editing purpose can be achieved, and are not limited to a specific method. In this application, the gene editing method can be selected from one or more of the following groups: CRISPR / Cas system, RNA editing system ADAR, RNA-directed endonuclease, zinc finger protease, Mega-TAL nuclease, TALENs, and Meganucleases. For example, the gene editing method can be using a CRISPR / Cas system.

[0287] In this application, the gene editing may include gene knockout and / or gene knock-in. For example, the gene editing may include gene knock-in. For example, the gene knock-in may be performed using a CRISPR / Cas system.

[0288] For example, the CRISPR-CAS system may include a class of clustered, regularly spaced short palindromic repeats (CRISPRs) and some function-associated proteins (CRISPR-associated, Cas). The Cas protein-coding genes may include Cas9, Cas1, Cas2, and Csn2. For example, it may be Cas9. The CRISPR-CAS system (e.g., a CRISPR / Cas9 system) can have targeted cleavage specificity for DNA molecules.

[0289] For example, the gene editing knock-in can be a process of inserting a DNA sequence by targeting a specific DNA sequence in a cell with a Cas protein. The gene editing knock-in can also be a Cas protein (e.g., Cas9 protein)-mediated process of homologous recombination between the foreign gene to be knocked into the donor plasmid and the targeted specific DNA sequence in the cell.

[0290] In this application, the exogenous nucleic acid molecule (e.g., plasmid) can serve as a donor plasmid in the gene editing knock-in. For example, the donor plasmid can be double-stranded DNA or single-stranded DNA. The donor plasmid can serve as a donor template for the HDR repair mechanism.

[0291] In this application, the donor plasmid may contain a nucleic acid molecule or a fragment of the foreign gene to be knocked in.

[0292] The site-specific enzyme of this application is capable of cleaving bonds (i.e., phosphodiester bonds) between specific nucleotide subunits in a nucleic acid sequence. In one embodiment, the site-specific enzyme is encoded in RNA. In other embodiments, the site-specific enzyme is a protein, enzyme, or small molecule mimic with enzymatic activity. In some embodiments, the site-specific enzyme is encoded in DNA. In one embodiment, the site-specific enzyme is encoded in plasmid DNA. In some embodiments, the site-specific enzyme and the donor DNA are encoded in the same plasmid.

[0293] In one embodiment, the site-specific enzyme is a transposase. The transposase may be a SleepingBeauty transposase. In some cases, the transposase may be a PiggyBac (PB) transposase.

[0294] For example, synthetic DNA transposons designed to introduce precisely defined DNA sequences into vertebrate chromosomes can be used (e.g., the Sleeping Beauty transposon system). The Sleeping Beauty transposon system consists of the Sleeping Beauty (SB) transposase and transposons designed to insert specific DNA sequences into the vertebrate genome. DNA transposons move from one DNA site to another in a simple cut-and-paste manner. Transposition is a precise process in which a defined DNA fragment is excised from one DNA molecule and moved to another site in the same or different DNA molecule or genome. The SB transposase inserts the transposon into the TA dinucleotide base pair of the recipient DNA sequence. The insertion site can be another location within the same DNA molecule or in another DNA molecule (or chromosome). There are approximately 200 million TA sites in the mammalian genome, including the human genome. The TA insertion site replicates during transposon integration. This replication of the TA sequence is a marker of transposition and is used in some experiments to determine the mechanism. Transposases can be encoded within transposons, or they can be provided from another source, in which case the transposon becomes a non-autonomous element. Non-autonomous transposons are the most useful genetic tools because they cannot independently continue to be excised and re-inserted after insertion. All DNA transposons identified in the human genome and other mammalian genomes are non-autonomous because, although they contain transposase genes, these genes are non-functional and cannot produce transposases that can move transposons.

[0295] In this application, the transposon system may include transposons. The transposon may include nucleic acid molecules capable of being incorporated into nucleic acids by a transposase. The transposon may include two transposon ends (also referred to as "arms") connected by a sequence long enough to form a loop in the presence of a transposase. The transposon may be double-stranded, single-stranded, or a mixture, containing both single-stranded and double-stranded regions, depending on the transposase used to insert the transposon. Transposases may include Mu, Tn3, Tn5, Tn7, and / or Tn10. The ends of the transposon may be double-stranded. In this application, the transposon may be inserted into double-stranded DNA via a transposition event. In this application, the transposon may be considered as the foreign gene. The plasmid may contain the transposon. The plasmid may also contain nucleic acid molecules required for the transposition event. For example, the transposon system may include the Sleeping Beauty transposon system. The Sleeping Beauty transposon system is a member of the Tc1 / mariner transposon superfamily. For example, the transposon subsystem may include the Piggy Bac transposon subsystem.

[0296] In another embodiment, the site-specific enzyme is an integrase. For example, phiC31 integrase is a sequence-specific recombinase encoded within the genome of the bacteriophage phiC31. phiC31 integrase mediates recombination between two 34-base-pair sequences called attachment sites (att), one obtained in the bacteriophage and the other in the bacterial host. This serine integrase has been shown to function efficiently in many different cell types, including mammalian cells. In the presence of phiC31 integrase, a donor plasmid containing attB can be unidirectionally integrated into the target genome via recombination at a site having a sequence similar to the natural attP site (called a pseudo-attP site). phiC31 integrase can integrate plasmids of any size as a single copy and does not require cofactors. The integrated transgene is stably expressed and is heritable.

[0297] In one embodiment, the site-specific nuclease is a Cas nuclease. In a related embodiment, the Cas nuclease is Cas9. In another embodiment, the nuclease is Cas9 and the composition further comprises guide RNA. Another example of a sequence-specific nuclease system that can be used with the methods and compositions described herein includes the Cas9 / CRISPR system (Wiedenheft, B. et al., Nature 482, 331-338 (2012); Jinek, M. et al., Science 337, 816-821 (2012); Mali, P. et al., Science 339, 823-826 (2013); Cong, L. et al., Science 339, 819-823 (2013)). The Cas9 / CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) system utilizes RNA-guided DNA binding and sequence-specific target DNA cleavage. The guide RNA / Cas9 combination confers site specificity to the nuclease. The guide RNA (gRNA) contains approximately 20 nucleotides complementary to the target genomic DNA sequence upstream of the genomic PAM (protospacer adjacent motif) site (NNG) and the constant RNA scaffold region. The Cas (CRISPR-associated) 9 protein binds to the gRNA and the gRNA-bound target DNA, introducing a double-strand break at a defined location upstream of the PAM site. Cas9 possesses two independent nuclease domains homologous to HNH and RuvC endonucleases, and by mutating either domain, the Cas9 protein can be converted into a nickase that introduces single-strand breaks (Cong, L. et al., Science 339, 819-823 (2013)). It is particularly noteworthy that the methods and compositions of the present invention can be used with single-stranded or double-stranded inducible forms of Cas9 as well as with other RNA-guided DNA nucleases (e.g., Cas9-like systems of other bacteria).

[0298] The site-specific nucleases described and composed herein may be modified, chimeric, or isolated from organisms. Sequence-specific nucleases may be introduced into cells in the form of RNA encoding the sequence-specific nuclease (e.g., mRNA).

[0299] In one embodiment, the site-specific enzyme is a site-specific nuclease, such as a zinc finger nuclease. Zinc finger nucleases typically comprise a DNA-binding domain (i.e., the zinc finger) and a cleavage domain (i.e., the nuclease). The zinc finger binding domain can be modified to recognize and bind any selected nucleic acid sequence. See, for example, Beerli et al. (2002) Nat. Biotechnol. 20: 135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70: 313-340; Isalan et al. (2001) Nat. Biotechnol. 19: 656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12: 632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10: 41 1-416; Zhang et al. (2000) J. Biol. Chem. 275(43): 33850-33860; Doyon et al. (2008) Nat. Biotechnol. 26: 702-708; and Santiago et al. (2008) Proc. Natl. Acad. Sci. USA 105: 5809-5814. Modified zinc finger binding domains can possess novel binding specificities compared to naturally occurring zinc finger proteins. Modification methods include, but are not limited to, rational design and a variety of selections. Rational design includes, for example, using a database containing, for example, dipole, triplet, and / or tetrad nucleotide sequences and single zinc finger amino acid sequences, wherein each dipole, triplet, and / or tetrad nucleotide sequence is associated with one or more zinc finger amino acid sequences, said zinc finger binding to a specific dipole or tetrad sequence. See, for example, U.S. Patent Nos. 6,453,242 and 6,534,261, the disclosures of which are incorporated herein by reference in their entirety. As an example, the algorithm described in U.S. Patent 6,453,242 can be used to design zinc finger binding domains targeting preselected sequences. Alternative methods can also be used (e.g., a well-designed non-degenerate identification code table) to design zinc finger binding domains targeting specific sequences (Sera et al. (2002) Biochemistry 41: 7074-7081). Publicly available web-based tools for identifying potential target sites in DNA sequences and designing zinc finger binding domains can be found at http: / / www.zincfingertools.org and http: / / bindr.gdcb.iastate.edu / ZiFiT / (Mandell et al. (2006) Nuc. Acid Res. 34: W516-W523; Sander et al. (2007) Nuc. Acid Res. 35: W599-W605).The zinc finger binding domain can be designed to recognize and bind DNA sequences of about 3 to about 21 nucleotides in length, or preferably about 9 to about 18 nucleotides in length. Typically, the zinc finger binding domain contains at least three zinc finger recognition regions (i.e., zinc fingers). In one embodiment, the zinc finger binding domain may contain four zinc finger recognition regions. In another embodiment, the zinc finger binding domain may contain five zinc finger recognition regions. In yet another embodiment, the zinc finger binding domain may contain six zinc finger recognition regions. The zinc finger binding domain can be designed to bind to any suitable target DNA sequence. See, for example, U.S. Patent Nos. 6,607,882; 6,534,261 and 6,453,242, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the zinc finger nuclease may also contain a nuclear localization sequence (NLS). An NLS is an amino acid sequence that facilitates the targeting of the zinc finger nuclease protein to the nucleus to introduce double-strand breaks at target sequences on chromosomes. Nuclear localization signals are known in the art. See, for example, Makkerh et al. (1996) Current Biology 6: 1025-1027. Zinc finger nucleases also contain a cleavage domain. The cleavage domain portion of a zinc finger nuclease can be derived from any endonuclease or exonuclease. Non-restrictive examples of endonucleases from which the cleavage domain may be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, Catalog 2002-2003, New England Biolabs, Beverly, Mass.; and Belfort et al. (1997) Nucleic Acids Res. 25: 3379-3388.

[0300] In another embodiment, the targeted endonuclease can be a meganuclease. Meganucleases are endonucleases characterized by large recognition sites, typically ranging from about 12 to about 40 base pairs. As a result of this requirement, the recognition site usually appears only once in any given genome. Naturally occurring meganucleases recognize 15 to 40 base pair cleavage sites and are generally classified into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cyst box family, and the HNH family. Meganucleases can target specific chromosomal sequences by modifying their recognition sequences using techniques well known to those skilled in the art.

[0301] In another embodiment, the targeted endonuclease can be a transcription activator-like effector (TALE) nuclease. TALE is a transcription factor derived from the plant pathogen Xanthomonas, which can be readily engineered to bind novel DNA targets. TALE or a truncated form thereof can be linked to the catalytic domain of an endonuclease (e.g., Fok1) to produce a targeted endonuclease known as a TALE nuclease or TALEN.

[0302] In another embodiment, the nuclease may be a homing nuclease. Homing endonucleases include 1-5′cel, l-Ceul, l-Pspl, Vl-Sce, l-SceTV, I-Csml, l-Panl, l-Scell, l-Ppol, l-Scelll, l-Crel, l-Tevl, 1-Tev, and I-7evIII. Their recognition sequences are known. See also U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252; Belfort et al. (1997) Nucleic Acids Res. 25: 3379-3388; Ou on et al. (1989) Gene 82: 115-118; Perler et al. (1994) Nucleic Acids Res. 22: 1125-1127; Jasin (1996) Trends Genet. 12: 224-228; Gimble et al. (1996) J. Mol. Biol. 263: 163-180; Argast et al. (1998) J. Mol. Biol. 280: 345-353 and the New England Biolabs catalogue.

[0303] In some embodiments, the site-specific enzyme comprises a modified (non-naturally occurring) homing endonuclease (a broad-spectrum nuclease). The recognition sequences of homing endonucleases and broad-spectrum nucleases (e.g., l-Scel, l-Ceul, VI-Pspl, Vl-Sce, l-ScelN, l-Csml, l-Panl, l-Scell, l-Ppol, l-Scelll, l-Crel, l-Tevl, l-Tevll, and I-7evIII) are known. See also U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252; Belfort et al. (1997) Nucleic Acids Res. 25: 3379-3388; Dujon et al. (1989) Gene 82: 115-118; Perler et al. (1994) Nucleic Acids Res. 22: 1125-1127; Jasin (1996) Trends Genet. 12: 224-228; Gimble et al. (1996) J. Mol. Biol. 263: 163-180; Argast et al. (1998) J. Mol. Biol. 280: 345-353 and the New England Biolabs catalogue. Furthermore, the DNA-binding specificity of homing endonucleases and broad-spectrum nucleases can be engineered to bind to non-natural target sites. See, for example, Chevalier et al. (2002) Molec. Cell 10: 895-905; Epinat et al. (2003) Nucleic Acids Res. 31: 2952-2962; Ashworth et al. (2006) Nature 441: 656-659; Paques et al. (2007) Current Gene Therapy 7: 49-66; US Patent Publication No. 20070117128. The DNA-binding domains of homing endonucleases and large-scale nucleases can be altered as a whole in the context of the nuclease (i.e., causing the nuclease to include a homologous cleavage domain) or can be fused to a heterologous cleavage domain.

[0304] In one embodiment, the site-specific enzyme is a site-specific nuclease composed of or selected from the group consisting of omega, zinc finger, TALE, and CRISPR / Cas9.

[0305] For example, the gene editing system of this application

[0306] exogenous nucleic acid molecules

[0307] For example, the exogenous nucleic acid molecule may be a plasmid. For example, the exogenous nucleic acid molecule may include circular nucleic acid molecules, supercoiled nucleic acid molecules, and / or linear nucleic acid molecules. For example, the exogenous nucleic acid molecule may be a DNA molecule. For example, the exogenous nucleic acid molecule may include single-stranded nucleic acid molecules and / or double-stranded nucleic acid molecules. For example, the concentration of the exogenous nucleic acid molecule in the transfection composition may be from about 5 μg / mL to about 3000 μg / mL (e.g., about 5 μg / mL to about 2500 μg / mL, about 10 μg / mL to about 2000 μg / mL, about 10 μg / mL to about 1500 μg / mL, about 5 μg / mL to about 1000 μg / mL, about 10 μg / mL to about 1200 μg / mL, about 8 μg / mL to about 1000 μg / mL). Approximately 15 μg / mL to approximately 950 μg / mL, approximately 20 μg / mL to approximately 900 μg / mL, approximately 30 μg / mL to approximately 900 μg / mL, approximately 40 μg / mL to approximately 950 μg / mL, approximately 50 μg / mL to approximately 950 μg / mL, approximately 60 μg / mL to approximately 950 μg / mL, approximately 70 μg / mL to approximately 950 μg / mL, approximately 80 μg / mL to approximately 950 μg / mL, approximately 90 μg / mL to approximately 950 μg / mL 0 μg / mL, about 100 μg / mL to about 950 μg / mL, about 110 μg / mL to about 950 μg / mL, about 120 μg / mL to about 950 μg / mL, about 130 μg / mL to about 950 μg / mL, about 140 μg / mL to about 950 μg / mL, about 150 μg / mL to about 950 μg / mL, about 180 μg / mL to about 950 μg / mL, about 200 μg / mL to about 950 μg / mL (approximately 200 μg / mL to about 850 μg / mL, approximately 200 μg / mL to about 800 μg / mL, approximately 250 μg / mL to about 850 μg / mL, approximately 300 μg / mL to about 750 μg / mL, approximately 350 μg / mL to about 700 μg / mL, approximately 400 μg / mL to about 650 μg / mL, approximately 450 μg / mL to about 600 μg / mL, approximately 500 μg / mL to about 550 μg / mL, etc.). In some embodiments, the concentration of the exogenous nucleic acid molecule in the transfection composition is approximately 200 μg / mL to about 800 μg / mL.

[0308] In this application, the plasmid may include a circular plasmid. For example, the plasmid can be enzymatically digested without interference from the DNase treatment. For example, the plasmid may be a circular plasmid, a supercoiled plasmid, and / or a linear plasmid.

[0309] For example, the exogenous nucleic acid molecule may be obtained from the host cell. Commonly used plasmid extraction methods are well known to those skilled in the art.

[0310] In this application, the size of the exogenous nucleic acid molecule can be at least about 1 kb, for example at least about 1.5 kb, at least about 2 kb, at least about 2.5 kb, at least about 3 kb, at least about 3.5 kb, at least about 4 kb, at least about 4.5 kb, at least about 5 kb, at least about 5.5 kb, at least about 6 kb, at least about 6.5 kb, at least about 7 kb, at least about 7.5 kb, at least about 8 kb, at least about 8.5 kb, at least about 9 kb or greater.

[0311] For example, the exogenous nucleic acid molecule may also contain one or more homologous regions. For example, each homologous region may contain at least 10 nucleotides (e.g., at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 60 nucleotides, at least 70 nucleotides, at least 80 nucleotides, at least 90 nucleotides, at least 100 nucleotides, at least 110 nucleotides, at least 120 nucleotides, at least 130 nucleotides, at least 140 nucleotides, at least 150 nucleotides, at least 160 nucleotides, at least 170 nucleotides, at least 180 nucleotides, at least 190 nucleotides, at least 200 nucleotides, or more). For example, in the exogenous nucleic acid molecule, the homologous region may be located at the 3' end and / or the 5' end of the exogenous gene. In some embodiments, at least one homologous region is located at the 3' end of the exogenous gene, and at least another homologous region is located at the 5' end of the exogenous gene.

[0312] For example, the exogenous gene may be integrated into the cell's genome. For example, the expression of the exogenous gene may be regulated by an endogenous or exogenous promoter. For example, after the exogenous gene is integrated into the cell's genome, its expression may be regulated by an endogenous or exogenous promoter. For example, the homologous region may be homologous to a target region of the cell's genomic DNA. For example, the target region may be located in a TCR-α subunit constant gene (TRAC). For example, the target region may be located at the AAVS-I site.

[0313] For example, the exogenous gene may encode one or more exogenous proteins. For example, the exogenous protein may include one or more of the following: antibody or antigen-binding fragments, chimeric antigen receptors (CARs), cytokines, and chemokines.

[0314] For example, the CAR may include a target-binding domain that targets a tumor-associated antigen. For example, the tumor-associated antigen may be selected from GPC3, CD19, BCMA, Claudin18.2, and Mesothelin. For example, the antibody or antigen-binding fragment may include a multispecific antibody or its antigen-binding fragment. For example, the multispecific antibody or its antigen-binding fragment may simultaneously target immune effector cells (e.g., T cells, NK cells) and tumor cells. For example, the multispecific antibody or its antigen-binding fragment may include a bispecific T-cell connector (BiTE). For example, the BiTE may include a CD3 binding domain. For example, the BiTE may also include a tumor-associated antigen binding domain.

[0315] For example, the cytokines may include interleukins. For example, the interleukins may include IL15, IL17, or functionally active fragments thereof.

[0316] For example, the chemokine may include CCL19 or a functionally active fragment thereof.

[0317] For example, the exogenous protein may contain the cytokines (e.g., interleukins; e.g., IL15, IL17 or their functionally active fragments) and the chemokines (e.g., CCL19 or its functionally active fragments).

[0318] For example, the exogenous protein may include a CAR (e.g., GPC3CAR), the cytokines (e.g., interleukins; e.g., IL15, IL17 or their functionally active fragments), and the chemokines (e.g., CCL19 or its functionally active fragments).

[0319] For example, the exogenous protein may include a polyprotein. For example, a cleavable portion may be included between two or more proteins in the polyprotein. For example, the cleavable portion may include a 2A peptide. For example, the 2A peptide may include P2A, T2A, F2A, or E2A.

[0320] For example, in this application, the exogenous gene may include a gene encoding one or more proteins selected from the group consisting of: antibodies (e.g., monoclonal antibodies, bispecific antibodies and / or multispecific antibodies; intact Ig antibodies (e.g., IgG antibodies); antibody fragments (e.g., VHH, Fab, Fab', (Fab)2, scFv), cytokines, chemokines, chimeric antigen receptors and MHC complexes (e.g., HLA-A, HLA-G).

[0321] For example, the exogenous gene may encode a CAR. For example, the exogenous gene may simultaneously encode a CAR and a cytokine (e.g., IL-15 or IL-7). For example, the exogenous gene may simultaneously encode a CAR, a cytokine (e.g., IL-15 or IL-7), and a chemokine (e.g., CCL19). For example, the exogenous gene may encode CAR-BiTE (or CAR-2A-BiTE).

[0322] In this application, the exogenous gene may be natural or an engineered gene.

[0323] In this application, the exogenous gene may contain a nucleic acid molecule encoding a chimeric antigen receptor (CAR), and the exogenous gene may be integrated into the genome of the transfected cell.

[0324] In this application, the size of the exogenous gene can be at least about 1000 bp (e.g., at least about 1500 bp, at least about 2000 bp, at least about 2500 bp, at least about 3000 bp, at least about 3500 bp, at least about 4000 bp, at least about 4500 bp, at least about 5000 bp, at least about 5500 bp, at least about 6000 bp, at least about 6500 bp, at least about 7000 bp, at least about 7500 bp, at least about 8000 bp, at least about 8500 bp, at least about 9000 bp, at least about 9500 bp or more), wherein the exogenous gene is integrated into the genome of the transfected cell. For example, the size of the exogenous gene can be at least about 1000 bp, at least about 3000 bp, or at least about 3500 bp.

[0325] In some implementations, the size of the exogenous gene can be up to about 10 kb. For example, it can be up to about 9900 bp, up to about 9800 bp, up to about 9700 bp, up to about 9600 bp or more.

[0326] In some cases, the size of the foreign gene can be clearly distinguished from the size of nucleic acid molecules or fragments thereof (e.g., host genomic DNA) of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or greater) as described in this application. For example, by SDS-PAGE, the band of the foreign gene can be clearly found to be located at different positions in the same lane as the band of nucleic acid molecules or fragments thereof of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or greater) of the foreign gene. In some cases, the size of the foreign gene can be clearly distinguished from the size of nucleic acid molecules or fragments thereof derived from the host (e.g., microorganism) genome as described in this application. For example, SDS-PAGE can clearly reveal that the bands of the exogenous gene and the bands of the nucleic acid molecules or fragments of the host (e.g., microorganism) genome are located at different positions in the same lane.

[0327] In this application, the foreign gene can express more than one (e.g., one, two, three, or more) proteins. For example, the foreign gene can encode a chimeric antigen receptor (CAR). For example, the foreign gene can encode only a chimeric antigen receptor (CAR). As another example, the foreign gene can contain a nucleic acid molecule encoding a chimeric antigen receptor (CAR) and / or a second protein, the second protein being different from the chimeric antigen receptor. In this application, the second protein can be any one or more proteins different from the chimeric antigen receptor.

[0328] For example, the chimeric antigen receptor may include at least one antigen-binding domain targeting an antigen. For example, the chimeric antigen receptor may specifically bind to one antigen. For example, the chimeric antigen receptor may specifically bind to two antigens, and / or may specifically bind to at least two different epitopes of one antigen. In this application, the antigen may be a tumor-associated antigen (TAA). The tumor-associated antigen may be an antigen associated with the following tumor cells: for example, breast cancer cells, B-cell lymphoma, Hodgkin lymphoma cells, ovarian cancer cells, prostate cancer cells, mesothelioma, lung cancer cells (e.g., small cell lung cancer cells), non-Hodgkin B-cell lymphoma (B-NHL) cells, ovarian cancer cells, prostate cancer cells, mesothelioma cells, lung cancer cells (e.g., small cell lung cancer cells), melanoma cells, chronic lymphocytic leukemia cells, glioma, glioblastoma, medulloblastoma, colorectal cancer cells, etc. Cancer cell-associated antigens may also be expressed by non-cancer cells. For example, the antigen may be CD19. For example, the antigen may be GPC3.

[0329] In some cases, the antigen-binding domain can be a single-chain antibody (scFv), or a cAb VHH (camel antibody variable domain) and its humanized variants, an IgNAR VH (shark antibody variable domain) and its humanized variants, an sdAb VH (single-domain antibody variable domain), and a "camel-derived" antibody variable domain. The antigen-binding domain can also be a T-cell receptor (TCR)-based recognition domain, such as a single-chain TCR (scTv, a single-chain bidomain TCR containing Vα and Vβ).

[0330] In this application, the chimeric antigen receptor may include a transmembrane domain. The N-terminus of the transmembrane domain may be directly or indirectly connected to the C-terminus of the antigen-binding domain. In this application, any transmembrane (TM) structure provided for inserting a polypeptide into the cell membrane of a eukaryotic cell (e.g., a mammalian cell) can be used for the transmembrane domain.

[0331] For example, the transmembrane domain may include transmembrane domains derived from proteins selected from: the α, β or ζ chain of the T cell receptor, CD28, CD3e, CD45, CD4, CD5, CD8a, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and CD154.

[0332] In some cases, the chimeric antigen receptor may include a hinge region. This hinge region may be located between the antigen-binding domain and the transmembrane domain. The hinge region may be an immunoglobulin heavy chain hinge region, or it may be a hinge region polypeptide derived from the receptor (e.g., a hinge region derived from CD8).

[0333] The length of the hinge region can be approximately 4 to approximately 50 amino acids. For example, it can be approximately 4 to approximately 10 amino acids, approximately 10 to approximately 15 amino acids, approximately 15 to approximately 20 amino acids, approximately 20 to approximately 25 amino acids, approximately 25 to approximately 30 amino acids, approximately 30 to approximately 40 amino acids, or approximately 40 to approximately 50 amino acids.

[0334] The hinge region may contain at least one cysteine ​​residue. The amino acid sequence of the hinge region may be known in the art, see, for example, Tan et al. (1990) Proc. Natl. Acad. Sci. USA 87:162; and Huck et al. (1986) Nucl. Acids Res. 14:1779.

[0335] In this application, the hinge region may comprise the amino acid sequence of a human IgG1, IgG2, IgG3, or IgG4 hinge region. For example, compared to a wild-type (naturally occurring) hinge region, the hinge region may include one or more amino acid substitutions and / or insertions and / or deletions.

[0336] In this application, the chimeric antigen receptor may include a co-stimulatory domain. The length of the co-stimulatory domain may be about 30 to about 70 amino acids. The co-stimulatory domain may be derived from a polypeptide of the receptor. For example, the co-stimulatory domain may be the intracellular portion of a transmembrane protein. For example, the co-stimulatory domain may include co-stimulatory domains derived from the following proteins: 4-1BB (CD137), CD28, ICOS, OX-40, BTLA, CD27, CD30, GITR, and HVEM. For example, the co-stimulatory domain may include co-stimulatory domains derived from the following proteins: CD28, 4-1BB, OX-40, and ICOS.

[0337] In this application, the chimeric antigen receptor may further include a linker. The linker may be located between the transmembrane domain and the co-stimulatory domain. The linker may be a linker peptide. For example, the linker peptide may have a length of about 6 to about 40 amino acids. The linker peptide may have any amino acid sequence, as long as it has a flexible structure.

[0338] In this application, the chimeric antigen receptor may include an intracellular signal transduction domain. For example, the intracellular signal transduction domain may include intracellular signal transduction domains derived from the following proteins: CD8β, CD4, CD3ζ, CD28, CD134, and CD7. For example, the intracellular signal transduction domain may include a signal transduction domain derived from CD3ζ.

[0339] In this application, the intracellular signal transduction domain may comprise the ITAM-containing portion of a polypeptide containing an ITAM motif. For example, the intracellular signal transduction domain may include DAP12; FCER1G (Fcε receptor Iγ chain); CD3D (CD3δ); CD3E (CD3ε); CD3G (CD3γ); CD3Z (CD3ζ); and CD79A (antigen receptor complex-associated protein α chain).

[0340] In this application, the second protein may be selected from at least one of the following groups: cytokines, chemokines, and antibodies or antigen-binding fragments thereof. In this application, the second protein may include any one or more functional proteins. For example, the functional protein may be used to treat diseases related to gene defects. For example, the functional protein may be a protein missing and / or mutated in the host of the transfected cell. For example, a foreign gene expressing the functional protein may be transfected into the fibroblasts (e.g., primary fibroblasts), muscle cells, and / or stem cells (e.g., iPSCs).

[0341] In this application, the cytokine can be any desired cytokine, as long as it can mediate and / or regulate biological or cellular functions or processes (e.g., immune responses). The cytokine may include lymphokines, monokines, and / or interleukins. The cytokines may also include variants of the cytokines that contain one or more amino acid mutations in the amino acid sequence of the corresponding wild-type cytokines, as described, for example, in Sauvé et al., Proc Natl Acad Sci USA 88,4636-40 (1991); Hu et al., Blood 101,4853-4861 (2003) and U.S. Patent Publication No. 2003 / 0124678; Shanafelt et al., Nature Biotechnol 18,1197-1202 (2000); Heatonet et al., Cancer Res 53,2597-602 (1993) and U.S. Patent No. 5,229,109; U.S. Patent Publication No. 2007 / 0036752; WO 2008 / 0034473; WO 2009 / 061853.

[0342] For example, the cytokine may be selected from at least one of the following: GM-CSF, IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-12, IL-15, IFN-α, IFN-β, IFN-γ, MIP-1α, MIP-1β, TGF-β, TNF-α, and TNF-β. For example, the cytokine may include IL-15. For example, the cytokine may include IL-7.

[0343] In this application, the chemokine may be selected from at least one of the following groups: CCL19, 9E3, AMCF, β-globulin, ENA-78, eotaxin, eotaxin-2, IP-IO, KC, LIX, mig, MGSA, mob-l, NAP-2, NAP-3, NAP-4, PBSF, MGSA, mouse KC, MIP-2, MIP-1α, NAP-2, ENA-78, GCP-2, ACT-2, CIO, CCF18, DC-CK1, ELC, Exodus, FIC, GDCF, GDCF-2, HC-21, HCC-1, 1-309, JE, LAG-1, MARC, MCAF, MCP-1, MCP-2, MCP-3, MCP-4, MCP-5, MRP-2, RANTESSDF, TARC, ATAC, Ltn, SCM-1, and neurotactin.

[0344] In this application, the second protein may comprise a multispecific antibody (e.g., a bispecific antibody). For example, the second protein may comprise a bispecific T-cell connective (BiTE). For example, the bispecific T-cell connective may specifically bind to at least one tumor-associated antigen (TAA) and T cells. For example, the bispecific T-cell connective may specifically bind to an antigen expressed on the surface of T cells, such as a CD3 receptor. For example, the bispecific T-cell connective may specifically target MHC-independent tumor-associated antigens (TAAS).

[0345] The bispecific T-cell adapter may include at least one antigen-binding portion, for example, it may include at least one single-chain antibody scFv.

[0346] In this application, the bispecific T-cell connector (BiTE) can target CD3 and CD19, CD3 and CEA, CD3 and PSMA, or EpCMA and CD3. For example, the bispecific T-cell connector can target CD3, CD28, and CD38. For example, the bispecific T-cell connector may include Blinatumomab. MT111, MT112BAY2020112, MT110AMG110 and / or SAR442257.

[0347] In this application, when the exogenous protein comprises CAR and BiTE, the tumor-associated antigen targeted by the BiTE may be the same as or different from the tumor-associated antigen targeted by the CAR. In some embodiments, the BiTE and the CAR target the same epitope. In some embodiments, the BiTE and the CAR target the same target, but each specifically recognizes or binds to a different epitope of that target. In some embodiments, the BiTE and the CAR target different targets.

[0348] In this application, the exogenous gene can express the chimeric antigen receptor and the cytokines described in this application. In this application, the exogenous gene can express the chimeric antigen receptor and the bispecific T-cell connective (BiTE) described in this application.

[0349] In this application, the exogenous nucleic acid molecule (e.g., plasmid) may contain a homologous arm that is homologous to a target gene in the cell genome. For example, the homologous arm may have at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identity with the nucleic acid sequence at the 5' and / or 3' end of the knock-in site in the genomic DNA of the cell to be transfected. For example, the homologous arm may be 100-1000 bp in size. For example, the homologous arm may be about 150 bp-1000 bp, about 200 bp-1000 bp, about 300 bp-1000 bp, about 400 bp-1000 bp, or about 800 bp-1000 bp.

[0350] In some embodiments, the exogenous nucleic acid molecule may be in the form of a nucleic acid vector. The term "vector" is used to refer to a vector nucleic acid molecule into which a heterologous nucleic acid sequence can be inserted for introduction into cells where it can be replicated and expressed. The nucleic acid sequence may be "heterologous," meaning that the nucleic acid sequence is foreign to the cells to be transfected or to which the inserted nucleic acid sequence is located. Vectors include DNA, RNA, plasmids, viscera, and artificial chromosomes (e.g., YAC), etc. Those skilled in the art can construct vectors using recombinant preparation techniques (e.g., Sambrook et al., 2001; Ausubel et al., 1996). Vectors can be used to transfect cells to produce antibodies or other exogenous proteins.

[0351] In this application, the exogenous nucleic acid molecule may contain regulatory sequences, such as promoters. Promoters are typically regions in a nucleic acid sequence that control transcription initiation and rate. Promoters may contain gene elements that can bind regulatory proteins and molecules, such as RNA polymerases and other transcription factors. Promoters may or may not be used in conjunction with an "enhancer," which refers to a cis-regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.

[0352] Vectors or constructs typically contain at least one termination signal. The “termination signal” or “terminator” consists of a DNA sequence that specifically terminates the RNA transcript via RNA polymerase. Therefore, in some embodiments, a termination signal is considered to terminate the RNA transcript. In eukaryotic systems, the terminator region may also contain a specific DNA sequence that allows site-specific cleavage of the new transcript to expose a polyadenylation site. This signals a specialized endogenous polymerase to add an extension sequence of approximately 200 A residues (polyA) to the 3' end of the transcript. RNA molecules modified with this polyA tail appear more stable and are translated more efficiently. Therefore, in other embodiments involving eukaryotes, the terminator may contain a signal for cleaving the RNA, for example, a terminator signal that facilitates polyadenylation information.

[0353] The exogenous nucleic acid molecules in this application may also contain polyadenylation signals that affect appropriate transcript polyadenylation.

[0354] In some embodiments, the exogenous nucleic acid molecule may contain one or more replication origin sites (often referred to as "ori"), which are specific nucleic acid sequences that initiate replication at these sites. Alternatively, if the host cell is yeast, autonomously replicating sequences (ARS) may be used.

[0355] In some specific embodiments, the transfection composition transfected into cells via electroporation is non-viral (i.e., does not contain any viral components). This is because non-viral methods reduce toxicity and / or improve the safety of the method.

[0356] Cell performance evaluation

[0357] In this application, the cell viability may include indicators selected from the following group: cell survival rate, cell proliferation capacity, cell killing capacity, cell secretion capacity, cell preservation capacity, and cell resuscitation capacity.

[0358] In this application, the cell proliferation capacity can be reflected by the cell proliferation rate (e.g., by FACS); the cell viability can be reflected by the proportion of live cells to total cells (e.g., by FACS); the cell secretion capacity can be reflected by the expression level of exogenous proteins encoded by exogenous genes secreted by cells (e.g., by flow cytometry, Western blot, antigen-antibody specific binding reaction, etc.); the cell killing capacity can be reflected by the cell killing rate against tumor cells in vitro; by the effect of cells on the tumor volume of solid tumors in vivo; and by the effect of cells on the tumor size of non-solid tumors in vivo. In this application, cell viability and / or cell proliferation capacity can reflect the cell preservation capacity and the cell resuscitation capacity. For example, the cell preservation capacity and / or cell resuscitation capacity can be reflected by the cell viability and / or cell proliferation capacity of cells under cryopreservation conditions (e.g., liquid nitrogen preservation conditions) and after thawing (e.g., thawing from the cryopreservation conditions).

[0359] Quality judgment method

[0360] On the other hand, this application provides a method for determining the quality of a transfection composition, the method comprising: determining the content of host cell genomic DNA in the transfection composition, and determining the quality of the transfection composition based on the content. For example, when the content of host cell genomic DNA accounts for less than about 10% (w / w) of the total DNA in the transfection composition (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w), less than about 6% (w / w), less than about 5% (w / w), less than about 4% (w / w), less than about 3% (w / w), less than about 2% (w / w), less than about 1.5% (w / w), less than about 1% (w / w), less than about 0.9% (w / w), less than about 8%, the quality is determined based on the content of the host cell genomic DNA. When the concentration of the transfection composition is less than 0.01‰ (w / w), approximately 7‰ (w / w), approximately 6‰ (w / w), approximately 5‰ (w / w), approximately 4‰ (w / w), approximately 3‰ (w / w), approximately 2‰ (w / w), approximately 1.5‰ (w / w), approximately 1‰ (w / w), approximately 0.5‰ (w / w), approximately 0.1‰ (w / w), approximately 0.01‰ (w / w), approximately 0.001‰ (w / w), or lower, the quality of the transfection composition is deemed to meet the standard.

[0361] Therefore, the method described in this application may include the following steps: determining the content of the host genomic DNA (e.g., nucleic acid molecules or fragments thereof of a size of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or larger)). and / or, the method described in this application may include the following steps: determining the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism).

[0362] In this application, the standard may be a standard used for the electroporation method of this application, or a standard used for transfecting (e.g., electroporating) cells according to the method of this application.

[0363] In this application, the method described herein may include the following steps: determining the total content of nucleic acid molecules in the transfection mixture, or determining the total amount of exogenous nucleic acid molecules (e.g., plasmids) derived from the host cell therein.

[0364] In this application, the content of host genomic DNA in the transfection mixture can be determined before transfection by measuring the content of host genomic DNA.

[0365] If the calculated proportion meets the proportion threshold in the method described in this application (e.g., less than about 1% (w / w) of the total plasmid in the transfection mixture, such as less than about 0.9% (w / w), less than about 0.8% (w / w), less than about 0.7% (w / w), less than about 0.6% (w / w), less than about 0.5% (w / w), less than about 0.4% (w / w), less than about 0.3% (w / w), less than about 0.2% (w / w), less than about 0.1% (w / w), less than about 0.09% (w / w), less than about 0.08% (w / w), or lower), then the transfection mixture can be considered to have achieved the technical effect of the method described in this application (e.g., it can improve transfection efficiency), and the transfection mixture can be directly used for cell transfection. Conversely, if the calculated proportion does not meet the proportion threshold in the method described in this application, then the transfection mixture can be considered to have not achieved the technical effect of the method described in this application. In other words, in order to achieve the technical effect of the method described in this application (e.g., to improve transfection efficiency), the transfection mixture can be subjected to a step of reducing the content of the host genomic DNA in the transfection mixture.

[0366] In this application, the determination can be performed using methods for measuring nucleic acid molecule content. These methods may include phosphorus determination (i.e., detecting the phosphorus content in ribonucleic acid and / or deoxyribonucleic acid to calculate the nucleic acid molecule content; for example, phosphorus determination agents such as ammonium molybdate can be used), sugar determination (i.e., detecting the colored compounds produced by aldehydes formed from pentose sugars in ribose, and calculating the nucleic acid molecule content from the concentration of the colored compounds using colorimetry or spectrophotometry), ultraviolet absorption (i.e., detecting the absorbance of ultraviolet light by bases in nucleic acids to calculate the nucleic acid molecule content), fluorescence spectrophotometry, and / or qPCR (which can obtain absolute quantification of nucleic acid molecules) to determine the nucleic acid molecule content.

[0367] For example, the assay can be performed using qPCR. In this application, the content of nucleic acid molecules or fragments thereof of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or greater) and / or the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) can be determined using an E. coli DNA Quantitative Detection Kit (Cat#4458435, Thermal Fisher) in the plasmid to be detected, following the method described in the kit's instructions.

[0368] Transfected cells or cell populations

[0369] On the other hand, this application provides a cell and / or cell line prepared using the method described in this application.

[0370] In this application, the cells and / or cell lines described may have a significantly increased transfection positivity rate (e.g., a significantly increased gene editing knock-in positivity rate (e.g., target cell activation can increase the positivity rate of CAR, antibody, cytokine, and / or chemokine knock-in), significantly increased DNA homologous recombination efficiency, and / or significantly increased cell viability). The cell lines described in this application may maintain a significantly increased transfection positivity rate over multiple generations of proliferation (e.g., at least about 5 passages, at least about 10 passages, at least about 15 passages, at least about 20 passages, or longer).

[0371] In some implementations, the transfection positivity rate is greater than about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50%. The positivity rate of the exogenous gene can be measured by determining the number of cells with the exogenous gene modification and dividing by the total number of cells. The integration of the exogenous gene into the cellular genomic DNA can be determined by methods known in the art, such as direct genomic DNA sequencing, differential restriction digestion (if gene editing is the addition, removal, or alteration of restriction enzyme sites), gel electrophoresis, array capillary electrophoresis, MALDI-TOF MS, dynamic allele-specific hybridization, molecular beacons, restriction fragment length polymorphism, primer extension, temperature gradient gel electrophoresis, etc.

[0372] In other embodiments, cell viability after electroporation is at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85%. Cell viability can be measured by methods known in the art. For example, cells can be counted before and after electroporation using a cell counter device. In other embodiments, apoptosis can be measured. The introduction of large amounts of nucleic acids is thought to induce apoptosis. Considering that the methods described herein result in less apoptosis than other methods in the art, in some embodiments, the number of cells exhibiting apoptosis after electroporation is less than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5%. Apoptosis refers to the specific process of programmed cell death and can be measured by methods known in the art. For example, apoptosis can be determined by annexin V.

[0373] In this application, the cells and / or cell lines may simultaneously express the chimeric antigen receptor CAR described in this application and the bispecific T cell connector BiTE described in this application.

[0374] For example, the cells and / or cell lines may express a combined CAR, such as CAR-BiTE.

[0375] In this application, the cells and / or cell lines described herein may simultaneously express the chimeric antigen receptor (CAR) described herein and at least one cytokine described herein.

[0376] For example, the cells and / or cell lines may express a combined CAR, such as CAR-cytokine (e.g., CAR-IL15). For example, CAR-cytokine-chemokine (e.g., CAR-IL7-CCL19) may be expressed.

[0377] In this application, the cells and / or cell lines described may have a significantly increased transfection positivity rate (e.g., a significantly increased gene editing knock-in positivity rate (e.g., target cell activation can increase the positivity rate of CAR knock-in), significantly increased DNA homologous recombination efficiency, and / or significantly increased cell viability). The cell lines described in this application have the ability to maintain a significantly increased transfection positivity rate over multiple generations of proliferation (e.g., at least about 5 passages, at least about 10 passages, at least about 15 passages, at least about 20 passages, or longer).

[0378] Therapeutic uses

[0379] In some embodiments, the cells and cell lines generated by the methods described herein are cells and cell lines that provide therapeutic effects after the genomic DNA of the cells has been edited. Primary cells can be isolated, modified, and ex vivo for reintroduction into the subject of treatment using the methods described herein. Suitable primary cells include peripheral blood mononuclear cells (PBMCs), peripheral blood lymphocytes (PBLs), and other blood cell subsets (e.g., but not limited to CD4+). + T cells or CD8 + Other suitable primary cells include progenitor cells, such as bone marrow or lymphoid progenitor cells. Suitable cells also include stem cells, such as, for example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, neuronal stem cells, mesenchymal stem cells, muscle stem cells, and skin stem cells. For example, iPSCs can be obtained ex vivo from a patient with a known gene mutation associated with the mutation, and the mutation can be modified to a wild-type allele using the methods described herein. The modified iPSCs can then differentiate into dopaminergic neurons and be re-implanted into the patient. In another ex vivo therapeutic application, hematopoietic stem cells can be isolated from a patient with a known gene mutation, which can then be modified to correct the gene mutation. HSCs can then be administered back to the patient to obtain a therapeutic effect, or they can be differentiated into more mature hematopoietic cells in a culture before being administered to the patient.

[0380] In some embodiments, the modified genomic DNA sequence and / or donor DNA contains disease-related genes. In some embodiments, the sequence modification region contains disease-related genes. Disease-related genes are known in the art.

[0381] In one embodiment, the method includes modifying the genomic DNA of hematopoietic stem cells (also known as hematopoietic cells) or bone marrow progenitor cells.

[0382] Another example of the therapeutic use of the methods of this application is the site-specific integration of a chimeric antigen receptor (CAR). The term "chimeric antigen receptor" or "CAR" refers to a modified receptor that can be arbitrarily and specifically transplanted onto immune effector cells. These receptors are used to specifically transplant monoclonal antibodies onto T cells. This receptor is called a chimera because it is composed of parts from different sources. The most common form of these molecules is a fusion of a single-chain variable fragment (scFv) derived from a monoclonal antibody with: a CD3ζ transmembrane and intracellular domain; a CD28 or 41BB intracellular domain; or a combination thereof. Such molecules respond to recognition of the scFv of their target by causing signal transduction. An example of such a construct is the GPC3-CAR, which recognizes GPC3 (Glypican 3) specifically expressed on the surface of liver cancer cells. When T cells express this molecule, they recognize and kill target cells expressing GPC3 (e.g., liver cancer cells). To target malignant B cells, researchers have used chimeric immune receptors specific to the B-lineage molecule CD19 to redirect T cell specificity. Variable portions of the immunoglobulin heavy and light chains fuse via flexible linkers to form scFvs. These scFvs are preceded by a signal peptide to guide the initial protein to the endoplasmic reticulum and subsequent surface expression (which is cleaved). Flexible spacer regions allow scFvs to orient themselves in different directions to achieve antigen binding. The transmembrane domain is typically a hydrophobic α-helix, usually derived from the original signal transduction intracellular domains that penetrate the cell and deliver the desired signal.

[0383] Research is underway on artificial T-cell receptors as a cancer treatment, using a technique known as adoptive cell transfer. T cells are removed from a patient and modified to express receptors specific to a particular form of cancer. These T cells, which can then recognize and kill cancer cells, are reintroduced into the patient. Modification of T cells derived from donors other than the patient is also under investigation.

[0384] These modified CAR T cells can be expanded in vitro, and the expanded CAR T cell population can then be infused into a patient. Following infusion, the T cells proliferate in the patient's body and, guided by their modified receptors, recognize and kill cancer cells with antigens on their surface. Many existing treatments involve the introduction of CARs via viral infection. However, safety concerns always exist when using viral infection in treatments. Therefore, the methods described herein are non-viral methods for gene therapy and genome engineering. Previously, it was impossible to transfect immune cells with plasmid DNA because doing so resulted in severe toxicity to the cells. The inventors of this application have discovered that by treating the transfection composition prior to cell transfection (e.g., reducing the amount of host genomic DNA), the problem affecting cell viability is overcome, and long segments of DNA (and / / or high concentrations) can be transfected into cells while maintaining high levels of viability. Using the methods described herein, CARs can be integrated into specific sites on immune cells. In some embodiments, the cells are autologous immune cells. Long-term expression of CARs in T cells or natural killer (NK) cells can be used for leukemia treatment or for treating tumors associated with certain antigens.

[0385] In some aspects, the methods described herein relate to improved methods for ex vivo therapy. Cell populations can be isolated from a subject, and the cells can then be activated using methods known in the art and / or the methods described herein, and the genomic DNA of the cells can be modified in a manner that corrects defects or site-specific integration of target genes. The cell populations can then be transplanted into a subject for therapeutic purposes. In some cases, the isolated cell populations may contain subpopulations of cells sensitive to certain in vitro manipulations (e.g., conventional transfection and / or electroporation methods), or the subpopulations may be resistant to conventional transfection and / or electroporation methods or genomic DNA manipulation. It is understood that modifying genomic DNA with the methods described herein results in more efficient sequence modifications in such populations.

[0386] Furthermore, the cells and cell lines generated using the methods employed in this paper can be used for drug development and / or reverse genetics studies. Such cells and animals can exhibit phenotypes associated with specific mutations or their sequence modifications and can be used to screen for drugs that specifically interact with the mutation or mutant protein in question, or drugs that can be used to treat diseases in affected animals. These cell lines also provide tools for studying the effects of specific mutations, as the cell lines and their corresponding “modified” cell lines represent “genetically identical” controls, thus providing a powerful tool for repairing disease-specific mutations, drug screening and discovery, and the study of disease mechanisms.

[0387] The compositions disclosed herein can be used for in vivo, in vitro, or ex vivo administration. For example, the compositions disclosed herein can be used as cancer vaccines. In this application, the term in vitro administration refers to operations performed on cells removed from or outside the object, including but not limited to cells in a culture. The term ex vivo administration refers to cells that have already been manipulated in vitro and subsequently administered to the object. The term in vivo administration includes all operations performed within the object, including administration.

[0388] The methods of this application also relate to methods for immunizing and / or treating certain cancers in a subject, comprising: transfecting cells with a transfection composition of this application comprising a) an exogenous nucleic acid molecule and b) a gene editing system (i.e., wherein the host, such as a microorganism, contains genomic DNA in the amount defined in this application, for example, less than about 2 (w / w)% of the total DNA in the transfection composition); wherein the exogenous nucleic acid molecule comprises: (i) a homologous region containing a nucleic acid sequence homologous to a target genomic DNA region; and (ii) a chimeric antigen receptor (CAR) coding sequence, and optionally one or more antibodies (e.g., BiTE) and / or cytokines (e.g., IL15); and wherein the genomic DNA sequence is specifically modified in the target genomic DNA region to integrate the CAR (antibody and / or cytokine) coding sequence; and administering the cells to a patient. In some embodiments, the immune cells are autologous. In some embodiments, the immune cells have been contacted with an antigen. In some embodiments, the antigen is an antigen expressed by the subject's cancer cells. In some embodiments, the antigen is cell-free. The term "cell-free" refers to a composition that does not contain any cellular components. In some embodiments, the antigen is an extract derived from a patient's tumor. In some embodiments, the antigen is a polypeptide. In some embodiments, the antigen comprises one or more of tumor cell lysates, apoptotic tumor cells, tumor-associated antigens, and tumor-derived mRNA.

[0389] In some embodiments, the immune cells are antigen-presenting cells. Examples of antigen-presenting cells include dendritic cells, macrophages, B cells, and tumor cells (pseudoantigen-presenting cells), wherein T cell stimulating factors (e.g., B7 or 4-1BBL) are forcibly expressed through, for example, gene transfer. In some embodiments, the antigen-presenting cells are dendritic cells.

[0390] The routes of administration for immune cells can include, for example, intratumoral, intradermal, subcutaneous, intravenous, intralymphatic, and intraperitoneal administration. In some embodiments, administration is intratumoral or intralymphatic. In some embodiments, immune cells are administered directly to cancerous tissue or lymph nodes.

[0391] In some implementations, the immune cells are T cells. T cells can be cells that have already come into contact with an antigen or with an antigen-presenting cell. For example, APCs can be cultured with tumor antigens specific to the patient's cancer to differentiate into, for example, CD8-positive cytotoxic T lymphocytes (CTLs) or CD4-positive helper T cells. The T cells thus established can be administered to an individual with cancer.

[0392] The source of naïve T cells is not particularly limited and can be derived, for example, from the peripheral blood of vertebrates. The naïve T cells used can be CD8-positive or CD4-positive cells isolated from PBMC fractions. In some embodiments, the naïve T cells are CD8-positive or CD4-positive cells mixed with other cells and components without being isolated from PBMC fractions, in terms of efficiency in inducing CTLs. For example, when cells from PBMC fractions are cultured in a medium supplemented with serum and tumor antigens, PBMCs differentiate into dendritic cell precursors. These precursors then bind to a peptide and differentiate into dendritic cells as antigen-presenting cells that present that peptide / tumor antigen. The antigen-presenting cells stimulate CD8-positive T cells in the PBMCs to differentiate into CTLs. Thus, CTLs capable of recognizing the added peptide can be obtained. The CTLs thus obtained can be isolated and used directly as cancer vaccines. Alternatively, they can be further cultured in the presence of interleukins (e.g., IL-2), antigen-presenting cells, and tumor antigens before being used as cancer vaccines. There are no particular restrictions on the route of administration; examples include intradermal, subcutaneous, intravenous, and intratumoral administration.

[0393] On the one hand, this application provides the following technical solutions:

[0394] 1. A method for improving transfection efficiency, comprising the step of: ensuring that the content of nucleic acid molecules or fragments thereof with a size of at least about 48 kb accounts for less than about 10% of the total nucleic acid molecule content of the transfection mixture.

[0395] 2. A method for improving the efficiency of gene editing, comprising the steps of: ensuring that the content of nucleic acid molecules or fragments thereof of at least about 48 kb in size accounts for less than about 10% of the total nucleic acid molecule content of the transfection mixture.

[0396] 3. A method for improving the efficiency of DNA homologous recombination, comprising the step of: making the content of nucleic acid molecules or fragments thereof of at least about 48 kb in size account for less than about 10% of the total content of nucleic acid molecules in the transfection mixture.

[0397] 4. A method for improving cell viability after transfection, comprising the step of: ensuring that the content of nucleic acid molecules or fragments thereof with a size of at least about 48 kb accounts for less than about 10% of the total nucleic acid molecule content of the transfection mixture.

[0398] 5. A method for preparing a transfection mixture, comprising the step of: making the content of nucleic acid molecules or fragments thereof with a size of at least about 48 kb account for less than about 10% of the total nucleic acid molecule content of the transfection mixture.

[0399] 6. A method for determining the quality of a transfection mixture, comprising the steps of: determining whether the content of nucleic acid molecules or fragments thereof with a size of at least about 48 kb accounts for less than about 10% of the total nucleic acid molecule content of the transfection mixture.

[0400] 7. The method according to any one of claims 1-6 of this aspect, wherein the size of the nucleic acid molecule or fragment thereof is at least about 500 kb.

[0401] 8. The method according to any one of claims 1-7 of this aspect, wherein the size of the nucleic acid molecule or fragment thereof is at least about 1 Mb.

[0402] 9. The method according to any one of claims 1-8 of this aspect, wherein the size of the nucleic acid molecule or fragment thereof is at least about 10 Mb.

[0403] 10. The method according to any one of claims 1-9 of this aspect, wherein the nucleic acid molecule or fragment thereof is derived from microorganisms.

[0404] 11. The method according to claim 10 of this aspect, wherein the microorganism is selected from one or more of the group consisting of bacteria, fungi, actinomycetes, mycoplasma, chlamydia, rickettsia, and spirochetes.

[0405] 12. The method according to any one of claims 10-11 of this aspect, wherein the microorganism comprises Gram-negative bacteria.

[0406] 13. The method according to any one of claims 10-12 of this aspect, wherein the microorganism comprises Escherichia coli.

[0407] 14. The method according to any one of claims 1-13 of this aspect, wherein the content of the nucleic acid molecule or fragment thereof with a size of at least about 48 kb accounts for less than about 2% of the total nucleic acid molecule content of the transfection mixture.

[0408] 15. The method according to any one of claims 1-14 of this aspect, wherein the content of the nucleic acid molecule or fragment thereof with a size of at least about 48 kb accounts for less than about 5‰ of the total nucleic acid molecule content of the transfection mixture.

[0409] 16. The method according to any one of claims 1-15 of this aspect, wherein the content of the nucleic acid molecule or fragment thereof with a size of at least about 48 kb accounts for less than about 1‰ of the total nucleic acid molecule content of the transfection mixture.

[0410] 17. The method according to any one of claims 1-16 of this aspect, wherein the transfection includes transient transfection and / or stable transfection.

[0411] 18. The method according to any one of claims 1-17 of this aspect, wherein the transfection includes electrotransfer.

[0412] 19. The method according to any one of claims 1-18 of this aspect, wherein the transfection comprises transfecting cells.

[0413] 20. The method according to any one of claims 4, 7-19 of this aspect, wherein the cell comprises a eukaryotic cell.

[0414] 21. The method according to any one of claims 4, 7-20 of this aspect, wherein the cells comprise stem cells, immune cells, fibroblasts and / or muscle cells.

[0415] 22. The method according to solution 21 of this aspect, wherein the stem cells include pluripotent stem cells.

[0416] 23. The method according to any one of claims 21-22 of this aspect, wherein the stem cells include hematopoietic stem cells and / or mesenchymal stem cells.

[0417] 24. The method according to any one of claims 21-23 of this aspect, wherein the immune cells are selected from the group consisting of: unactivated or activated T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes and mast cells.

[0418] 25. The method according to any one of claims 1-24 of this aspect, wherein the transfection mixture comprises a plasmid.

[0419] 26. The method according to technical solution 25 of this aspect, wherein the plasmid is a circular plasmid, a supercoiled plasmid, or a linear plasmid.

[0420] 27. The method according to any one of claims 25-26 of this aspect, wherein the plasmid is a DNA plasmid.

[0421] 28. The method according to any one of claims 25-27 of this aspect, wherein the plasmid comprises a multiple cloning site.

[0422] 29. The method according to any one of claims 25-28 of this aspect, wherein the plasmid comprises an exogenous promoter.

[0423] 30. The method according to any one of claims 25-29 of this aspect, wherein the nucleic acid molecule or fragment thereof of at least 48 kb size exists in a different nucleic acid molecule from the plasmid.

[0424] 31. The method according to any one of the technical solutions 1-30 of this aspect, comprising the following steps: reducing the content of nucleic acid molecules or fragments thereof of at least about 48 kb in the transfection mixture.

[0425] 32. The method according to claim 31 of this aspect, wherein the reduction includes purifying the transfection mixture.

[0426] 33. The method according to any one of claims 31-32 of this aspect, wherein the reduction comprises purifying the transfection mixture using a reagent selected from the group consisting of: DNase, SDS, TX-100, CTAB and cesium chloride-ethidium bromide.

[0427] 34. The method according to any one of claims 31-33 of this aspect, wherein the reduction includes using methods selected from the group consisting of: artificial DNA synthesis of plasmids according to any one of claims 25-33 of this aspect.

[0428] 35. The method according to any one of claims 2, 7-34 of this aspect, wherein the gene editing method is selected from one or more of the following: CRISPR / Cas system, RNA editing system ADAR, RNA-directed endonuclease, zinc finger protease, Mega-TAL nuclease, TALENs and Meganucleases.

[0429] 36. The method according to any one of claims 2, 7-35 of this aspect, wherein the gene editing includes gene editing knockout and / or gene editing knock-in.

[0430] 37. The method according to any one of claims 2, 7-36 of this aspect, wherein the gene editing includes gene editing knock-in.

[0431] 38. The method according to any one of claims 25-37 of this aspect, wherein the plasmid is used as a donor plasmid in the gene editing knock-in.

[0432] 39. The method according to solution 38 of this aspect, wherein the donor plasmid comprises a nucleic acid molecule or a fragment thereof of the foreign gene to be knocked in.

[0433] 40. The method according to claim 39 of this aspect, wherein the exogenous gene includes a nucleic acid molecule encoding at least one of the following proteins: antibody or antigen-binding fragment, chimeric antigen receptor (CAR), cytokine, and chemokine.

[0434] 41. The method according to the present invention, 40, wherein the antibody or antigen-binding fragment comprises a bispecific antibody or antigen-binding fragment.

[0435] 42. The method according to any one of claims 40-41 of this aspect, wherein the antibody or antigen-binding fragment comprises a bispecific T-cell adaptor (BiTE).

[0436] 43. The method according to any one of claims 38-42 of this aspect, wherein the donor plasmid comprises a homologous arm that is homologous to the end of the nucleic acid molecule or fragment thereof of the foreign gene to be knocked in.

[0437] 44. The method according to technical solution 43 of this aspect, wherein the homologous arm is 100-1000bp in size.

[0438] 45. The method according to any one of claims 4, 7-44 of this aspect, wherein the cell viability includes indicators selected from the group consisting of: cell survival rate, cell expansion capacity, cell killing capacity, cell secretion capacity, cell preservation capacity, and cell resuscitation capacity.

[0439] 46. ​​The method according to any one of claims 1-45 of this aspect comprises the step of: determining the content of the nucleic acid molecule or fragment thereof with a size of at least about 48 kb.

[0440] 47. The method according to any one of the technical solutions 1-46 of this aspect, comprising the step of: determining the total content of nucleic acid molecules in the transfection mixture.

[0441] 48. Cells and / or cell lines prepared by any one of the methods described in any one of claims 1-47 of this aspect.

[0442] 49. The transfection mixture prepared by any one of the methods described in any one of claims 1-47 of this aspect.

[0443] 50. A method for improving transfection efficiency, comprising the step of: making the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) less than about 10% of the total nucleic acid molecules in the transfection mixture.

[0444] 51. A method for improving the efficiency of gene editing, comprising the step of: making the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) less than about 10% of the total content of nucleic acid molecules in the transfection mixture.

[0445] 52. A method for improving the efficiency of DNA homologous recombination, comprising the step of: making the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) less than about 10% of the total content of nucleic acid molecules in the transfection mixture.

[0446] 53. A method for improving cell viability after transfection, comprising the step of: making the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) less than about 10% of the total nucleic acid molecules in the transfection mixture.

[0447] 54. A method for preparing a transfection mixture, comprising the step of: making the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) less than about 10% of the total nucleic acid molecules in the transfection mixture.

[0448] 55. A method for determining the quality of a transfection mixture, comprising the step of determining whether the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) is less than 10% of the total content of nucleic acid molecules in the transfection mixture.

[0449] 56. The method according to any one of claims 50-55 of this aspect, wherein the microorganism is selected from one or more of the group consisting of bacteria, fungi, actinomycetes, mycoplasma, chlamydia, rickettsia, and spirochetes.

[0450] 57. The method according to any one of claims 50-56 of this aspect, wherein the microorganism comprises Gram-negative bacteria.

[0451] 58. The method according to any one of claims 50-57 of this aspect, wherein the microorganism comprises Escherichia coli.

[0452] 59. The method according to any one of claims 50-58 of this aspect, wherein the nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism) is at least about 48 kb in size.

[0453] 60. The method according to any one of claims 50-59 of this aspect, wherein the nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism) is at least about 500 kb in size.

[0454] 61. The method according to any one of claims 50-60 of this aspect, wherein the nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism) is at least about 1 Mb in size.

[0455] 62. The method according to any one of claims 50-61 of this aspect, wherein the size of the nucleic acid molecule or fragment thereof derived from the genome of the host (e.g., a microorganism) is at least about 10 Mb.

[0456] 63. The method according to any one of claims 50-62 of this aspect, wherein the content of the nucleic acid molecules or fragments thereof derived from the genome of the host (e.g., microorganism) accounts for less than about 2% of the total nucleic acid molecules in the transfection mixture.

[0457] 64. The method according to any one of claims 50-63 of this aspect, wherein the content of nucleic acid molecules or fragments thereof derived from the genome of the host (e.g., microorganism) accounts for less than about 5‰ of the total content of nucleic acid molecules in the transfection mixture.

[0458] 65. The method according to any one of claims 50-64 of this aspect, wherein the content of the nucleic acid molecules or fragments thereof derived from the genome of the host (e.g., microorganism) accounts for less than about 1‰ of the total nucleic acid molecules in the transfection mixture.

[0459] 66. The method according to any one of claims 50-65 of this aspect, wherein the transfection includes transient transfection and / or stable transfection.

[0460] 67. The method according to any one of claims 50-66 of this aspect, wherein the transfection comprises electrotransfer.

[0461] 68. The method according to any one of claims 50-67 of this aspect, wherein the transfection comprises transfecting cells.

[0462] 69. The method according to any one of claims 53, 56-68 of this aspect, wherein the cell comprises a eukaryotic cell.

[0463] 70. The method according to any one of claims 53, 56-69 of this aspect, wherein the cells comprise stem cells, immune cells, fibroblasts and / or muscle cells.

[0464] 71. The method according to solution 70 of this aspect, wherein the stem cells include pluripotent stem cells.

[0465] 72. The method according to any one of claims 70-71 of this aspect, wherein the stem cells include hematopoietic stem cells and / or mesenchymal stem cells.

[0466] 73. The method according to any one of claims 70-72 of this aspect, wherein the immune cells are selected from the group consisting of: unactivated or activated T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes, and mast cells.

[0467] 74. The method according to any one of claims 50-73 of this aspect, wherein the transfection mixture comprises a plasmid.

[0468] 75. The method according to solution 74 of this aspect, wherein the plasmid is a circular plasmid, a supercoiled plasmid, or a linear plasmid.

[0469] 76. The method according to any one of claims 74-75 of this aspect, wherein the plasmid is a DNA plasmid.

[0470] 77. The method according to any one of claims 74-76 of this aspect, wherein the plasmid comprises a multiple cloning site.

[0471] 78. The method according to any one of claims 74-77 of this aspect, wherein the plasmid comprises an exogenous promoter.

[0472] 79. The method according to any one of claims 50-78 of this aspect, wherein the nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism) exists in a different nucleic acid molecule from the plasmid.

[0473] 80. The method according to any one of claims 50-79 of this aspect, comprising the step of: reducing the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) in the transfection mixture.

[0474] 81. The method according to claim 80 of this aspect, wherein the reduction includes purifying the transfection mixture.

[0475] 82. The method according to any one of claims 80-81 of this aspect, wherein the reduction comprises purifying the transfection mixture using a reagent selected from the group consisting of: DNase, SDS, TX-100, CTAB, and cesium chloride-ethidium bromide.

[0476] 83. The method according to any one of claims 80-82 of this aspect, wherein the reduction includes using methods selected from the group consisting of: artificial DNA synthesis of plasmids according to any one of claims 74-82 of this aspect.

[0477] 84. The method according to any one of claims 51, 56-83 of this aspect, wherein the gene editing method is selected from one or more of the following: CRISPR / Cas system, RNA editing system ADAR, RNA-directed endonuclease, zinc finger protease, Mega-TAL nuclease, TALENs and Meganucleases.

[0478] 85. The method according to any one of the technical solutions 51, 56-84 of this aspect, wherein the gene editing includes gene editing knockout and / or gene editing knock-in.

[0479] 86. The method according to any one of the technical solutions 51, 56-85 of this aspect, wherein the gene editing includes gene editing knock-in.

[0480] 87. The method according to any one of claims 74-86 of this aspect, wherein the plasmid is used as a donor plasmid in the gene editing knock-in.

[0481] 88. The method according to solution 87 of this aspect, wherein the donor plasmid comprises a nucleic acid molecule or a fragment thereof of the foreign gene to be knocked in.

[0482] 89. The method according to claim 88 of this aspect, wherein the exogenous gene comprises a nucleic acid molecule encoding at least one of the following proteins: antibody or antigen-binding fragment, chimeric antigen receptor (CAR), cytokine, and chemokine.

[0483] 90. The method according to claim 89 of this aspect, wherein the antibody or antigen-binding fragment includes a bispecific antibody or antigen-binding fragment.

[0484] 91. The method according to any one of claims 89-90 of this aspect, wherein the antibody or antigen-binding fragment comprises a bispecific T-cell adaptor (BiTE).

[0485] 92. The method according to any one of claims 87-91 of this aspect, wherein the donor plasmid comprises a homologous arm that is homologous to the end of a nucleic acid molecule or fragment thereof of the foreign gene to be knocked in.

[0486] 93. The method according to technical solution 92 of this aspect, wherein the homologous arm is 100-1000bp in size.

[0487] 94. The method according to any one of the technical solutions 53, 56-93 of this aspect, wherein the cell viability includes indicators selected from the group consisting of: cell survival rate, cell expansion capacity, cell killing capacity, cell secretion capacity, cell preservation capacity, and cell resuscitation capacity.

[0488] 95. The method according to any one of claims 50-94 of this aspect comprises the step of: determining the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism).

[0489] 96. The method according to any one of the technical solutions 50-95 of this aspect, comprising the step of: determining the total content of nucleic acid molecules in the transfection mixture.

[0490] 97. Cells and / or cell lines prepared by any one of the methods described in any one of claims 50-96 of this aspect.

[0491] 98. The transfection mixture prepared by any one of the methods described in any one of claims 50-97 of this aspect.

[0492] On the other hand, this application also provides the following technical solutions:

[0493] 1. A method for transfecting a foreign gene into a cell using a plasmid, wherein the foreign gene comprises a nucleic acid molecule encoding a chimeric antigen receptor (CAR), and the foreign gene is integrated into the genome of the transfected cell.

[0494] 2. The method according to technical solution 1 of this aspect, wherein the size of the exogenous gene is at least about 1000 bp.

[0495] 3. The method according to any one of the technical solutions 1-2 of this aspect, wherein the size of the exogenous gene is at least about 3500 bp.

[0496] 4. The method according to any one of the technical solutions 1-3 of this aspect, wherein the size of the exogenous gene is at most about 10kb.

[0497] 5. The method according to any one of claims 1-4 of this aspect, wherein the exogenous gene comprises a nucleic acid molecule encoding a chimeric antigen receptor (CAR) and / or a second protein, the second protein being different from the chimeric antigen receptor.

[0498] 6. The method according to claim 5 of this aspect, wherein the chimeric antigen receptor comprises at least one antigen-binding domain targeting the antigen.

[0499] 7. The method according to any one of claims 5-6 of this aspect, wherein the second protein is selected from at least one of the following: cytokines, chemokines, and antibodies or antigen-binding fragments thereof.

[0500] 8. The method according to any one of claims 5-7 of this aspect, wherein the second protein comprises a bispecific antibody.

[0501] 9. The method according to any one of claims 5-8 of this aspect, wherein the second protein comprises a bispecific T-cell adaptor (BiTE).

[0502] 10. The method according to any one of claims 1-9 of this aspect, wherein the transfection includes stable transfection.

[0503] 11. The method according to any one of claims 1-10 of this aspect, wherein the transfection includes electrotransfer.

[0504] 12. The method according to any one of the technical solutions 1-11 of this aspect, wherein the transfection includes gene editing knock-in using gene editing means.

[0505] 13. The method according to technical solution 12 of this aspect, wherein the gene editing method is selected from one or more of the following: CRISPR / Cas system, RNA editing system ADAR, RNA-directed endonuclease, zinc finger protease, Mega-TAL nuclease, TALENs and Meganucleases.

[0506] 14. The method according to technical solutions 12-13 of this aspect, wherein the plasmid is used as a donor plasmid in the gene editing knock-in.

[0507] 15. The method according to any one of claims 1-14 of this aspect, wherein the plasmid comprises a multiple cloning site.

[0508] 16. The method according to any one of claims 1-15 of this aspect, wherein the plasmid comprises an exogenous promoter.

[0509] 17. The method according to any one of claims 1-16 of this aspect, wherein the plasmid comprises a homologous arm that is homologous to the end of the foreign gene or a fragment thereof.

[0510] 18. The method according to technical solution 17 of this aspect, wherein the homologous arm is 100-1000bp in size.

[0511] 19. The method according to any one of claims 1-18 of this aspect, wherein the plasmid comprises a circular plasmid.

[0512] 20. The method according to any one of claims 1-19 of this aspect, wherein the plasmid is a DNA plasmid.

[0513] 21. The method according to any one of claims 1-20 of this aspect, wherein the cell comprises a eukaryotic cell.

[0514] 22. The method according to any one of claims 1-21 of this aspect, wherein the cells include immune cells, stem cells, immune cells, fibroblasts and / or muscle cells.

[0515] 23. The method according to claim 22 of this aspect, wherein the immune cells are selected from the group consisting of: inactive or activated T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes and mast cells.

[0516] 24. The method according to any one of claims 22-23 of this aspect, wherein the stem cells include pluripotent stem cells.

[0517] 25. The method according to any one of claims 22-24 of this aspect, wherein the stem cells include hematopoietic stem cells and / or mesenchymal stem cells.

[0518] 26. The method according to any one of claims 1-25 of this aspect, wherein in the transfection mixture containing the plasmid, the content of nucleic acid molecules or fragments thereof of at least about 48 kb in size accounts for less than about 10% of the total content of nucleic acid molecules in the transfection mixture.

[0519] 27. The method according to claim 26 of this aspect, wherein the content of the nucleic acid molecule or fragment thereof with a size of at least about 48 kb accounts for less than about 2% of the total nucleic acid molecule content of the transfection mixture.

[0520] 28. The method according to any one of claims 26-27 of this aspect, wherein the content of the nucleic acid molecule or fragment thereof with a size of at least about 48 kb accounts for less than about 5‰ of the total nucleic acid molecule content of the transfection mixture.

[0521] 29. The method according to any one of claims 26-28 of this aspect, wherein the content of the nucleic acid molecule or fragment thereof with a size of at least about 48 kb accounts for less than about 1‰ of the total nucleic acid molecule content of the transfection mixture.

[0522] 30. The method according to any one of claims 26-29 of this aspect, wherein the nucleic acid molecule or fragment thereof of at least about 48 kb is at least about 1 Mb in size.

[0523] 31. The method according to any one of claims 26-30 of this aspect, wherein the nucleic acid molecule or fragment thereof, which is at least about 48 kb in size, is at least about 10 Mb in size.

[0524] 32. The method according to any one of claims 26-31 of this aspect, wherein the nucleic acid molecule or fragment thereof of at least about 48 kb in size is derived from microorganisms.

[0525] 33. The method according to any one of claims 1-32 of this aspect, wherein in the transfection mixture containing the plasmid, the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) accounts for less than about 10% of the total content of nucleic acid molecules in the transfection mixture.

[0526] 34. The method according to any one of claims 1-33 of this aspect, wherein in the transfection mixture containing the plasmid, the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) accounts for less than about 2% of the total content of nucleic acid molecules in the transfection mixture.

[0527] 35. The method according to any one of claims 1-34 of this aspect, wherein in the transfection mixture containing the plasmid, the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) accounts for less than about 5‰ of the total content of nucleic acid molecules in the transfection mixture.

[0528] 36. The method according to any one of claims 1-35 of this aspect, wherein in the transfection mixture containing the plasmid, the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) accounts for less than about 1‰ of the total content of nucleic acid molecules in the transfection mixture.

[0529] 37. The method according to claim 36 of this aspect, wherein the nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism) is at least about 48 kb in size.

[0530] 38. The method according to any one of claims 36-37 of this aspect, wherein the nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism) is at least about 1 Mb in size.

[0531] 39. The method according to any one of claims 36-38 of this aspect, wherein the nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism) is at least about 10 Mb in size.

[0532] 40. The method according to any one of claims 36-39 of this aspect, wherein the microorganism is selected from one or more of the group consisting of bacteria, fungi, actinomycetes, mycoplasma, chlamydia, rickettsia, and spirochetes.

[0533] 41. The method according to any one of claims 36-40 of this aspect, wherein the microorganism comprises Gram-negative bacteria.

[0534] 42. The method according to any one of claims 36-41 of this aspect, wherein the microorganism comprises Escherichia coli.

[0535] 43. Cells and / or cell lines prepared by any one of the methods described in any one of claims 1-42 of this aspect.

[0536] 44. The cells and / or cell lines according to the present invention, as described in technical solution 43, simultaneously express CAR and BiTE.

[0537] 45. The cells and / or cell lines according to any one of claims 43-44 of this aspect, which simultaneously express CAR and at least one cytokine.

[0538] 46. ​​The application of reducing the proportion of nucleic acid molecules or fragments of at least about 48 kb in the total nucleic acid molecule content of a transfection mixture containing a plasmid in improving transfection efficiency of cells transfected with said plasmid containing a foreign gene encoding a combined CAR.

[0539] 47. The application of reducing the proportion of nucleic acid molecules or fragments thereof derived from the host (e.g., microorganism) genome to the total nucleic acid molecule content of a transfection mixture containing a plasmid in improving transfection efficiency of cells transfected with said plasmid containing a foreign gene encoding a combined CAR.

[0540] 48. The application according to any one of the technical solutions 46-47 of this aspect, wherein the combined CAR is selected from the group consisting of CAR-BiTE, CAR-cytokine and CAR containing at least two different target antigens.

[0541] On the other hand, this application also provides the following technical solutions:

[0542] 1. A method for increasing the efficiency of plasmid transfection into cells, comprising the steps of: transfecting cells with a plasmid containing a foreign gene that has been treated with deoxyribonuclease (DNase).

[0543] 2. The method according to technical solution 1 of this aspect, wherein the transfection includes transient transfection and / or stable transfection.

[0544] 3. The method according to any one of the technical solutions 1-2 of this aspect, wherein the transfection includes electrotransfer.

[0545] 4. The method according to any one of the technical solutions 1-3 of this aspect, wherein the exogenous gene is transiently transfected into the cell.

[0546] 5. The method according to any one of the technical solutions 1-4 of this aspect, wherein after the transient transfection, the cell expresses the protein encoded by the exogenous gene.

[0547] 6. The method according to any one of claims 2-5 of this aspect, wherein the stable transfection includes the use of a transposon system and / or gene editing methods.

[0548] 7. The method according to any one of claims 2-6 of this aspect, wherein after the stable transfection, the exogenous gene is integrated into the genome of the cell.

[0549] 8. The method according to any one of claims 2-7 of this aspect, wherein the stable transfection includes the use of the Sleeping Beauty transposon system.

[0550] 9. The method according to any one of claims 2-8 of this aspect, wherein the stable transfection method is selected from one or more of the following: CRISPR / Cas system, ADAR RNA editing system, RNA-directed endonuclease, zinc finger protease, Mega-TAL nuclease, TALENs and Meganucleases.

[0551] 10. The method according to any one of claims 2-9 of this aspect, wherein the stable transfection includes gene editing knock-in.

[0552] 11. The method according to solution 10 of this aspect, wherein the plasmid is used as a donor plasmid in the gene editing knock-in.

[0553] 12. The method according to any one of claims 1-11 of this aspect, wherein the DNase is capable of cleaving single-stranded DNA and / or double-stranded DNA.

[0554] 13. The method according to any one of claims 1-12 of this aspect, wherein the DNase is capable of non-specifically cleaving linear DNA.

[0555] 14. The method according to any one of claims 1-13 of this aspect, wherein the DNase is capable of cleaving linear double-stranded DNA.

[0556] 15. The method according to any one of claims 1-14 of this aspect, wherein the DNase treatment comprises the step of contacting the DNase with the plasmid.

[0557] 16. The method according to claim 15 of this aspect, wherein the contact includes contact in a buffer environment, the buffer containing Mg2+ and Ca2+.

[0558] 17. The method according to any one of claims 1-16 of this aspect, wherein the DNase treatment comprises the step of: purifying the plasmid after the contact.

[0559] 18. The method according to any one of claims 1-17 of this aspect, wherein the cell comprises a eukaryotic cell.

[0560] 19. The method according to any one of claims 1-18 of this aspect, wherein the cells comprise stem cells, immune cells, fibroblasts and / or muscle cells.

[0561] 20. The method according to claim 19 of this aspect, wherein the stem cells include pluripotent stem cells.

[0562] 21. The method according to any one of claims 19-20 of this aspect, wherein the stem cells include hematopoietic stem cells and / or mesenchymal stem cells.

[0563] 22. The method according to any one of claims 19-21 of this aspect, wherein the immune cells are selected from the group consisting of: unactivated or activated T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes and mast cells.

[0564] 23. The method according to any one of claims 1-22 of this aspect, wherein the plasmid comprises a circular plasmid.

[0565] 24. The method according to any one of claims 1-23 of this aspect, wherein the plasmid is a DNA plasmid.

[0566] 25. The method according to any one of claims 1-24 of this aspect, wherein the plasmid comprises a multiple cloning site.

[0567] 26. The method according to any one of claims 1-25 of this aspect, wherein the plasmid comprises an exogenous promoter.

[0568] 27. The method according to any one of claims 1-26 of this aspect, wherein the plasmid comprises a homologous arm that is homologous to the end of the exogenous gene or a fragment thereof.

[0569] 28. The method according to technical solution 27 of this aspect, wherein the homologous arm is 100-1000bp in size.

[0570] 29. The method according to any one of claims 1-28 of this aspect, wherein the exogenous gene comprises a nucleic acid molecule encoding a chimeric antigen receptor (CAR).

[0571] 30. The method according to any one of claims 1-29 of this aspect, wherein the exogenous gene comprises a nucleic acid molecule encoding a chimeric antigen receptor (CAR) and / or a second protein, the second protein being different from the chimeric antigen receptor.

[0572] 31. The method according to claim 30 of this aspect, wherein the second protein is selected from at least one of the following: cytokines, chemokines, and antibodies or antigen-binding fragments thereof.

[0573] 32. The method according to any one of claims 30-31 of this aspect, wherein the second protein comprises a bispecific antibody.

[0574] 33. The method according to any one of claims 30-32 of this aspect, wherein the second protein comprises a bispecific T cell connector (BiTE).

[0575] 34. The method according to any one of claims 1-33 of this aspect, wherein the size of the exogenous gene is at least about 1000 bp.

[0576] 35. The method according to any one of claims 1-34 of this aspect, wherein the size of the exogenous gene is at least about 3500 bp.

[0577] 36. The method according to any one of claims 1-35 of this aspect, wherein the size of the exogenous gene is at least about 5000 bp.

[0578] 37. The method according to any one of claims 1-36 of this aspect, wherein the size of the exogenous gene is at most about 10 kb.

[0579] 38. The method according to any one of claims 1-37 of this aspect, wherein after treatment with the DNase, the content of nucleic acid molecules or fragments thereof of at least about 48 kb in size in the transfection mixture containing the plasmid accounts for less than about 10% of the total nucleic acid molecule content of the transfection mixture.

[0580] 39. The method according to claim 38 of this aspect, wherein the content of the nucleic acid molecule or fragment thereof with a size of at least about 48 kb accounts for less than about 2% of the total nucleic acid molecule content of the transfection mixture.

[0581] 40. The method according to any one of claims 38-39 of this aspect, wherein the content of the nucleic acid molecule or fragment thereof with a size of at least about 48 kb accounts for less than about 5‰ of the total nucleic acid molecule content of the transfection mixture.

[0582] 41. The method according to any one of claims 38-40 of this aspect, wherein the content of the nucleic acid molecule or fragment thereof with a size of at least about 48 kb accounts for less than about 1‰ of the total nucleic acid molecule content of the transfection mixture.

[0583] 42. The method according to any one of claims 38-41 of this aspect, wherein the nucleic acid molecule or fragment thereof of at least about 48 kb is at least about 1 Mb in size.

[0584] 43. The method according to any one of claims 38-42 of this aspect, wherein the nucleic acid molecule or fragment thereof of at least about 48 kb is at least about 10 Mb in size.

[0585] 44. The method according to any one of claims 38-43 of this aspect, wherein the nucleic acid molecule or fragment thereof of at least about 48 kb in size is derived from microorganisms.

[0586] 45. The method according to any one of claims 1-44 of this aspect, wherein after treatment with the DNase, the content of nucleic acid molecules or fragments thereof derived from the genome of the host (e.g., microorganism) in the transfection mixture containing the plasmid is less than about 10% of the total nucleic acid molecules in the transfection mixture.

[0587] 46. ​​The method according to claim 45 of this aspect, wherein the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) accounts for less than about 2% of the total nucleic acid molecule content of the transfection mixture.

[0588] 47. The method according to any one of claims 45-46 of this aspect, wherein the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) accounts for less than about 5‰ of the total content of nucleic acid molecules in the transfection mixture.

[0589] 48. The method according to any one of claims 45-47 of this aspect, wherein the content of nucleic acid molecules or fragments thereof derived from the genome of a host (e.g., a microorganism) accounts for less than about 1‰ of the total content of nucleic acid molecules in the transfection mixture.

[0590] 49. The method according to any one of claims 45-48 of this aspect, wherein the nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism) is at least about 48 kb in size.

[0591] 50. The method according to any one of claims 45-49 of this aspect, wherein the nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism) is at least about 1 Mb in size.

[0592] 51. The method according to any one of claims 45-50 of this aspect, wherein the nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism) is at least about 10 Mb in size.

[0593] 52. The method according to any one of claims 45-51 of this aspect, wherein the microorganism is selected from one or more of the group consisting of bacteria, fungi, actinomycetes, mycoplasma, chlamydia, rickettsia, and spirochetes.

[0594] 53. The method according to any one of claims 45-52 of this aspect, wherein the microorganism comprises Gram-negative bacteria.

[0595] 54. The method according to any one of claims 45-53 of this aspect, wherein the microorganism comprises Escherichia coli.

[0596] 55. Cells and / or cell lines prepared by any one of the methods described in any one of claims 1-54 of this aspect.

[0597] 56. The use of deoxyribonuclease (DNase) in processing plasmids to enable their use in transient transfection of cells.

[0598] 57. A kit for improving plasmid transfection efficiency, comprising deoxyribonuclease (DNase) and reagents and / or instruments required for transient transfection.

[0599] 58. The kit according to claim 57 of this aspect, wherein the reagents required for transient transfection include the reagents required for electroporation.

[0600] 59. The kit according to claim 58 of this aspect, wherein the reagents required for electroporation include ddH2O and / or glycerol.

[0601] 60. The kit according to any one of claims 57-59 of this aspect, wherein the DNase is capable of cleaving single-stranded DNA and / or double-stranded DNA.

[0602] 61. The kit according to any one of claims 57-60 of this aspect, wherein the DNase is capable of nonspecifically cleaving linear DNA.

[0603] 62. The kit according to any one of claims 57-61 of this aspect, wherein the DNase comprises an exonuclease.

[0604] 63. The kit according to any one of claims 57-62 of this aspect, comprising a buffer solution, said buffer solution containing Mg 2+ and Ca 2+ .

[0605] Without being limited by any theory, the embodiments described below are merely for illustrating the various technical solutions of this application and are not intended to limit the scope of the invention.

[0606] Example

[0607] Example 1: Detection of the content of host genomic DNA in plasmids

[0608] The quantitative PCR (qPCR) method was used to determine the nucleic acid molecules or fragments thereof derived from the host (e.g., microorganism) genome contained in commercially available plasmids (where plasmids are referred to as source A plasmids and source B plasmids according to their different sources of purchase) (i.e., host genomic DNA).

[0609] In addition, multiple parameters (such as ring opening, supercoiling, polymer, and endotoxin content) of plasmids from source A and source B were detected. The results for ring opening, supercoiling, and polymer were obtained by HPLC detection provided by Beijing Yiqiao Shenzhou Technology Co., Ltd.; the endotoxin content was obtained by detection provided by Beijing Yiqiao Shenzhou Technology Co., Ltd.

[0610] The results of the measurement Figure 1 As shown. Figure 1 The results showed no significant differences in the open circularity, supercoilability, multimerity, and endotoxin content of these plasmids; however, there were significant differences in the content of host-derived (e.g., microorganism) genomic DNA in these plasmids.

[0611] In addition, the DNA in plasmids from source A and source B was analyzed by gel electrophoresis. Among them, plasmids 3-A, 5-A, 6-A and 7A were plasmids from source A, and plasmids 3-B, 5-B, 5B-2, 6B and 7B were plasmids from source B.

[0612] The results are as follows Figure 2 As shown, M represents the electrophoresis result corresponding to the marker; 1-9 are the electrophoresis results of different plasmids (the amount of DNA added to each lane is 100ng), and M1 shows the specific size of each fragment in the marker.

[0613] Figure 2 The results indicate that plasmids from source B have less host genomic DNA and fewer bands larger than approximately 48.5 kb.

[0614] The plasmids used in this application are described in the following table:

[0615]

[0616]

[0617] In the CD19CAR, the amino acid sequence of the scFV targeting CD19 is shown in SEQ ID NO:10.

[0618] In the GPC3CAR, the amino acid sequence of the scFV targeting GPC3 is shown in SEQ ID NO:12.

[0619] Example 2: Plasmids with low host genomic DNA content have higher cell transfection efficiency.

[0620] 2.1 Expression of GFP

[0621] Plasmids 5-A (source A), 5-B (source B, industrial grade), and 5-B-2 (laboratory grade) were used. A chemically synthesized sgRNA targeting the human TRAC gene (5'TCAGGGTTCTGGATATCTGT (SEQ ID NO: 8, this sgRNA has three thiomethyl and three oxymethyl modifications at both the 5' and 3' ends, GenScript Biotech, Nanjing) was designed. The purchased Cas9 protein was from Sinocare (catalog number: 40572-A08B). The sgRNA and Cas9 protein were used to prepare ribonucleoproteins (RNPs) for subsequent cell modification.

[0622] 5-A, 5-B, and 5-B-2 were introduced into human T cells activated for two days with Dynabead (from Thermofisher, containing anti-CD3 and anti-CD28 antibodies) via electroporation, while the prepared RNPs were introduced into the cells. The nucleic acid molecule encoding GFP was integrated into the TRAC gene of the human T cells and expressed via the endogenous promoter of the TRAC gene.

[0623] The survival rate and cell proliferation of T cells transfected with plasmids 5-A, 5-B, or 5-B-2 were detected by FACS, and the expression level of GFP in the transfected T cells was also measured. The results are shown below. Figures 3A-3C As shown. Cell proliferation was obtained by counting cells as detected by 20-second FACS; cell viability data were obtained by verifying the gated cell populations of FSC-SSCs that were negative for propidium iodide (PI). The gated cell populations of GFP-positive cells were determined by the positivity rate of live cells in the control group being ≤1%.

[0624] In Figure 3, 1-4 show the results for the control group (1), 5-A (2), 5-B-2 (3), and 5-B (4), respectively. Figure 3A The results showed that, compared with plasmid 5-A, which contains more nucleic acid molecules or fragments of the host's genome (e.g., microorganisms), the viability of T cells transfected with plasmid 5-B or 5-B-2 was significantly improved. The lower the content of host genomic DNA, the higher the viability of T cells after transfection. Figure 3BThe results showed that, compared with plasmid 5-A which contains more host genomic DNA, the amplification capacity of T cells transfected with plasmid 5-B or 5-B-2 was significantly improved. The lower the content of host genomic DNA, the stronger the amplification capacity of T cells after transfection. Figure 3C The results showed that, compared with plasmid 5-A which contains more host genomic DNA, the expression level of GFP in T cells transfected with plasmid 5-B or 5-B-2 was significantly increased. The lower the content of host genomic DNA, the higher the expression level of GFP in T cells after transfection.

[0625] 2.2 Expression of GFP or CAR

[0626] Following the method described in Example 2.1, plasmids 3-A, 5-A, 6-A, 7-A, 3-B, 5-B, 5-B-2, 6-B, or 7-B were transfected into activated T cells via electroporation, resulting in a total of 25 transfected T cells that integrated the exogenous gene.

[0627] The relative overall expression level of the knock-in protein in these T cells was calculated, where relative overall expression level = T cell survival rate (%) * expression rate of knock-in protein in transfected T cells (%). The T cell survival rate was the cell survival rate on day 1 post-transfection; the T cell knock-in protein expression rate was the expression rate on day 4 post-transfection. The expression rate of GFP in transfected T cells was obtained by FACS detection; the expression rate of CD19CAR in transfected T cells was obtained by CD19 antibody detection (Cat#102, BioSwan Lab, Shanghai).

[0628] The results are as follows Figure 4 As shown, the curves represent the fitting curves of relative overall expression levels relative to the host genomic DNA content. The results indicate that the lower the content of host genomic DNA in the plasmid, the higher the cell survival rate of T cells and / or the expression rate of knock-in proteins after transfection.

[0629] 2.3 Expression of CAR

[0630] A chemically synthesized sgRNA (SEQ ID NO:8, purchased from Genscript Biotech, Nanjing) targeting the human TRAC gene was designed. This sgRNA has three thiomethyl and three oxymethyl modifications at both the 5' and 3' ends. The purchased Cas9 protein was sourced from Sinocare (catalog number: 40572-A08B).

[0631] The prepared plasmid 3u-B, sgRNA, and Cas9 (prepared as an RNP system, with a Cas9:sgRNA weight ratio of approximately 3:1) were mixed with human T cells activated by Dynabead for 2-3 days and electroporated. The nucleic acid molecule encoding the CD19CAR was integrated into the human TRAC gene and could be expressed through the endogenous promoter of the TRAC gene.

[0632] Following the method described in Example 2.1, the cell viability and proliferation of transfected T cells were statistically analyzed, and the expression level of CD19CAR in transfected T cells was detected. The results are as follows: Figures 5A-5C As shown. Cell proliferation was obtained by counting cells as detected by 20-second FACS; cell viability data were obtained by verifying the gated cell populations of FSC-SSCs that were negative for propidium iodide (PI). The results were verified using a cell counter NC-200. The gated cell populations of GFP-positive cells were determined by a GFP positivity rate of ≤1% in the control group. Figure 5C The control group in the figure consists of T cells that have not undergone any plasmid transfection.

[0633] Figure 5A The screen shows the status on the 5th day after the electrosurgical transfer. Figure 5A The results showed that T cells transfected with plasmids containing less host genomic DNA (e.g., plasmid 3eu-B) had excellent viability, exceeding approximately 80%. Figure 5B The data shows the status from day 0 to day 5 after electroporation. Figure 5B The results indicate that T cells transfected with plasmids containing less host genomic DNA have excellent amplification capabilities. Figure 5C The screen showed the situation on the second day after the electrosurgical transfer. Figure 5C The results indicate that T cells transfected with plasmids containing less host genomic DNA exhibit superior expression levels of exogenous proteins (i.e., a high positive rate of exogenous protein expression). This demonstrates that lower levels of host genomic DNA in the plasmid further promote cell survival and proliferation of transfected T cells, and enhance the expression level of exogenous proteins integrated into the T cell genome.

[0634] Example 3: Plasmids containing less host genomic DNA were transfected into immune effector cells, which were then able to specifically kill tumor cells.

[0635] 3.1 In vitro specific killing of tumor cells

[0636] A chemically synthesized sgRNA (SEQ ID NO:8, purchased from Genscript Biotech, Nanjing) targeting the human TRAC gene was designed. This sgRNA has three thiomethyl and three oxymethyl modifications at both the 5' and 3' ends. The purchased Cas9 protein was sourced from Sinocare (catalog number: 40572-A08B).

[0637] The aforementioned plasmid 3eu-B, sgRNA, and Cas9 (prepared as an RNP system, with a Cas9:sgRNA weight ratio of approximately 3:1) were mixed with human T cells activated by Dynabead for 2-3 days and electroporated to obtain 3eu-B CART cells.

[0638] 3-U-B CART cells were co-incubated with Calcein-AM (Invitrogen, Catalog No. Cat#C3099) labeled target cells Nalm6 (Clone G5, CRL3273, ATCC) (human B-type acute lymphoblastic leukemia cells). After incubation, the target cell mortality rate resulting from CART cell killing of target cells was calculated. Mortality rate = N D / N L *100%. Where N L N represents the number of target cells collected in 20 seconds during FACS detection. D This represents the number of target cells that died.

[0639] The mortality rate results are as follows Figure 6 As shown. Among them. Figure 6 The graph shows the mortality rate of Nalm6 target cells, with the x-axis E:T representing the ratio of effector cells (CART cells) to target cells (tumor cells). 1-4 represent the results of 34 hours of 3U-B CART cell killing, 10 hours of 3U-B CART cell killing, 34 hours of control T cell killing, and 10 hours of control T cell killing, respectively. The control group consists of T cells that have not undergone any plasmid transfection.

[0640] Figure 6 The results showed that T cells transfected with this plasmid had good tumor cell killing ability when the host genomic DNA content was low.

[0641] 3.2 In vivo specific killing of tumor cells

[0642] NCG mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were injected with 1x10 6 A mouse model of B-type acute lymphoblastic leukemia was established by intravenous injection of Nalm-6-luc cells (purchased from PharmaLegacy, Shanghai) at a concentration of / ml.

[0643] Four days later, 1x10 mg of the drug was administered to three mice in the mouse animal model. 8 100 μl of the 3-U-B CART cells described in Example 3.1 and PBMC cells derived from the same cell donor were injected via tail vein at a concentration of / mL, and these mice were designated as the experimental group. Two other mice in the mouse model were injected only with 1x10 / mL. 8PBMC cells were administered via tail vein injection at a concentration of / mL, with 100 μl of the cells injected without any other treatment, serving as a control group.

[0644] Tumor status in experimental and control mice was detected by fluorescence detection (Lumina XRMS, PerkinElmer) on days 3, 7, 11, or 14 after intravenous injection of the CART cells. Results are as follows: Figure 7 As shown.

[0645] Figure 7 The results showed that the tumors in the control group grew rapidly, while the tumors in the experimental group almost disappeared (no fluorescence value was detected). This demonstrates that even with low levels of host genomic DNA, these CAR-T cells, after plasmid transfection, exhibit a significant tumor-killing effect on mice.

[0646] Example 4: Plasmids containing less host genomic DNA, when transfected into T cells, were able to specifically kill tumor cells.

[0647] A chemically synthesized sgRNA (SEQ ID NO:8, purchased from Genscript Biotech, Nanjing) targeting the human TRAC gene was designed. This sgRNA has three thiomethyl and three oxymethyl modifications at both its 5' and 3' ends. The purchased Cas9 protein was sourced from Sinocare (catalog number: 40572-A08B).

[0648] Plasmid 19-B, sgRNA, and Cas9 (prepared as an RNP system, Cas9:sgRNA weight ratio approximately 3:1) were mixed and electroporated into human T cells activated by Dynabead for 2-3 days. The nucleic acid molecule encoding CD19CAR-2A-IL15 was knocked into the human TRAC gene and expressed through the endogenous promoter of the TRAC gene. The resulting cells were 19-BT cells.

[0649] Following the method in Example 2.1, the cell viability, CAR expression level, and cell proliferation of T cells after electroporation with plasmid 19-B were statistically analyzed. Simultaneously, following the method in Example 3, the mortality rate of Nalm6 target cells killed by T cells transfected with plasmid 19-B was statistically analyzed. The results are as follows: Figures 8A-8C As shown. Cell proliferation was obtained by counting cells as detected by 20-second FACS; cell viability data were obtained by verifying the cell population that was PI-negative in the FSC-SSC gate. The gate of CAR-positive cells was obtained by determining the positivity rate of live cells in the control group to be ≤1%.

[0650] Figure 8A The results show the results on days 2, 5, and 7 after electroporation, with T cells in group 1 transfected with plasmid 3-U-B and T cells in group 2 transfected with plasmid 19-B.

[0651] Figure 8A The results showed that the T cell viability after transfection with plasmid 19-B was similar to that of plasmid 3-B, both were excellent and exceeded 90% on day 7 after electroporation; at the same time, plasmid 19-B could also effectively express CD19CAR after transfection, but the expression level was slightly lower than that of plasmid 3-B.

[0652] Figure 8B The display shows the status on day 0, day 3, and day 6 after the electrocoagulation. Figure 8B The results indicate that T cells exhibit excellent amplification capacity after transfection with plasmids containing less host genomic DNA. Both plasmid 19-B and plasmid 3-U-B resulted in T cell amplification of approximately 10-fold or more after transfection.

[0653] Figure 8C The results show the mortality rate of target cells (Nalm6) on day 2 after electroporation. The x-axis E:T represents the ratio of effector cells (CAR-T cells) to target cells (tumor cells). Figure 8C In the table, 1-4 represent the results of 19-BT cell killing for 34 hours, 19-BT cell killing for 10 hours, and control T cell killing for 34 hours and 10 hours, respectively. The control T cells are T cells that have not been transfected with the plasmid. Figure 8C The results showed that the CAR cells (i.e., 19-BT cells) obtained by transfecting with a combination of CAR molecules (e.g., CD19CAR-IL-15) using the method described in this application had the ability to effectively kill tumor cells.

[0654] Example 5: T cells transfected with plasmids containing less host genomic DNA specifically kill tumor cells.

[0655] (1) Detect cell viability, cell expansion capacity, cell preservation capacity and cell resuscitation capacity.

[0656] A chemically synthesized sgRNA (SEQ ID NO:8, purchased from Genscript Biotech, Nanjing) targeting the human TRAC gene was designed. This sgRNA has three thiomethyl and three oxymethyl modifications at both its 5' and 3' ends. The purchased Cas9 protein was sourced from Sinocare (catalog number: 40572-A08B).

[0657] The plasmid 17-B, sgRNA, and Cas9 (prepared as an RNP system, with a Cas9:sgRNA weight ratio of approximately 3:1) were mixed with human T cells activated by Dynabead for 2-3 days and electroporated. The nucleic acid molecule encoding CD19CAR-2A-BiTE was knocked into the human TRAC gene and expressed through the endogenous promoter of the TRAC gene. 17-BT cells were obtained.

[0658] The results are as follows Figures 9A-9C As shown. Figure 9A Six days after electroporation, 17-BT cells and Nalm6 cells were co-cultured in a culture medium containing X vivo-15, 5% AB serum, 100 U / ml IL-2, 10 ng / mL IL-7 and 5 ng / mL IL-15 at an effector-to-target ratio (i.e., 17-BT cells: Nalm6 cells) of 2:1. Figure 9A The results showed that 17-BT cells could expand naturally in large quantities within 6 days after electroporation, and at the same time, with the assistance of target cell activation starting on day 6, they could expand even further.

[0659] Figure 9B The cell viability of 17-BT cells before and after cryopreservation and thawing is shown. The 17-BT cells were cryopreserved using CryoStor CS10 after 11 days of electroporation. Cell viability was measured using an NC-200 assay approximately 1 hour after cryopreservation and thawing. The results indicate that 17-BT cells maintained a high cell viability after cryopreservation and thawing.

[0660] Figure 9C The expression levels of CD19CAR in 17-BT cells at different time points were shown. Figure 9C The left and right columns show the expression levels of CD19CAR in 17-BT cells on day 6 after electroporation (before activation with Nalm6 target cells) and after cryopreservation and thawing following target cell activation, respectively. The results indicate that after activation with Nalm6 target cells, 17-BT cells can expand significantly again after initial spontaneous expansion following electroporation. The further expansion caused by target cell activation 6 days later also significantly increased the CAR positivity rate.

[0661] (2) Detecting cell killing ability

[0662] 17-BT cells were co-incubated with Calcein-AM-labeled target cells Nalm6 (Clone G5, CRL3273, ATCC) (human B-type acute lymphoblastic leukemia cells). The target cell mortality rate resulting from T cell killing of target cells was calculated after incubation. Mortality rate = N D / N L *100%. Where N L N represents the number of target cells collected in 20 seconds during FACS detection. D This represents the number of target cells that died.

[0663] The mortality rate results are as follows Figure 10 As shown. Among them. Figure 10 The results show the mortality rate of target cells Nalm6, with the x-axis E:T representing the ratio of effector cells (17-BT cells) to target cells (tumor cells). Figure 10 In the figures, 1-2 represent the killing effect of 17-BT cells (1) and control cells (2), respectively. The control cells are T cells that have not undergone any plasmid transfection.

[0664] Figure 10 The results showed that, even with low levels of host genomic DNA, this plasmid could be used to construct immune effector cells with good tumor-killing capabilities.

[0665] (3) Detect the killing ability of cell supernatant

[0666] 17-BT cells were cultured in Xvivo-15 medium containing 5% AB serum, 100 U / ml IL-2, 10 ng / ml IN-7, and 5 ng / ml IL-15. Cell concentration was maintained at 5 x 10⁻⁶ cells / ml. 5 -2x10 6 / ml. After 1 day of cell culture, the cell culture supernatant was collected by centrifugation. In the incubation of target cells (Nalm6) with a fixed effector-to-target ratio, 50 μl of 17-BT cell culture supernatant was added or not. After one day, the killing rate against the target cells was measured.

[0667] The results are as follows Figure 11 As shown in the figure. 1-2 represent the target cell killing effect in the supernatant of 17-BT cells and the control, respectively. Figure 11 The results showed that the supernatant of 17-BT cells had good tumor-killing ability.

[0668] (4) Detecting cell killing ability

[0669] NCG mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were injected with 1x10 6 A mouse model of B-type acute lymphoblastic leukemia was established by intravenous injection of Nalm-6-luc cells (purchased from PharmaLegacy, Shanghai) at a concentration of / ml.

[0670] Four days later, 1x10 mg of the drug was administered to three mice in the mouse animal model. 8 Mice were injected intravenously with 100 μl of 17-BT cells and PBMC cells derived from the same cell donor at a concentration of / mL, and these mice were designated as the experimental group. Two other mice in the mouse model received only 1x10... 8 PBMC cells were administered via tail vein injection at a concentration of / mL, with 100 μl of the cells injected without any other treatment, serving as a control group.

[0671] Tumor status in mice in the experimental and control groups was detected by fluorescence detection (Lumina XRMS, PerkinElmer) on days 0, 3, and 10 after intravenous injection of T cells. Results are as follows: Figure 12 As shown.

[0672] Figure 12 The results showed that tumors in the control group grew rapidly, while tumors in the experimental group almost disappeared (no fluorescence value was detected). This demonstrates that T cells transfected with this plasmid have a significant killing effect on tumor cells in mice when the host genomic DNA content is low.

[0673] Example 6: Reducing the amount of host genomic DNA in the plasmid can improve transfection efficiency.

[0674] Apply DNase (Plasmid-Safe ATP-dependent DNase, catalog number E3110K, purchased from Lucigen) to plasmid 3U-A. Treat the DNA plasmid with DNase according to the kit's instructions: Add 50 μg of plasmid 3U-A to a final volume of 500 μl, including 50 μl DNase, 20 μl ATP, and 50 μl reaction solution. Digest for one hour. Then, recover the digested plasmid by precipitating DNA with sodium acetate. Wash with 70% ethanol, centrifuge, and resuspend the plasmid in water. After digestion, the host genome DNA content in the plasmid decreased by approximately 150-fold (i.e., approximately 0.018 (w / w)% of the total nucleic acid in the transfection composition).

[0675] Human T cells that had been activated with Dynabead for 2-3 days were then transfected with plasmid 3U-A (group A) without DNase treatment, plasmid 3U-A (group B) treated with DNase, and plasmid 3U-B (group C) as a positive control. The control group was group D, which consisted of T cells that had not undergone any plasmid transfection.

[0676] The viability of cells transfected with the above plasmid was determined on day 1 and day 2 after transfection according to the method in Example 3. Figure 13A ), the expression level of CAR in cells ( Figure 13B ), number of cells ( Figure 13C ) and electro-electric efficiency ( Figure 13D ).

[0677] The results in Figure 13 show that using DNase to reduce the amount of host genomic DNA in the plasmid can further improve the transfection efficiency of the plasmid in transfected cells.

[0678] Example 7: Plasmids containing a small amount of host genomic DNA, after being transfected into immune cells, were able to specifically kill tumor cells.

[0679] A chemically synthesized sgRNA (SEQ ID NO:8, purchased from Genscript Biotech, Nanjing) targeting the human TRAC gene was designed. This sgRNA has three thiomethyl and three oxymethyl modifications at both its 5' and 3' ends. The purchased Cas9 protein was sourced from Sinocare (catalog number: 40572-A08B).

[0680] Plasmid 33-B was mixed with sgRNA and Cas9 (prepared as an RNP system, Cas9:sgRNA weight ratio approximately 3:1) and then electroporated into human T cells activated by Dynabead for 2-3 days. The nucleic acid molecule encoding GPC3CAR-2A-IL15 was knocked into the human TRAC gene and expressed through the endogenous promoter of the TRAC gene. The resulting cells were 33-BT cells.

[0681] 1x10 NCG mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were subcutaneously injected. 7 HepG-2 cells (purchased from PharmaLegacy, Shanghai) were used to construct a mouse model of subcutaneous tumors.

[0682] Approximately 14 days later, the tumor had grown to about 100 mm. 3 The volume was 1x10 in three mice in the mouse animal model. 8 100 μl of 33-BT cells were injected via the tail vein at a concentration of / mL, and these mice were designated as the experimental group. Three other mice in the animal model received no treatment and served as the control group.

[0683] Tumor volume was measured weekly for 35 days following intravenous injection of the T cells to assess tumor growth in the experimental (CAR-1) and control mice. Results are as follows: Figure 14 As shown.

[0684] The control group mice died at approximately 28 days. In the experimental group, the tumor volume approached zero at 35 days. Figure 14 The results showed that tumors in the control group grew rapidly, while tumors in the experimental group almost disappeared. This demonstrates that, even with low levels of host genomic DNA in the plasmid, T cells transfected with this plasmid exhibit a significant killing effect on tumor cells in mice.

[0685] Example 8: Plasmids containing less host genomic DNA, when transfected into T cells, were able to specifically kill tumor cells.

[0686] A chemically synthesized sgRNA (SEQ ID NO:18, purchased from Genscript Biotech, Nanjing) targeting the human AAVS-I gene was designed. The purchased Cas9 protein was sourced from Sinocare (catalog number: 40572-A08B).

[0687] Plasmid 9-B was mixed with sgRNA and Cas9 (prepared as an RNP system, Cas9:sgRNA weight ratio approximately 3:1) and then electroporated into human T cells activated by Dynabead for 2-3 days. The nucleic acid molecule encoding BiTE was knocked into the human AAVS-I gene site and expressed under the regulation of the exogenous promoter (hPGK promoter). The obtained cells were 9-BT cells.

[0688] NCG mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were injected with 1x10 6 A mouse model of B-type acute lymphoblastic leukemia was established by intravenous injection of Nalm-6-luc cells (purchased from PharmaLegacy, Shanghai) at a concentration of / ml.

[0689] Four days later, 1x10 mg of the drug was administered to three mice in the mouse animal model. 8 100 μl of 9-BT cells were injected via the tail vein at a concentration of / mL, and these mice were designated as the experimental group. Three other mice in the animal model received no treatment and served as the control group.

[0690] Tumor status in experimental and control mice was detected by fluorescence detection (Lumina XRMS, PerkinElmer) on days 0, 3, 7, 10, 14, and 17 after intravenous injection of the T cells. Results are as follows: Figure 15 As shown.

[0691] Figure 15 The results showed that the tumors in the control group grew rapidly, while the experimental group showed a significant tumor-inhibiting effect. This demonstrates that, even with low host genomic DNA levels, immune effector cells transfected with this plasmid and with exogenous genes knocked into the AAVS-I site exhibit a significant killing effect on tumor cells in mice.

[0692] Example 9: Plasmids containing less host genomic DNA, when transfected into T cells, can specifically kill tumor cells.

[0693] A chemically synthesized sgRNA (SEQ ID NO:8, purchased from Genscript Biotech, Nanjing) targeting the human TRAC gene was designed. This sgRNA has three thiomethyl and three oxymethyl modifications at both its 5' and 3' ends. The purchased Cas9 protein was sourced from Sinocare (catalog number: 40572-A08B).

[0694] Plasmid 32-B was mixed with sgRNA and Cas9 (prepared as an RNP system, Cas9:sgRNA weight ratio approximately 3:1) and then electroporated into human T cells activated by Dynabead for 2-3 days. The nucleic acid molecule encoding GPC3CAR-2A-IL-7-2A-CCL19 was knocked into the human TRAC gene and expressed through the endogenous promoter of the TRAC gene. The resulting cells were 32-BT cells.

[0695] 1x10 NCG mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were subcutaneously injected. 7 HepG-2 cells (purchased from PharmaLegacy, Shanghai) were used to construct a mouse model of subcutaneous tumors.

[0696] Approximately 14 days later, the tumor had grown to about 100 mm. 3 Volume, 1x10 in 3 mice in the mouse animal model 8 100 μl of the 32-BT cells were injected via the tail vein at a concentration of / mL, and these mice were designated as the experimental group. Three other mice in the animal model received no treatment and served as the control group.

[0697] Tumor volume was measured weekly for 24 days following intravenous injection of the T cells to assess tumor growth in experimental (7 / 19 CART) and control mice. Results are as follows: Figure 16 As shown.

[0698] Figure 16 The results showed that tumors in the control group grew rapidly, while tumors in the experimental group almost disappeared. This demonstrates that, even with low host genomic DNA levels, T cells transfected with this plasmid and with a foreign gene knocked into the human TRAC site exhibit a significant killing effect on tumor cells in mice.

[0699] Example 10: Transfection of T cells with plasmids containing less host genomic DNA increased transfection efficiency for both inactive and activated T cells.

[0700] Apply DNase (Plasmid-Safe ATP-dependent DNase, catalog number E3110K, purchased from Lucigen) to plasmid 11-A. Treat the DNA plasmid with DNase according to the kit's instructions: Add 50 μg of plasmid 11-A to a final volume of 500 μl, including 50 μl DNase, 20 μl ATP, and 50 μl reaction solution. Digest for one hour. Then, recover the digested plasmid by precipitating DNA with sodium acetate. Wash with 70% ethanol, centrifuge, and resuspend the plasmid in water. After digestion, the host genome DNA content in the plasmid decreased by approximately 10-fold (i.e., after digestion, its content represents approximately 0.3 (w / w)% of the total nucleic acid in the transfection composition).

[0701] Then, unactivated human T cells were transfected with plasmid 11-A (group A) that had not undergone DNase treatment and plasmid 11-A that had been treated with DNase (group B). Figures 17A-17D ), or human T cells activated by Dynabead for 2-3 days ( Figures 18A-18D ).

[0702] Depend on Figures 17A-17D and Figures 18A-18D The results show that regardless of whether inactive T cells are used for transfection ( Figures 17A-17D ), or use activated T cells for transfection ( Figures 18A-18D When the content of host genomic DNA in the transfection composition was reduced, the transfection efficiency, cell viability (17A, 18A), GFP expression level (17B, 18B, 17C, 18C), and relative comprehensive GFP expression level (17D, 18D) were significantly improved.

[0703] Example 11: Plasmids containing less host genomic DNA, when transfected into T cells, can specifically kill tumor cells.

[0704] Knocking out PD-1 and CD95 can enhance CAR-T function. For mainstream viral methods, it is difficult to design GMP-compliant methods that simultaneously infect cells and knock out endogenous genes in one step. For non-viral transfection methods, transfection efficiency has been low previously due to non-viral transfection methods (e.g., plasmid transfection). If knocking out one or more endogenous genes while transfecting exogenous genes with plasmids is desired, the already low transfection efficiency will become even lower.

[0705] Using the method described in this application, transfection efficiency, gene editing efficiency, and exogenous gene expression levels are greatly improved, enabling the simultaneous knock-in of exogenous genes and knockout of multiple endogenous genes with a single transfection.

[0706] Chemically synthesized sgRNAs targeting the human TRAC gene (SEQ ID NO:8, purchased from Genscript Biotech, Nanjing); chemically synthesized sgRNAs targeting the human CD95 gene (SEQ ID NO:28, purchased from Genscript Biotech, Nanjing); and chemically synthesized sgRNAs targeting the human PD-1 gene (SEQ ID NO:25, purchased from Genscript Biotech, Nanjing) were designed. The Cas9 protein purchased was from Sinocare (catalog number: 40572-A08B).

[0707] Plasmid 12-B, along with the aforementioned suitable sgRNA and Cas9 (prepared as an RNP system, Cas9:sgRNA weight ratio approximately 3:1), was mixed and electroporated onto human T cells activated by Dynabead for 2-3 days. The nucleic acid molecule encoding the GPC3CAR was knocked into the human TRAC gene and expressed through the...

Claims

1. A method of modifying cells in vitro or ex vivo, the method comprising: The method involves transfecting cells to be modified with a transfection composition to enable the cells to contain and / or express a foreign gene, wherein the transfection composition contains a foreign nucleic acid molecule containing the foreign gene, at least a portion of which is derived from a host cell; and in the portion of the foreign nucleic acid molecule derived from the host cell, the content of the host cell's genomic DNA is less than 0.5% (w / w); the method further includes determining the content of the host cell's genomic DNA in the portion of the foreign nucleic acid molecule derived from the host cell, wherein when the content of the host cell's genomic DNA is 0.5% (w / w) or higher, the modification is considered complete. The exogenous nucleic acid molecule is partially processed to reduce the content of genomic DNA in the host cell to less than 0.5% (w / w); wherein the exogenous gene is integrated into the genome of the cell; the transfection composition further comprises a gene editing system capable of integrating the exogenous gene into a specific location in the cell genome; the exogenous nucleic acid molecule of the host cell is a plasmid, and the plasmid is a circular plasmid; the transfection is electroporation; the host cell is Escherichia coli; the cell to be modified is an immune effector cell, and the cell to be modified is a T lymphocyte, and the cell is a primary cell.

2. The method of claim 1, wherein, The exogenous nucleic acid molecules are extracted from the host cells.

3. The method according to claim 1, wherein the size of the exogenous nucleic acid molecule is at least 3kb.

4. The method according to claim 1, wherein the content of genomic DNA in the host cell is less than 3‰ (w / w).

5. The method according to any one of claims 1-4, wherein the content of genomic DNA in the host cell is less than 1‰ (w / w).

6. The method according to any one of claims 1-4, wherein the content of genomic DNA in the host cell is less than 0.5‰ (w / w).

7. The method according to any one of claims 1-4, wherein the size of the genomic DNA of the host cell is at least 48 kb, and the content of nucleic acid molecules or fragments thereof of at least 48 kb accounts for less than 0.5% (w / w) of the content of exogenous nucleic acid molecules derived from the host cell in the transfection mixture.

8. The method of any one of claims 1-4, wherein the method further comprises: The exogenous nucleic acid molecule is treated with DNase, which is capable of nonspecifically cleaving linear DNA, and the DNase is an exonuclease.

9. The method according to claim 8, wherein the method further comprises determining the content of the host cell's genomic DNA in the exogenous nucleic acid molecule portion obtained from the host cell, and determining whether to treat the exogenous nucleic acid molecule portion to reduce the content of the host cell's genomic DNA based on the content; when the content of the host cell's genomic DNA accounts for more than 3‰ (w / w) of the exogenous nucleic acid molecule obtained from the host cell, the DNase treatment is performed.

10. The method according to any one of claims 1-4, wherein the gene editing system comprises a site-specific enzyme or a nucleic acid molecule encoding the site-specific enzyme, said site-specific enzyme being selected from: transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), transposases, integrases, and Cas proteins.

11. The method according to any one of claims 1-4, wherein the exogenous gene encodes one or more exogenous proteins.

12. The method of claim 11, wherein the exogenous protein comprises one or more of the following: antibody or antigen-binding fragment, chimeric antigen receptor (CAR), cytokine, and chemokine.

13. The method of claim 12, wherein the CAR comprises a target-binding domain that targets tumor-associated antigens.

14. The method of claim 13, wherein the tumor-associated antigen is selected from: GPC3, CD19, BCMA, Claudin18.2, and Mesothelin.

15. The method of claim 12, wherein the antibody or antigen-binding fragment comprises a multispecific antibody or an antigen-binding fragment thereof.

16. The method of claim 15, wherein the multispecific antibody or its antigen-binding fragment comprises a bispecific T-cell adaptor (BiTE).

17. The method of claim 16, wherein the BiTE comprises a CD3 binding domain.

18. The method according to any one of claims 1-4, wherein the transfection composition does not contain a viral vector.

19. A transfection composition for transfecting cells to be modified, characterized in that, The transfection composition is used to transfect cells to be modified in vitro or in vitro to enable the cells to contain and / or express a foreign gene. The transfection composition contains a foreign nucleic acid molecule containing the foreign gene, at least a portion of which is derived from a host cell; and in the portion of the foreign nucleic acid molecule derived from the host cell, the content of the host cell's genomic DNA is less than 0.5% (w / w); or the foreign nucleic acid molecule in the transfection composition is optimized so that the content of the host cell's genomic DNA is less than 0.5% (w / w), the optimization including optimizing the portion of the foreign nucleic acid molecule derived from the host cell... The transfection composition is prepared by contacting deoxyribonuclease (DNase); the transfection is performed by electroporation; wherein the exogenous nucleic acid molecule of the host cell is a plasmid, and the plasmid is a circular plasmid; the exogenous gene is integrated into the genome of the cell; the transfection composition further comprises a gene editing system capable of integrating the exogenous gene into a specific location in the genome of the cell; the exogenous gene encodes one or more exogenous proteins, and the exogenous protein includes a chimeric antigen receptor (CAR); the cell to be modified is an immune effector cell, and the cell to be modified is a T lymphocyte, and the cell is a primary cell.

20. The transfection composition of claim 19, wherein, The content of genomic DNA in the host cell is less than 3‰ (w / w).

21. The transfection composition of claim 19, wherein, The content of genomic DNA in the host cell is less than 1‰ (w / w).

22. The transfection composition of claim 19, wherein The content of genomic DNA in the host cell is less than 0.5‰ (w / w).

23. The transfection composition of claim 19, wherein The transfection composition does not comprise a viral vector. The transfection composition does not comprise a viral vector.

Images