A plant-conserved Hem1 protein phase separation domain and its application

By cloning the LCD domain of the conserved Hem1 protein phase transition domain of the plant, the plant's response to SA was enhanced, and the problem of slow plant disease resistance was solved and the survival rate of crops under extreme conditions was improved.

CN115873864BActive Publication Date: 2025-05-30WUHAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210826269.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-13
Publication Date
2025-05-30
Estimated Expiration
2042-07-13

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the perceived sensitivity of plants to pathogen invasion and the speed of disease resistance, resulting in a decrease in crop survival rate under extreme stress conditions.

Method used

By cloning the conserved Hem1 protein phase transition domain, especially the low-complexity domain (LCD) at its C-terminal, to enhance the response sensitivity of disease-resistant genes to the defense hormone SA, thereby promoting plant invasion perception and disease-resistant response to pathogens.

Benefits of technology

It achieves a faster and more sensitive response to pathogen invasion, significantly improves the survival rate of crops under extreme stress conditions, and reduces food losses caused by pests and diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115873864B_ABST
    Figure CN115873864B_ABST
Patent Text Reader

Abstract

The present invention discloses a phase transition domain of a plant-conserved Hem1 protein and its application. The plant-specific LCD domain of the Hem1 protein can inhibit rapid cell death, thereby improving the survival rate of plants under extreme stress and promoting the stable production of agricultural crops. By applying the specific LCD of the Hem1 protein, the present invention promotes the survival rate of forestry and agricultural cash crops under extreme stress conditions, achieving the purpose of stabilizing agricultural production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetics, and particularly relates to a plant-conserved Hem1 protein phase transition domain and its application. Background Art

[0002] In the past two centuries, the world population has increased by sevenfold. It is estimated that food production needs to increase by 60% in 2050 to feed the expected 10 billion population on Earth (Ristaino et al., 2021a). The United Nations declared 2020 as the International Year of Plant Health. To address food security issues, while increasing food production, minimizing food losses caused by pests and diseases is an important measure to ensure food security. It is statistically shown that the proportion of global food production losses caused by food crop pests and diseases in the total food production is very high. Taking the statistical results of the average loss range of major global crops as an example, wheat is 21.5% (10.1% - 28.1%), rice is 30.0% (24.6% - 40.9%), corn is 22.5% (19.5% - 41.1%), potato is 17.2% (8.1% - 21.0%), and soybean is 21.4% (11.0% - 32.4%) (Savary et al., 2019). The survey results in Central America show that plant diseases cause significant pre-harvest losses to small farmers, reaching approximately 50% for beans and corn, and approximately 50% of potato losses in South America (Savary et al., 2019).

[0003] To prevent the invasion of pathogenic bacteria, plants have evolved a complete set of immune mechanisms to resist the invasion of exogenous microorganisms systemically. For example, specifically recognizing the conserved PAMPs (pathogen associated molecular pattern) of invading microorganisms, thereby generating an immune response PTI (PAMP-triggered immunity) to the invading microorganisms; and a specific immune response to the effector factors secreted by pathogenic microorganisms, namely effector ETI (effector-triggered immunity) (Jones and Dangl, 2006). Salicylic acid (SA) is a key defense hormone in plants and plays a very important role in the immune response of plants. It is essential for plants to generate basal immunity, induce hypersensitive response (HR) of cells, and plant systemic acquired resistance (SAR). SA can induce the production of many disease-resistant related proteins including pathogenesis-related proteins (PR proteins), thereby enabling plants to resist pathogens.

[0004] Our research shows that the Hem1 protein has the characteristic of rapid response to the plant defense hormone SA. The C-terminal LCD (low complexity domain) of this protein has the property of responding to SA. Therefore, we use this section of the LCD domain to endow or improve the response sensitivity of disease-resistant genes to SA, and develop a plant that is more sensitive to the invasion of pathogens and more rapid in resistance. Summary of the Invention

[0005] The object of the present invention is to provide a phase transition domain of the plant-conserved Hem1 protein and its application. The phase transition domain of the Hem1 protein can reduce the death of crops caused by extreme stress conditions, so as to achieve the purpose of stabilizing agricultural production.

[0006] In the first aspect of the present invention, a phase transition domain of a plant-conserved Hem1 protein is provided. The phase transition domain of the Hem1 protein includes: obtained by PCR amplification with the following primer pairs:

[0007] 1) Primer pair AtP1, the nucleotide sequence is shown in SEQ ID NO.1-SEQ ID NO.2;

[0008] 2) Primer pair OsP1, the nucleotide sequence is shown in SEQ ID NO.3-SEQ ID NO.4;

[0009] 3) Primer pair ZmP1, the nucleotide sequence is shown in SEQ ID NO.5-SEQ ID NO.6;

[0010] 4) Primer pair TaP1, the nucleotide sequence is shown in SEQ ID NO.7-SEQ ID NO.8;

[0011] 5) Primer pair GmP1, the nucleotide sequence is shown in SEQ ID NO.9-SEQ ID NO.10;

[0012] 6) Primer pair BnP1, the nucleotide sequence is shown in SEQ ID NO.11-SEQ ID NO.12;

[0013] 7) Primer pair BrP1, the nucleotide sequence is shown in SEQ ID NO.13-SEQ ID NO.14;

[0014] 8) Primer pair SlP1, the nucleotide sequence is shown in SEQ ID NO.15-SEQ ID NO.16;

[0015] 9) Primer pair PtP1, the nucleotide sequence is shown in SEQ ID NO.17-SEQ ID NO.18;

[0016] 10) Primer pair SmP1, with the nucleotide sequence shown in SEQ ID NO.19 - SEQ ID NO.20;

[0017] 11) Primer pair PpP1, with the nucleotide sequence shown in SEQ ID NO.21 - SEQ ID NO.22;

[0018] 12) Primer pair GhP1, with the nucleotide sequence shown in SEQ ID NO.23 - SEQ ID NO.24;

[0019] 13) Primer pair StP1, with the nucleotide sequence shown in SEQ ID NO.25 - SEQ ID NO.26;

[0020] 14) Primer pair NbP1, with the nucleotide sequence shown in SEQ ID NO.27 - SEQ ID NO.28.

[0021] Furthermore, the phase separation domain of the Hem1 protein further includes: a phase separation domain with a homology of ≥ 80% to the nucleotide sequence.

[0022] Furthermore, in the phase separation domain of the Hem1 protein, the amplified lengths of the primer pairs are respectively:

[0023] Primer pair AtP1: An amplified fragment of 348 bp is amplified from Arabidopsis thaliana cDNA,

[0024] Primer pair OsP1: An amplified fragment of 348 bp can be amplified from rice cDNA;

[0025] Primer pair ZmP1: An amplified fragment of 348 bp can be amplified from maize cDNA:

[0026] Primer pair TaP1: An amplified fragment of 348 bp can be amplified from wheat cDNA:

[0027] Primer pair GmP1: An amplified fragment of 348 bp can be amplified from soybean cDNA:

[0028] Primer pair BnP1: An amplified fragment of 348 bp can be amplified from rapeseed cDNA:

[0029] Primer pair BrP1: An amplified fragment of 348 bp can be amplified from Chinese cabbage cDNA:

[0030] Primer pair SlP1: An amplified fragment of 348 bp can be amplified from tomato cDNA:

[0031] Primer pair PtP1: An amplified fragment of 348 bp can be amplified from Populus trichocarpa cDNA:

[0032] Primer pair SmP1: An amplification fragment of 348 bp can be amplified from Selaginella moellendorffii cDNA:

[0033] Primer pair PpP1: An amplification fragment of 348 bp can be amplified from Physcomitrium patens cDNA:

[0034] Primer pair GhP1: An amplification fragment of 348 bp can be amplified from Gossypium hirsutum cDNA:

[0035] Primer pair StP1: An amplification fragment of 348 bp can be amplified from Solanum tuberosum cDNA:

[0036] Primer pair NbP1: An amplification fragment of 348 bp can be amplified from Nicotiana benthamiana cDNA:

[0037] In the second aspect of the present invention, there is provided the use of the plant-conserved Hem1 protein phase transition domain in enhancing the response of the fusion protein to immune signals, thereby promoting the survival rate of agricultural and forestry economic crops under extreme stress conditions.

[0038] In the second aspect of the present invention, there is provided the use of the Hem1 protein in enhancing the response of the fusion protein to immune signals, thereby promoting the survival rate of agricultural and forestry economic crops under extreme stress conditions.

[0039] The Hem1 protein includes: obtained by PCR amplification using the following primer pairs:

[0040] 1) Primer pair 1 corresponding to primer pair AtP1:

[0041] Left-end primer sequence, ATGGCGAATTCTCGTCAATATTATC;

[0042] Right-end primer sequence, TTAGTTATGCTGTTTATATGAGATGGGA;

[0043] 2) Primer pair 2 corresponding to primer pair OsP1:

[0044] Left-end primer sequence, ATGGCCCATGTTTCGTTCAAATC;

[0045] Right-end primer sequence, TTATTTGTAGGATAGGGGGCCAGA;

[0046] 3) Primer pair 3 corresponding to primer pair ZmP1:

[0047] Left-end primer sequence, ATGGCCCATGTTTCGTTCAAA;

[0048] Right-end primer sequence, CTATCTGTACGATAGAGGGCCAG;

[0049] 4) Primer pair 4 corresponding to primer pair TaP1:

[0050] Left primer sequence: ATGGCGCACGTTTCGTTCAAA;

[0051] Right primer sequence: CTATTTGTAGGACAGAGGGCCAG;

[0052] 5) Primer pair 5 corresponding to primer pair GmP1:

[0053] Left primer sequence: ATGGCAAAGTCAAGGCAGAAG;

[0054] Right primer sequence: CTACTTGTACGCTAATGGACCAG;

[0055] 6) Primer pair 6 corresponding to primer pair BnP1:

[0056] Left primer sequence: ATGGCGAATTCTCGTCAATAC;

[0057] Right primer sequence: TTAGTTATGCTGTTTATATGAGA;

[0058] 7) Primer pair 7 corresponding to primer pair BrP1:

[0059] Left primer sequence: ATGGCGAATTCCCGTCAATAC;

[0060] Right primer sequence: TTAGTTATGCTGTTTATAAGAGA;

[0061] 8) Primer pair 8 corresponding to primer pair SlP1:

[0062] Left primer sequence: ATGACTAAACCGAGGCAGCAG;

[0063] Right primer sequence: TCACTTGTAAGATATAGGACCGG;

[0064] 9) Primer pair 9 corresponding to primer pair PtP1:

[0065] Left primer sequence: ATGGCAAAGTCGCGGCAGCAT;

[0066] Right primer sequence: CTACTTGTACATTAACGGCCCAG;

[0067] 10) Primer pair 10 corresponding to primer pair SmP1:

[0068] Left primer sequence: ATGGGGACGGAGAGTCAATTG;

[0069] Right primer sequence: TCACGCTTGCACTGCCCGTGACG;

[0070] 11) Primer pair 11 corresponding to primer pair PpP1:

[0071] Left primer sequence: ATGGAGGATTTACAAGCCAGC;

[0072] Right primer sequence: TTATACATATGACAGAGGTCCTG;

[0073] 12) Primer pair 12 corresponding to primer pair GhP1:

[0074] Left primer sequence: ATGGCGAAATCGCGGCAACAC;

[0075] Right primer sequence: CTACTTGTATGATATGGGACCAG;

[0076] 13) Primer pair 13 corresponding to primer pair StP1:

[0077] Left primer sequence: ATGACTAAACCGAGGCAGCAA;

[0078] Right primer sequence: TCACTTGTAAGATATAGGACCAG;

[0079] 14) Primer pair 14 corresponding to primer pair NbP1:

[0080] Left primer sequence: ATGCTTACAATGGCTAAATCAAGGC;

[0081] Right primer sequence: TCACTTATAAGATATAGGACCCGAC;

[0082] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0083] The present invention provides a plant-conserved Hem1 protein phase transition domain and its application. For the first time, the present invention clones a liquid-liquid phase separation domain (LCD) specific to plants that responds to immune signals. The LCD cloned by molecular cloning in the present invention can endow different proteins with the response to immune signals through phase separation, thereby regulating the disease resistance response of plants. In this application, the CRISPR gene editing technology is used to delete this specific domain (LCD), and it is found that the mutant lacking LCD shows a more sensitive phenotype than the wild type in the experiment of pathogen-induced cell death, that is, the survival rate is significantly decreased. In this study, we found that LCD can inhibit the large-scale cell death induced by ETI, thereby promoting the survival of plants after being infected by pathogens. In summary, the plant-specific LCD can inhibit the over-activation of the plant immune response and promote the survival rate of plants after pathogen infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0084] To more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for the description of the embodiments. Obviously, the following described drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0085] Figure 1 The result that Hem1 in Example 1 of the present invention is a translational negative regulator; (A) is a schematic diagram of the uORFs-LUC translational reporter; (B) WL represents the growth phenotypes of Col-0 and hem1 under bright field; LUC represents the LUC activities measured for Col-0 wild type and hem1; after backcrossing the original mutant dst5 with the parental reporter system uORFs-LUC / WT, a bc5F2 population is obtained, and hem1 carries a point mutation on the Hem1 gene, and the scale bar is 2 cm; (C) is for Figure 1 The quantitative result of the relative LUC activities of Col-0 and hem1 in B. Error bars are mean ± s.d. (n = 16), and a t-test is performed. *** represents P < 0.001.

[0086] Figure 2Results of Example 1 of the present invention showing that hem1 restricts pathogen growth by promoting cell death after ETI induction; (A) shows the results of statistical analysis of leaf death in Col-0, rps2, and hem1 induced by 50 μM Dex in the ETI immune signal simulated by the pathogen effector AvrRpt2 expressed endogenously. The scale bar is 1 cm; (B) measures the rate of ETI-induced cell death in Col-0, rps2, and hem1; (C) shows the results of bacterial growth 2 days after ETI induction for 3 hours in Col-0, rps2, and hem1. Error bars represent mean ± s.d. (n = 8), and a t-test was performed. *** indicates P < 0.001.

[0087] Figure 3 Results of comparative analysis of the low complexity domain (LCD) of Hem1 protein in plants and animals in Example 1 of the present invention. (A) shows the prediction of the LCD of seven representative plant (top) and animal (bottom) Hem1 protein homologs using IUPred2 (https: / / iupred2a.elte.hu / ); (B) is the sequence alignment analysis of the LCD of plant Hem1 proteins. The regions marked by the red boxes are highly conserved regions, and the regions marked by the blue boxes are relatively conserved regions; (C) constructs a phylogenetic tree for representative species in animals and plants. The right half with a pink region represents plants (with LCD), and the left half with a blue region represents animals (without LCD). Animal Hem proteins can be further divided into two types, Hem1 / 2 (e.g., humans), while plants have a single (e.g., Arabidopsis) or repeated (e.g., wheat) Hem1 protein; (D) shows the 3D protein structures of AtHem1 (left; AT2G35110.1) and HsHem2 (right; NM_013436.5) stored in the AlphaFold2 database; the start, middle, and end positions of the LCD region of the Arabidopsis Hem1 protein are marked by arrows, and the corresponding positions of Hem1 encoded by AT2G35110.2 are included in the parentheses;

[0088] Figure 4 Results of in vitro phase separation experiments of Hem1 and LCD in Example 1 of the present invention; (A) shows a schematic diagram of the construction of the fusion protein. MBP, maltose binding protein; mYFP, monomeric YFP. (B) shows the formation of phase separation of mYFP-Hem1 and mYFP-LCD induced by PEG, with (top) or without (bottom) the molecular chaperone MBP. The scale bar is 10 μm. (C) shows the fusion events of mYFP-LCD condensates. The scale bar is 10 μm. (D, E) show the photobleaching experiments of mYFP-LCD condensates. Error bars for the relative fluorescence intensity recovery after photobleaching represent mean ± s.d. (n = 6). The scale bar is 3 μm.

[0089] Figure 5 The Hem1 protein regulates translation through a plant-specific LCD domain; (A) Proteins interacting with Hem1 were identified by immunoprecipitation mass spectrometry (IP-MS). On the left are the interacting proteins of Hem1 related to actin regulation, and on the right are the identified proteins of Hem1 interacting with the translation regulation process; (B) The split luciferase complementation (SLCA) assay verified the interaction of Hem1(1–1396), Hem1ΔLCD(1–1290), and LCD(1291–1396) with 77 translation initiation, elongation, and release factors in tobacco leaves. The complexes to which different translation factors belong are marked on the left, and the translation factors detected in the mass spectrometry identification results are marked with asterisks.

[0090] Figure 6 The LCD phase separation domain of the Hem1 protein endows NPR1 and TBF1 with phase separation functions; (A) NPR1-YFP and NPR1-LCD-YFP were expressed in tobacco transient leaf cells, and their localization and distribution after treatment with water (top) and SA (bottom) are shown; (B) TBF1-YFP and TBF1-LCD-YFP were expressed in tobacco transient leaf cells, and their localization and distribution after treatment with water (top) and SA (bottom) are shown. The scale bar is 3 μm. Detailed implementation manners

[0091] The present invention will be specifically described below in combination with the detailed implementation manners and examples, and the advantages and various effects of the present invention will be presented more clearly therefrom. Those skilled in the art should understand that these detailed implementation manners and examples are used to illustrate the present invention rather than limit the present invention.

[0092] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In case of contradiction, this specification shall prevail.

[0093] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchase or by existing methods.

[0094] An embodiment of the present invention provides a plant-conserved Hem1 protein phase separation domain, and the general idea is as follows:

[0095] We screened a translation regulation gene Hem1 through genetic mutagenesis, and further research proved that the Hem1 protein is a phase separation protein that responds to immune signals such as SA and ETI.

[0096] Sequence analysis of the Hem1 protein revealed that the phase separation of the Hem1 protein upon immune signal stimulation is regulated by a disordered region (LCD, low complexity domain) located at its C-terminus. Further studies showed that the plant Hem1 protein can interact with multiple protein complexes during mRNA translation, such as eIF4F, eIF3, eIF2, etc. When a pathogen invades a host cell, the unique LCD endows Hem1 with the ability to form phase separation bodies to rapidly respond to immune signals and mediate the translational regulation of plants.

[0097] Using the CRISPR gene editing technology to delete this specific domain (LCD), it was found that the mutants lacking the LCD showed a more sensitive phenotype than the wild type in the experiment of pathogen-induced cell death, that is, the survival rate decreased significantly. In this study, we found that LCD can inhibit the large-scale cell death induced by ETI and thus promote the survival of plants after pathogen infection.

[0098] Sequence analysis of the Hem1 protein revealed that the Hem1 protein is highly conserved in plants. Through prediction, it was found that all Hem1 proteins in plants have an LCD domain at the 3'-terminus. Therefore, we cloned the LCD domains of Hem1 proteins from some important agricultural and forestry economic crops and lower species such as Physcomitrella patens, such as Oryza sativa, Zea mays, Triticum aestivum, Glycine max, Brassica napus, Brassica rapa, Cucumis sativus, Solanum lycopersicum, Populus trichocarpa, Selaginella moellendorffii, Physcomitrella patens, Gossypium hirsutum, Solanum tuberosum, Nicotiana benthamiana.

[0099] The vector pYL181 used in this application is specifically described in the literature: Zhou, G., Niu, R., Zhou, Y., Luo, M., Peng, Y., Wang, H., Wang, Z., & Xu, G. (2021). Proximity editing to identify RNAs in phase-separated RNA binding protein condensates. Cell discovery, 7(1), 72. https: / / doi.org / 10.1038 / s41421-021-00288-9.

[0100] The vector 35S::gene-YFP used in this application is specifically described in the literature: Xu, G., Yuan, M., Ai, C., Liu, L., Zhuang, E., Karapetyan, S., Wang, S., & Dong, X. (2017). uORF-mediated translation allows engineered plant disease resistance without fitness costs. Nature, 545(7655), 491–494. https: / / doi.org / 10.1038 / nature22372.

[0101] Next, a plant-conserved Hem1 protein phase separation domain of this application will be described in detail in combination with examples and experimental data.

[0102] Example 1: Discovery of the translation regulatory gene Hem1, the plant-conserved Hem1 protein phase separation domain and its uses

[0103] I. A translation regulatory gene Hem1 was screened by genetic mutagenesis

[0104] 1. The operation steps are as follows:

[0105] (1) Weigh 2.5 g of uORFs TBF1 -LUC / WT dried and clean Arabidopsis thaliana seeds (about 125,000 seeds) into a 50 mL centrifuge tube, add 40 mL of phosphate buffer (100 mM, pH 7.4), and leave it standing in a 4°C refrigerator overnight (M0).

[0106] (2) The next day, replace the fresh 40 mL of phosphate buffer in the fume hood, add EMS to make its final concentration 0.4%, and place the centrifuge tube on a hammer-mounted shaker and gently rotate and incubate at room temperature for 8 h.

[0107] (3) After the mutagenesis, replace the phosphate buffer containing EMS with 40 mL of deionized water and repeat the washing 20 times.

[0108] (4) Finally, spread the washed seeds (M1) on clean filter paper and let them dry.

[0109] (5) Prepare 40 pots of substrate for Arabidopsis growth and evenly scatter the dried seeds into the substrate.

[0110] (6) After maturity, for the seeds (M2) in each pot, approximately every 180 M1 single plants are used as a pool and collected by mixing.

[0111] (7) Evenly sow approximately 800 seeds from each M2 on 1 / 2 MS plates and place them in a light incubator for cultivation. When the seedlings grow to 12 days old, spray them with 1 mM luciferin diluted with 0.01% Triton X-100 (10 mL: 0.0032 g luciferin powder, adjust the pH value to a bright green with one drop of 1 M NaOH). After a 1-hour dark treatment, analyze the luciferase phenotype by imaging with a cold CCD camera.

[0112] 2. For the mutant dst5 with enhanced LUC activity screened after EMS mutagenesis, the seeds (M3) harvested from the mutant dst5 were sown and the LUC activity was analyzed, further confirming the phenotype of enhanced dst5 LUC activity. By backcrossing dst5 (M3) with the parental uORFs TBF1 -LUC / WT, it was determined that dst5 is a single-gene recessive mutant, where bc1F1 shows low LUC activity as uORFs TBF1 -LUC / WT. Among 576 bc1F2, we selected 94 segregating offspring with high LUC activity for further whole-genome resequencing on the Illumina HiSeq2000 platform. Meanwhile, collect the leaves of approximately 50 uORFs TBF1 -LUC / WT as the parental reference genome for resequencing.

[0113] 3. SNP calls in the TAIR10 version of the Col-0 reference genome by the pipelines of NGM 54 and SNPtrack 55 both gave three closely related homozygous mutations on chromosome 2 chr2: C14798110T (AT2G35110 / Hem1); chr2: C11572722T (AT2G27100); chr2: C15262299T (AT2G36380). Further genetic complementation experiments were used to determine that Hem1 is the causal gene mutated in dst5 (M3). The sequence of the translation regulatory gene Hem1 in Arabidopsis thaliana is available in NCBI accession number NM_001036408.3 (https: / / www.ncbi.nlm.nih.gov / ).

[0114] II. Hem1 protein is a phase-changing protein responsive to immune signals such as SA and ETI

[0115] 1. ETI induction

[0116] For Dex-AvrRptr2 / Col-0, Dex-AvrRptr2 / rps2 and Dex-AvrRptr2 / hem1 mutants grown for 21 days under short-day conditions (12 h light, 12 h dark, 22 °C) (Dex-AvrRptr2, dexamethasone (Dex) induces the expression of the pathogen effector AvrRpt2), after spraying 50 μM dexamethasone, the leaf death of different mutants was observed at 10 h and 24 h respectively, and samples were taken for photography.

[0117] 2. Ion leakage experiment

[0118] Using a punch with a diameter of 6 mm, samples were taken from Dex-AvrRptr2 / Col-0, Dex-AvrRptr2 / rps2 and Dex-AvrRptr2 / hem1 grown for 21 days. Four replicates were set for each genotype, with 6 discs in each replicate. They were placed in a 50 mL centrifuge tube and 6 mL of deionized water containing 1 μM was added, and measurements were taken every 3 h.

[0119] 3. Bacterial growth experiment

[0120] Two days before the experiment, Psm Es4326 was taken out of the refrigerator, streaked on a plate medium containing 100 mg streptomycin and then placed in an incubator at 28 °C. On the day of the experiment, Psm Es4326 was taken out and 50 mL of 10 mM MgCl 2Prepare the solution with OD = 0.002. Use a syringe to inject bacteria into the leaves of 21-day-old Arabidopsis thaliana. Inject 24 leaves for each genotype. After injection, dry the water on the leaf surface with a tissue paper and culture for 3 days. After 3 days, remove the leaves injected with the pathogen, punch holes with a 6-mm-diameter puncher, and set every three small round pieces as a sample, with 8 replicates. Place the punched small round pieces into an eight-well tube containing 200 μL of 10 mM MgCl 2 solution, add steel columns, and place them on a grinder for grinding. At the same time, add 180 μL of 10 mM MgCl 2 solution to a 96-well plate. Use an 8-channel pipette to take 20 μL from the ground sample and add it to the first column in the 96-well plate. After mixing, take 20 μL and dilute it to the next level, with a total of 6 dilutions. Finally, spread the diluted bacterial solution on a KB culture plate and count the results two days later.

[0121] The results are as Figure 2 shown. As Figure 2 can be seen, the hem1 mutant shows a phenotype of accelerated cell death in the ETI immune signal simulated by the pathogen effector AvrRpt2 induced by the endogenous source. And the hem1 mutant shows a strong resistance to the Psm ES4326 pathogen after the premature induction of ETI translation. Therefore, we infer that LCD helps to promote the survival rate of plants in the ETI immune response.

[0122] III. The phase transition domain of the plant-conserved Hem1 protein

[0123] 1. Use IUPred2A (https: / / iupred2a.elte.hu / ) to predict plants and find that all plant-derived Hem1 proteins have a unique C-terminal extension (LCD domain), while animal-derived Hem1 proteins do not have the LCD domain.

[0124] 2. To find out the structural basis supporting its central function, we analyzed the protein sequence of Hem1. The results of the comparative analysis of the disordered regions (LCD) of Hem1 proteins in plants and animals are as Figure 3 shown. It can be seen that most of the protein sequence consists of the classical Nckap1 domain, and its sequence and structural similarity are shared in higher eukaryotes. Some animal Hem1 proteins (such as humans) have evolved into two discrete subfamily members (Hem1 / 2). While plant species have only one member, and it varies with the gene copy number of polyploid plants (for example, Arabidopsis thaliana has one, and wheat has four copies; Figure 3 .C).

[0125] 3. In vitro phase separation experiments of Hem1 and LCD

[0126] To verify the ability of Hem1 protein and LCD to phase-separate in vitro, we constructed MBP-mYFP-Hem1 (pYL183) and MBP-mYFP-Hem1-LCD (pYL187). The specific steps are as follows:

[0127] (1) Use the primer pairs in Table 1 to amplify from Arabidopsis cDNA (annealing temperature is 60 °C) to obtain the Hem1 and Hem1 LCD fragments;

[0128] Table 1

[0129]

[0130] (2) Connect the Hem1 fragment to the pYL181 (Zhou, et al., 2021) vector by homologous recombination to obtain the MBP-mYFP-Hem1 (pYL183) plasmid; connect the Hem1 LCD fragment to the pYL181 vector by homologous recombination to obtain the MBP-mYFP-Hem1-LCD (pYL187) plasmid;

[0131] (3) Transform the MBP-mYFP-Hem1 (pYL183) plasmid and the MBP-mYFP-Hem1-LCD (pYL187) plasmid into Escherichia coli Rossetta (DE3) cells (TransGen, CD801-02) respectively to obtain 2 well-transformed expression strains.

[0132] (4) Shake the 2 well-transformed expression strains in 5 mL of LB liquid medium containing carbenicillin (50 mg / L) overnight on a small shaker first. The next day, transfer them at a ratio of 1:500 to TB medium containing carbenicillin (50 mg / L) and culture them on a shaker at 250 rpm at 25 °C for 6 h until OD600 -1 = 1.0. Induce protein expression by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) with a final concentration of 0.3 mM at 16 °C for 18 h. -1 ) nm

[0133] (5) Collect the cells by centrifugation and resuspend them in lysis buffer (20 mM Tris-HCl pH 7.4, 1 mM EDTA, 500 mM NaCl, 10 mM 2-mercaptoethanol, 1 mM PMSF). Use a high-pressure homogenizer (ATS Engineering, FB-110X) to lyse them under high pressure. Centrifuge at 12,000 g at 4 °C for 1 h to separate the soluble supernatant. Purify using amylose resin (NEB, E8021S). The purified protein is passed through with 10 μg / mL -1 ​Factor Xa protease (NEB, P8010S) was digested overnight at 23 °C. Proteolytic digestion and purification of proteins at each step were examined by SDS-PAGE gel electrophoresis and Coomassie Brilliant Blue staining. The protein concentration was measured using Bradford's Easy Protein Quantitative Kit (TransGen, DQ101-01) and adjusted to different concentrations to induce in vitro phase separation.

[0134] (6) PEG8000 (Sigma, BCCC7539) was used to induce phase separation. Liquid samples, namely MBP-YFP-Hem1 and YFP-Hem1-LCD proteins, were placed in a confocal dish (Solarbio, YA0572) and examined using a Leica TCS SP8 upright microscope equipped with a 63× oil immersion objective. Excitation was performed using a 514 nm laser and emission spectra were received through a 524–580 nm filter. To perform fluorescence recovery after photobleaching (FRAP), we used a 514 nm laser at 60% power intensity to bleach the region of interest (ROI) in two iterations. The recovery of YFP fluorescence was recorded every two seconds after bleaching. The recovery curve was analyzed using Origin 9.

[0135] (7) The results are as Figure 4 shown, and it can be seen that:

[0136] We utilized the spatial structure data of Arabidopsis thaliana hem1 and human hem2 in the AlphaFold2 database ( Figure 4 .D), and after comparison, it was found that the three-dimensional spatial structures of the two proteins are very similar. The largest difference is mainly in a region of the carboxyl terminus of Arabidopsis thaliana that cannot be predicted, and this region is exactly the LCD domain of Arabidopsis thaliana.

[0137] Before the removal of the molecular chaperone maltose-binding protein, the Hem1 protein (MBP-mYFP-Hem1) expressed in Escherichia coli could condense into condensates at a lower protein concentration induced by PEG. The removal of MBP (mYFP-Hem1) resulted in the formation of a large number of aggregates by Hem1 without the occurrence of liquid-liquid phase separation, indicating that Hem1 has a strong tendency to aggregate in vitro. Observation of the in vitro phase separation of LCD (mYFP-LCD) revealed the occurrence of typical liquid-liquid phase separation, such as PEG-induced phase separation ( Figure 4 .A, B), droplet fusion events ( Figure 4 .C), and fluorescence recovery after photobleaching (FRAP; Figure 4 .D, E). Therefore, the unique LCD domain of plant Hem1 provides the ability of the Hem1 protein to undergo phase separation.

[0138] 4. To determine the extent to which Hem1 is involved in translational reprogramming, we constructed a protein-protein interaction network of Hem1 from the IP mass spectrometry of the mYFP-Hem1 complementary line driven by the plant Hem1 gene's own promoter. The operating steps are as follows:

[0139] (1) Take a certain amount of mYFP-Hem1 complementary seeds and GFP-transformed seeds into a 1.5 mL sterilized centrifuge tube, add 1 mL of 50% 84 disinfectant solution for sterilization for 3 min. After adding 1 mL of 75% ethanol for sterilization for 1 min, wash 6 times with sterile water and then add 1 mL of sterile water, and place it in a 4°C refrigerator for soaking for three days. After three days, spot the seeds on 1 / 2 MS solid medium. After culturing for 10 d, collect 5 g of Arabidopsis seedlings and grind them in liquid nitrogen. Collect the powder into a 50 mL centrifuge tube, add 10 mL of lysis buffer (50 mM pH 7.5 Tris-HCl, 150 mM NaCl, 0.2% nonidet P-40, 0.1% Triton-100, 1 tablet of Cocktail), place it on a mixer to mix well and then place it on ice for 10 min. Then centrifuge at 4°C and 12,000 g for 15 min. Take the supernatant and add 20 μL of _A agarose beads that have been pre-washed with lysis buffer, and place it on a rotary shaker and incubate at 4°C for 2 h. After the incubation, centrifuge at 3,000 g for 5 min at 4°C to collect _A agarose beads into a 1.5 mL centrifuge tube, add 1 mL of washing buffer (50 mM pH 7.5 Tris-HCl, 150 mM NaCl), place it on a rotary shaker at 4°C and wash for 1 min, then centrifuge at 3,000 g for 2 min at 4°C, discard the supernatant, add 1 mL of washing buffer again, and repeat the washing three times. Finally, add 2× protein loading buffer (Solarbio, P1040) to the washed _A agarose beads, and heat at 95°C for 5 min. Load the prepared protein sample onto an SDS-PAGE gel and electrophorese until the sample runs out of the stacking gel by about 1 cm, then cut the gel strip and send it to the mass spectrometry identification center for subsequent identification and analysis.

[0140] (2) After removing the proteins detected in the empty control from the obtained mass spectrometry data, we used cytoscape (https: / / cytoscape.org / ) to construct the interaction network of Hem1 protein involved in the cytoskeleton and translation factors.

[0141] (3) As shown in Figure 5 , we found that Hem1 interacted with translation factors and some components in the known actin regulation during the biological process of participating in translation ( Figure 5.A). Hem1 interacts extensively with proteins related to the translation machinery, so Hem1 may act as a global translation regulator. To support this, we successfully cloned 77 out of a total of 95 protein translation initiation, elongation, and release factors encoded in the Arabidopsis genome. We directly detected 35 strong pairwise interactions (score > median) through split luciferase complementation assay (SLCA; Figure 5 .B). This indicates that Hem1 is highly associated with the translation process throughout translation. Based on these results, we propose a model where Hem1 associates with translation-related devices (such as membrane organelles or the cytoskeleton) by guiding or anchoring and acts as a scaffold, and this association can ensure orderly translation but with relatively low efficiency. This integrated molecular device can also well regulate the translation process. For example, during ETI activation, Hem1 can quickly co-assemble with these translation factors into a temporary protein manufacturing workshop for efficient translation.

[0142] Example 2, LCD and Its Applications

[0143] 1. To further verify that LCD can enhance the response of fusion proteins to immune signals such as SA and ETI, we cloned the SA-responsive receptor gene NPR1 and transcription factor TBF1 in Arabidopsis, and the specific steps are as follows:

[0144] (1) Amplify (annealing temperature is 58°C) from Arabidopsis cDNA using the primer pairs in Table 2 to obtain NPR1 and TBF1 fragments;

[0145] Table 2

[0146]

[0147] (2) Connect the NPR1 and TBF1 fragments to the 35S::gene-YFP (Xu et al., 2017) vector through homologous recombination respectively to obtain two plant binary expression vectors, 35S::NPR1-YFP and 35S::TBF1-YFP.

[0148] (3) Amplify the Hem1 gene LCD based on the two constructed plant binary expression vectors to obtain the LCD fragment;

[0149] Table 3

[0150]

[0151] (4) Digest the LCD fragment with BamHI (NEB, #R3136), and also digest the two plant binary expression vectors, 35S::NPR1-YFP and 35S::TBF1-YFP, with BamHI. Connect the LCD of the Arabidopsis Hem1 gene to the two constructed NPR1 and TBF1 expression vectors by ligation to endow NPR1 and TBF1 with Hem1 LCD, obtaining the 35S::NPR1-LCD-YFP vector and the 35S::TBF1-LCD-YFP vector.

[0152] (4) Use the tobacco transient expression system to transform the constructed plasmids. For the NPR1 group: 35S::NPR1-YFP and 35S::NPR1-LCD-YFP; for the TBF1 group: 35S::TBF1-YFP and 35S::TBF1-LCD-YFP were separately transferred into Agrobacterium tumefaciens (GV3101), cultured overnight at 28 °C with shaking at 220 rpm / min, and resuspended with a resuspension solution (10 mM MgCl 2 , 10 mM 2-(N-morpholino)ethanesulfonic acid (pH 5.6), 200 μM acetosyringone) to an OD 600 nm = 0.2, left at room temperature for 1 - 4 h, and then injected into the leaves of Nicotiana benthamiana plants at 28 days old. Since overexpression of TBF1 will cause the death of tobacco leaves, after injecting the TBF1 group, it was cultured in the greenhouse for 20 h. After injecting the NPR1 group and culturing in the greenhouse for 40 h, a laser confocal microscope (Leica TCS SP8) was used to observe the transiently expressed tobacco leaves with and without 10 mM SA induction. The excitation light was 514 nm, and the emission spectrum was 524 - 580 nm.

[0153] 2. As shown in Figure 6 , it can be seen that NPR1 and TBF1 without fused LCD cannot form a large number of condensations under the stimulation of SA; while NPR1 and TBF1 fused with LCD can rapidly form condensations of different sizes under the stimulation of SA. LCD enhances the response of the disease-resistant genes NPR1 and TBF1 to SA, further indicating that the Hem1 protein plays an important role in plant immunity, and its LCD domain is a sensitivity receptor that improves the plant's immune response to pathogens.

[0154] Finally, it should also be noted that the term "including", "comprising" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements not only includes those elements, but also includes other elements not expressly listed, or elements inherent to such process, method, article or device.

[0155] While the preferred embodiments of the present invention have been described, additional changes and modifications can be made by those skilled in the art once they learn of the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications that fall within the scope of the present invention.

[0156] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. Application of the phase transition domain of the plant-conserved Hem1 protein in enhancing the response of a fusion protein to immune signals, characterized in that, the fusion protein is NPR1 or TBF1 fused with the phase transition domain of the Hem1 protein, and the immune signal is SA; the nucleotide sequence encoding the phase transition domain of the plant-conserved Hem1 protein is the sequence obtained by PCR amplification from Arabidopsis thaliana cDNA using the following primer pair: F: 5’-CGCGGATCCCCATCCGTATCGCTCATCC-3’ R: 5’-CGCGGATCCGTTATGCTGTTTATATGAGATGGGA-3’.

Citation Information

Patent Citations

  • Method for recombinant expression of hemoglobin by using kluyveromyces marxianus

    CN116949086A