Taq DNA polymerase mutants for use in probe-based qPCR

Abstract

The application belongs to the technical field of molecular biology, and particularly relates to a Taq DNA polymerase mutant for probe qPCR. In the application, the Taq DNA polymerase mutant is designed, characterized and screened based on probe qPCR, a cycle process with fast amplification time (1 second of extension period) is adopted, and part of the Taq DNA polymerase mutant is obtained. Compared with the wild-type Taq DNA polymerase, the mutant provided in the application has the characteristics of fast detection and amplification results, which significantly reduces the total time required in the qPCR process and improves the detection efficiency of qPCR or real-time qPCR. Therefore, the mutant provided in the application has great economic advantages. The Taq DNA polymerase mutant provided in the application can be used for conventional qPCR detection, including gene expression analysis and other DNA quantitative detection.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and particularly relates to a Taq DNA polymerase mutant for probe qPCR. BACKGROUND

[0002] Taq DNA polymerase is generally used for amplification of nucleic acid amplicons in polymerase chain reaction (PCR). In a PCR reaction, amplicons (target nucleic acids or target DNA fragments) are generally amplified through cycles of three steps: denaturation, annealing and extension. Real-time fluorescent quantitative PCR (qPCR) is a method for detecting and recording the amplification results by collecting fluorescent signal data generated by dyes or probes during the PCR amplification process. Probe-based detection technology refers to a detection technology that uses fluorescently labeled target probes for detection. When the fluorescent probe binds to the target sequence, the fluorescent dye is released, and the progress of amplification can be inferred by detecting the change in fluorescent signal intensity in real time.

[0003] Taq DNA polymerase has DNA polymerase activity and 5'→3' exonuclease activity, which is the basis for the realization of probe qPCR. Since the amplicon of probe qPCR is usually short, the polymerization activity of wild-type Taq DNA polymerase is sufficient to meet the amplification requirements even in a short amplification time interval (such as 1 second). However, whether or not polymerization occurs during amplification, wild-type Taq DNA polymerase cannot separate the probe from the fluorophore to which it is attached within 1 second, which limits the detection speed. Therefore, the 5'→3' exonuclease activity of Taq DNA polymerase, which is responsible for releasing the reporter signal, becomes the rate-limiting factor for probe qPCR. Based on this, the present application provides a Taq DNA polymerase mutant capable of improving 5'→3' exonuclease activity to realize rapid detection of qPCR. SUMMARY

[0004] In view of the problems existing in the prior art, the present application provides a Taq DNA polymerase mutant for probe qPCR, aiming to solve some or at least alleviate some of the problems in the prior art.

[0005] The application discloses a Taq DNA polymerase mutant, wherein the amino acid sequence of the mutant is at least one of the following mutations compared with the amino acid sequence of wild-type Taq DNA polymerase: A70F, F73A, P253G, E255K, D257R, A259F, A271F, L288S, E289K, S357I, L376S, T385I, G418P, R419D, E421K, L461S, A472F, E497K, L498S, E524K, D551R, R556D, S679I, L789S or E189K / E507K / E742K; the amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO. 2; A70F represents that the 70th amino acid in SEQ ID NO. 2 is mutated from A to F; F73A represents that the 73rd amino acid in SEQ ID NO. 2 is mutated from F to A; P253G represents that the 253rd amino acid in SEQ ID NO. 2 is mutated from P to G; E255K represents that the 255th amino acid in SEQ ID NO. 2 is mutated from E to K; D257R represents that the 257th amino acid in SEQ ID NO. 2 is mutated from D to R; A259F represents that the 259th amino acid in SEQ ID NO. 2 is mutated from A to F; A271F represents that the 271st amino acid in SEQ ID NO. 2 is mutated from A to F; L288S represents that the 288th amino acid in SEQ ID NO. 2 is mutated from L to S; E289K represents that the 289th amino acid in SEQ ID NO. 2 is mutated from E to K; S357I represents that the 357th amino acid in SEQ ID NO. 2 is mutated from S to I; L376S represents that the 376th amino acid in SEQ ID NO. 2 is mutated from L to S; T385I represents that the 385th amino acid in SEQ ID NO. 2 is mutated from T to I; G418P represents that the 418th amino acid in SEQ ID NO. 2 is mutated from G to P; R419D represents that the 419th amino acid in SEQ ID NO. 2 is mutated from R to D; E421K represents that the 421st amino acid in SEQ ID NO. 2 is mutated from E to K; L461S represents that the 461st amino acid in SEQ ID NO. 2 is mutated from L to S; A472F represents that the 472nd amino acid in SEQ ID NO. 2 is mutated from A to F; E497K represents that the 497th amino acid in SEQ ID NO. 2 is mutated from E to K; L498S represents that the 498th amino acid in SEQ ID NO. 2 is mutated from L to S; E524K represents that the 524th amino acid in SEQ ID NO. 2 is mutated from E to K; D551R represents that the 551st amino acid in SEQ ID NO. 2 is mutated from D to R; R556D represents that the 556th amino acid in SEQ ID NO. 2 is mutated from R to D; S679I represents that the 679th amino acid in SEQ ID NO. 2 is mutated from S to I; L789S represents that the 789th amino acid in SEQ ID NO. 2 is mutated from L to S; E189K / E507K / E742K represents that the 189th amino acid in SEQ ID NO. 2 is mutated from E to K, the 507th amino acid in SEQ ID NO. 2 is mutated from E to K and the 742nd amino acid in SEQ ID NO. 2 is mutated from E to K.amino acid at position 524 of SEQ ID NO. 2 is mutated from E to K; the D551R indicates that the amino acid at position 551 of SEQ ID NO. 2 is mutated from D to R; the R556D indicates that the amino acid at position 556 of SEQ ID NO. 2 is mutated from R to D; the S679I indicates that the amino acid at position 679 of SEQ ID NO. 2 is mutated from S to I; the L789S indicates that the amino acid at position 789 of SEQ ID NO. 2 is mutated from L to S; the E189K / E507K / E742K indicates that three mutations occur simultaneously in SEQ ID NO. 2, i.e., the amino acid at position 189 is mutated from E to K, the amino acid at position 507 is mutated from E to K, and the amino acid at position 742 is mutated from E to K.

[0006] Further, the Taq DNA polymerase mutant is capable of extending primers, and the extension condition is limited within 1 second.

[0007] The present application also provides a DNA sequence encoding the Taq DNA polymerase mutant as described above. The nucleotide sequence encoding the wild-type Taq DNA polymerase is shown in SEQ ID NO. 1.

[0008] The nucleotide sequence of A70F is only different from SEQ ID NO. 1 in that the codon of the amino acid at position 70 is replaced from GCC to TTC.

[0009] The nucleotide sequence of F73A is only different from SEQ ID NO. 1 in that the codon of the amino acid at position 73 is replaced from TTT to GCT.

[0010] The nucleotide sequence of P253G is only different from SEQ ID NO. 1 in that the codon of the amino acid at position 253 is replaced from CCG to GGG.

[0011] The nucleotide sequence of E255K is only different from SEQ ID NO. 1 in that the codon of the amino acid at position 255 is replaced from GAA to AAA.

[0012] The nucleotide sequence of D257R is only different from SEQ ID NO. 1 in that the codon of the amino acid at position 257 is replaced from GAT to CGT.

[0013] The nucleotide sequence of A259F is only different from SEQ ID NO. 1 in that the codon of the amino acid at position 259 is replaced from GCC to TTC.

[0014] The nucleotide sequence of A271F is only different from SEQ ID NO. 1 in that the codon of the amino acid at position 271 is replaced from GCC to TTC.

[0015] The nucleotide sequence of L288S differs from SEQ ID NO. 1 only in that the codon for amino acid at position 288 is replaced by TCT from TCG.

[0016] The nucleotide sequence of E289K differs from SEQ ID NO. 1 only in that the codon for amino acid at position 289 is replaced by AAA from GAA.

[0017] The nucleotide sequence of S357I differs from SEQ ID NO. 1 only in that the codon for amino acid at position 357 is replaced by ATC from AGT.

[0018] The nucleotide sequence of L376S differs from SEQ ID NO. 1 only in that the codon for amino acid at position 376 is replaced by TCT from CTG.

[0019] The nucleotide sequence of T385I differs from SEQ ID NO. 1 only in that the codon for amino acid at position 385 is replaced by ATC from ACC.

[0020] The nucleotide sequence of G418P differs from SEQ ID NO. 1 only in that the codon for amino acid at position 418 is replaced by CCT from GGT.

[0021] The nucleotide sequence of R419D differs from SEQ ID NO. 1 only in that the codon for amino acid at position 419 is replaced by GAC from CGC.

[0022] The nucleotide sequence of E421K differs from SEQ ID NO. 1 only in that the codon for amino acid at position 419 is replaced by AAA from GAA.

[0023] The nucleotide sequence of L461S differs from SEQ ID NO. 1 only in that the codon for amino acid at position 461 is replaced by TCT from CTG.

[0024] The nucleotide sequence of A472F differs from SEQ ID NO. 1 only in that the codon for amino acid at position 472 is replaced by TTC from GCC.

[0025] The nucleotide sequence of E497K differs from SEQ ID NO. 1 only in that the codon for amino acid at position 497 is replaced by AAA from GAA.

[0026] The nucleotide sequence of L498S differs from SEQ ID NO. 1 only in that the codon for amino acid at position 498 is replaced by TCT from TTA.

[0027] The nucleotide sequence of E524K differs from SEQ ID NO. 1 only in that the codon for the amino acid at position 524 is replaced from GAA to AAA.

[0028] The nucleotide sequence of D551R differs from SEQ ID NO. 1 only in that the codon for the amino acid at position 551 is replaced from GAT to CGT.

[0029] The nucleotide sequence of R556D differs from SEQ ID NO. 1 only in that the codon for the amino acid at position 556 is replaced from CGT to GAT.

[0030] The nucleotide sequence of S679I differs from SEQ ID NO. 1 only in that the codon for the amino acid at position 679 is replaced from TCA to ATA.

[0031] The nucleotide sequence of L789S differs from SEQ ID NO. 1 only in that the codon for the amino acid at position 789 is replaced from CTG to TCT.

[0032] The nucleotide sequence of E189K / E507K / E742K differs from SEQ ID NO. 1 only in that the codon for the amino acid at position 189 is replaced from GAA to AAA, the codon for the amino acid at position 507 is replaced from GAA to AAA, and the codon for the amino acid at position 742 is replaced from GAA to AAA.

[0033] The present application also provides a vector comprising the DNA sequence as described above.

[0034] The present application also provides a cell comprising the DNA sequence as described above.

[0035] The present application also provides the use of the Taq DNA polymerase mutant as described above in nucleic acid amplification.

[0036] The present application also provides the use of the Taq DNA polymerase mutant as described above in qPCR.

[0037] The present application also provides a qPCR detection kit, comprising: a target sequence primer, an intercalating dye or a labeled target probe, and the Taq DNA polymerase mutant as described above.

[0038] Further, the intercalating dye is SYBR Green or EvaGreen. The label emits fluorescence when stripped from the probe by exonuclease.

[0039] The application also provides a qPCR detection method, a reaction system of 20 μL, comprising 4 μL of 50 ng / μL Taq DNA polymerase mutant, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 1 μL of 5 μM tag probe, 1 μL of template, 2 μL of 10x buffer, and the rest is water; the reaction program is: denaturation at 95°C for 30 seconds; annealing at 95°C for 4 seconds, extension at 60°C for 1 second, 40 cycles; the Taq DNA polymerase mutant is as described above.

[0040] Further, the buffer comprises 20 mM Tris-HCl, 80 mM Tris-acetate, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 3 mM Mg-acetate, 0.1% Tween-20, pH 8.8.

[0041] In summary, the advantages and positive effects of the application are:

[0042] The Taq DNA polymerase mutant provided by the application has higher qPCR efficiency compared with wild-type Taq DNA polymerase. In the application, the Taq DNA polymerase mutant is designed, characterized and screened based on the probe method qPCR, a cycle process with fast amplification time (extension period of 1 second) is adopted, and some Taq DNA polymerase mutants are obtained, including: A70F, F73A, P253G, E255K, D257R, A259F, A271F, L288S, E289K, S357I, L376S, T385I, G418P, R419D, E421K, L461S, A472F, E497K, L498S, E524K, D551R, R556D, S679I, L789S, E189K / E507K / E742K.

[0043] Compared with wild-type Taq DNA polymerase, the mutant provided by the application has the characteristics of rapid detection and amplification of results, which significantly reduces the total time required for qPCR process and improves the detection efficiency of qPCR or real-time qPCR. Therefore, the mutant provided by the application has great economic advantages.

[0044] The Taq DNA polymerase mutant provided by the application can be used for conventional qPCR detection, including gene expression analysis and other DNA quantitative detection. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figures 1-6 ​Amplification signal plot of wild type and mutant Taq DNA polymerase. In the figure, the X axis is the number of cycles, and the Y axis is the fluorescence signal (DR), indicating the change in fluorescence during amplification. The circle represents the specific signal value detected at each cycle. All detection threshold lines are fixed at 0.02. The qPCR program of all mutants is repeated, as shown in the figure, and two different sets of points and lines can be seen.

[0046] Figure 1 Amplification signal plot of wild type and mutant E255K, P253G, F73A;

[0047] Figure 2 Amplification signal plot of wild type and mutant A70F, L288S, E289K, S357I;

[0048] Figure 3 Amplification signal plot of wild type and mutant D257R, A259F, A271F, G418P;

[0049] Figure 4 Amplification signal plot of wild type and mutant R419D, E421K, L461S, L376S;

[0050] Figure 5 Amplification signal plot of wild type and mutant T385I, E524K, D551R, R556D, S679I;

[0051] Figure 6 Amplification signal plot of wild type and mutant A472F, E497K, L498S, L789S, E189K / E507K / E742K. DETAILED DESCRIPTION

[0052] The words "about", "approximately", and the like, when used with a numerical value, generally mean a value within an experimental error range (e.g., a mean value within a 95% confidence interval) or a variable value within ±10% of the numerical value, with the larger numerical value as the boundary.

[0053] The term "labeled probe" refers to a labeled probe used in an amplification reaction, including quantitative or qPCR analysis, and end-point analysis. Such labeled probes can be used to monitor amplification of a target polynucleotide, suitable for monitoring changes in amplicon quantity over time.

[0054] Oligonucleotide labeled probes include, but are not limited to, 5'-exonuclease TaqMan probes (see U.S. Patent No. 5,538,848), various stem-loop molecular beacons (see U.S. Patent Nos. 6,103,476 and 5,925,517, stemless molecular beacons or linear beacons (WO 99 / 21881), PNA molecular beacons (e.g., U.S. Patent Nos. 6,355,421 and 6,593,091), linear PNA beacons, non-FRET labeled probes (e.g., U.S. Patent No. 6,150,097), Sunrise / amplfluor labeled probes (U.S. Patent No. 6,548,250), stem-loop and scorpion labeled probes (U.S. Patent No. 6,589,743), bulge labeled probes (U.S. Patent No. 6,59091), pseudoknot labeled probes (U.S. Patent No. 6,589,250); cyclers (U.S. Patent No. 6,383,752), hairpin labeled probes (U.S. Patent No. 6,596,490), peptide nucleic acid (PNA) light-up labeled probes, self-assembled nanoparticle labeled probes, and ferrocene-modified labeled probes, etc., as described in U.S. Patent No. 6485901. Labeled probes can also include black hole quenchers (Biosearch), Iowa black (IDT) quenchers, QSY quenchers (Molecular Beacons), and Dabsyl and Dabcel sulfonate / carboxylate quenchers (Epoch). Labeled probes can also be composed of two probes, e.g., a fluorophore on one probe and a quencher on the other, hybridization of the two probes quenching the signal, or altering the signal characteristics by a change in fluorescence. Labeled probes can also include sulfonated derivatives of fluorescent dyes with sulfonic acid groups in addition to carboxyfluorescein, phosphoramidite fluorescein, CY 5 phosphoramidite fluorescein (available from Amersham).

[0055] As used herein, "sample" refers to any biological sample of any origin, including nucleic acids or DNA.

[0056] As used herein, "real time quantitative PCR", "real time qPCR", and "quantitative PCR" (abbreviated "qPCR") are used interchangeably to refer to a PCR amplification method that uses labeled probes for simultaneous amplification, detection, and quantification of a target polynucleotide, and further can include methods exemplified herein, such as TaqMan, SYBR Green, etc., in real-time fluorescent quantitative PCR or semi-quantitative fluorescent quantitative PCR systems.

[0057] In the present application, "target" refers to a polynucleotide sequence that needs to be amplified, which can be a nucleic acid molecule or present in a nucleic acid molecule or sample. The target polynucleotide can be obtained in any way, can be DNA or cDNA obtained based on RNA, and can be in a methylated and / or non-methylated form.

[0058] In the present application, "cycle threshold" or "C T " refers to the number of cycles experienced when the fluorescence signal reaches a set threshold, including real-time quantitative PCR of DNA by plotting the logarithmic curve of fluorescence signal versus cycle period. The threshold is preferably set to 3-5 times the fluorescence signal mark difference above the background signal. The number of cycles in which the fluorescence exceeds the threshold is called the threshold cycle (Ct) or the quantitative cycle (Cq).

[0059] In the present application, "threshold" refers to the reporter signal value used to calculate the cycle threshold (C T ).

[0060] In the present application, "reporter signal" refers to the signal value related to the concentration of PCR product generated by the reporter gene (usually dye or labeled probe) during data detection and analysis, including but not limited to cycle reaction data. The data includes but is not limited to fluorescence signal data, light signal data, magnetic signal data and electronic signal data. The detection and analysis includes but is not limited to DNA quantitative analysis by qPCR. The reporter signal can be generated by DNA binding or inserting into the dye (such as SYBR Green or evgreen). The dye binds to double-stranded DNA during PCR, increasing the fluorescence quantum yield of the dye, thereby increasing the measured fluorescence intensity of each cycle. The signal intensity can be adjusted to increase the accuracy of target DNA quantification.

[0061] The Taq DNA polymerase mutant in the present application can make qPCR more efficient, such as making the amplification time interval cycle 1 second. In order to improve the amplification efficiency of the target system, the Taq DNA polymerase mutant in the present application can be used with primers and templates to screen the best combination. In the experiment, a standard curve with C T value change can be constructed by continuously diluting the DNA concentration, so as to determine the sample dilution according to the reporter signal. The amplification factor is determined using the slope of linear regression, such as dilution 1:2 resulting in a difference of 1 (CT), then the amplification factor is 100%.

[0062] The amplification efficiency of qPCR can also be determined by qPCR quantification methods that do not require the generation of a standard curve. For example, the MAK2 method (see Boggy G, Woolf PJ (2010); Ravasi T (ed.). "A Mechanistic Model of PCR for Accurate Quantification of Quantitative PCR Data" PLOS ONE 5(8): e12355), which has been shown to have the same or better quantitative detection as the standard curve method. Such methods are based on the knowledge of the principles of the polymerase amplification process to estimate the sample concentration and amplification efficiency.

[0063] The Taq DNA polymerase mutants in the present application can be used for real-time or qPCR detection, and can also be used for nucleic acid quantification detection, and for relative or absolute quantification of gene expression. Absolute quantification requires that the PCR amplification efficiency of the sample and the standard is the same, so that the exact number of target DNA molecules can be obtained by comparison with the standard curve. The Taq DNA polymerase mutants in the present application can provide faster cycle times, the same or higher amplification efficiency, and are very suitable for absolute and relative quantification detection.

[0064] Qualitative PCR can also be used for nucleic acid detection of infectious diseases, cancer and genetic abnormalities, so as to achieve rapid diagnosis. The characteristics of the Taq DNA polymerase mutants in the present application in qPCR detection are helpful for the diagnosis of infectious diseases or emerging diseases (such as influenza, coronavirus).

[0065] The Taq DNA polymerase mutants in the present application can be used for real-time or qPCR detection of gene expression, which is of great significance for food safety, food spoilage, fermentation, and microbial risk assessment and public health protection of water bodies (including drinking water and recreational water).

[0066] The Taq DNA polymerase mutants in the present application can be used for real-time or qPCR detection of different categories or functions of genes, such as in environmental-related samples to determine the number of microorganisms in the sample and / or to identify different families, genera and species of microorganisms according to markers. It can also be used for the detection of functional markers (genes encoding proteins) to show gene expression within the community, thereby revealing environmental information.

[0067] The Taq DNA polymerase mutants in the present application can be used for real-time or qPCR detection of agricultural pathogens, including bacteria that infect plants or seedlings. It is possible even if there is only a small amount of pathogen in the detection system, such as Phytophthora ramorum mixed with host plant DNA, which is a oomycete that can kill oak trees and other species.

[0068] The Taq DNA polymerase mutants in the present application can be used to detect transgenic organisms according to the sensitivity and dynamic range of real-time or qPCR detection. This detection does not require amplification of the transgene, but only needs to be combined with specific primers to amplify the promoter, terminator or intermediate sequence of the vector. Several copies of the transgene are usually inserted during the construction of transgenic plants, and therefore the Taq DNA polymerase mutants in the present application can also be used for the detection of gene copy number.

[0069] The use of qPCR with the Taq DNA polymerase mutants in the present application can achieve quantitative analysis and genotyping of viruses (using melting curve to characterize strains).

[0070] The degree of infection is closely related to the diagnosis of many diseases. The Taq DNA polymerase mutants in the present application can be used to quantitatively analyze the copy number of viral genomes per unit in patient tissues, thereby judging the degree of infection.

[0071] In the present application, SEQ ID NO. 1 is the DNA sequence of wild-type Taq DNA polymerase with a C-terminal Histag label. SEQ ID NO. 2 is the amino acid sequence of wild-type Taq DNA polymerase with a C-terminal Histag label.

[0072] Examples

[0073] When using the Taq DNA polymerase mutants in the present application for gene expression analysis, RNA is generally extracted from the sample and then reverse transcribed to obtain cDNA. Any method in the prior art can be used to detect the threshold of the reporter signal to determine the Ct value of the sample. T , to achieve quantitative detection of cDNA targets.

[0074] Acquiring mutants

[0075] Reverse PCR mutagenesis method was used to obtain Taq DNA polymerase mutants. All Taq DNA polymerase mutants in the present application were expressed and purified in E. coli, and were verified by sequencing. In order to facilitate purification, His tag was added to the C-terminus of all mutants and wild-type.

[0076] qPCR probes

[0077] Obtaining of qPCR probe: qPCR was performed targeting SARS-CoN gene 2019-nCoV_N2 released by the US CDC 2019-nCoV Real-Time RT-PCR Diagnostic Panel.

[0078] Forward primer: 2019-nCoV_N2 Forward Primer: TTACAAACATTGGCCGCAAA (SEQ ID NO: 3);

[0079] Reverse primer: 2019-nCoV_N2 Reverse Primer: GCGCGACATTCCGAAGAA (SEQ ID NO: 4);

[0080] Probe: 2019-nCoV_N2 Probe: FAM-ACA ATT TGC CCC CAG CGC TTC AG-BHQ1 (SEQ ID NO: 5).

[0081] Starting target concentration was 10 copies of Covid-19 N gene (Twist Bioscience, CA) per reaction.

[0082] Reaction mixture 20 μL, containing 4 μL 50 ng / μL Taq DNA polymerase, 1 μL 10 μM forward primer, 1 μL 10 μM reverse primer, 1 μL 5 μM tag probe, 1 μL 10 copies / μL Covid 19 N gene, 2 μL 10x buffer (20 mM Tris-HCl, 80 mM Tris-Acetate, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 3 mM Mg-Acetate, 0.1% Tween®-100, pH 8.8 @ 25 °C), the rest is water.

[0083] Reaction program was denaturation at 95 °C for 30 seconds, then 40 cycles of [annealing at 95 °C for 4 seconds, extension at 60 °C for 1 second], and collection of fluorescence signal at 60 °C using Prime Pro 48 Real-time qPCR instrument (Cole-Parmer, UK).

[0084] The results are shown in Table 1. Figures 1-6 Wild type has no significant signal, and the mutants with significant signal are A70F, F73A, P253G, E255K, D257R, A259F, A271F, L288S, E289K, S357I, L376S, T385I, G418P, R419D, E421K, L461S, A472F, E497K, L498S, E524K, D551R, R556D, S679I, L789S, E189K / E507K / E742K. The nucleotide and amino acid sequences of each mutant are recited in the sequence listing (see the sequence listing in detail).

[0085] ​The technical solutions in the present application are explained by referring to patents and documents. The examples given above are only examples and do not limit the protection scope of the present application. Those skilled in the art can make changes to the experimental methods, examples, etc. on the basis of understanding the technical solutions of the present application and the changes are included in the protection scope of the claims of the present application. It is obvious to those skilled in the art that the technical solutions of the present application can be replaced or modified without deviating from the scope and spirit of the present application. The present application can be implemented without including the elements not explicitly recorded as necessary conditions in the present application. In each example, the words "comprise", "include" or "contain" are open descriptions. The method or process sequence in the present application can be adjusted and is not limited to the step sequence indicated in the specification or claims. In any case, the explanation of the present application should not be limited to the specific description in the specification or examples of the present application.

[0086] The technical solutions in the present application are described more widely and the microorganisms belonging to the same subgenus or species also belong to the protection scope of the present application. The terms or expressions used in the present application are only used for description and do not produce limitation and the descriptions using the same meanings of these terms or expressions are all possible and belong to the protection scope of the present application. Therefore, although the present application has been explicitly disclosed by the preferred examples or optional features, those skilled in the art can make modifications according to the concepts disclosed in the present application and the modifications all belong to the protection scope of the claims of the present application.

Claims

1. A qPCR detection method for non-disease diagnostic purposes, characterized by: The qPCR detection kit is used for rapid detection of amplification results; The reaction system of the qPCR contains 4 μL of Taq DNA polymerase mutant with a concentration of 50 ng / μL, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 1 μL of 5 μM label probe, 1 μL of template, 2 μL of 10×buffer, and the rest is water, with a total volume of 20 μL; The reaction procedure of the qPCR is denaturation at 95℃ for 30 seconds, annealing at 95℃ for 4 seconds, extension at 60℃ for 1 second, and 40 cycles; The buffer contains 20 mM Tris-HCl, 80 mM Tris-acetate, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 3 mM Mg-acetate, 0.1% Triton®-X-100, and pH 8.8; The amino acid sequence of the Taq DNA polymerase mutant is mutated at D551R compared to the amino acid sequence of wild-type Taq DNA polymerase shown as SEQ ID NO. 2, wherein the D551R mutation indicates that the 551th amino acid in SEQ ID NO. 2 is mutated from D to R; The encoding nucleotide sequence of the Taq DNA polymerase mutant is mutated at D551R compared to the encoding nucleotide sequence of wild-type Taq DNA polymerase shown as SEQ ID NO. 1, wherein the D551R mutation indicates that the codon of the 551th amino acid in SEQ ID NO. 1 is replaced from GAT to CGT.

2. The qPCR detection method of claim 1, wherein: The qPCR detection kit comprises target sequence primers, an intercalating dye or a labeled target probe, and a Taq DNA polymerase mutant.

3. The qPCR detection method of claim 2, wherein: The intercalating dye is SYBR Green or EvaGreen.

4. Application of the qPCR detection method according to any one of claims 1-3 in nucleic acid amplification and qPCR.

Images