A gene of Ardisia japonica carbonyl glycosyltransferase AjCGT1 and its application in the preparation of bergenin

Abstract

The present invention relates to a gene encoding a carbon glycosyltransferase (AjCGT1) from Ardisia truncatula and its application in the preparation of bergenin, belonging to the field of biotechnology. The nucleotide sequence of the Ardisia truncatula AjCGT1 gene is shown in SEQ ID NO. 1, with a total length of 1353 bp; the amino acid sequence of the encoded protein is shown in SEQ ID NO. 2, encoding 451 amino acid residues. The Ardisia truncatula AjCGT1 gene can be used as a biosynthesis regulatory gene for bergenin and in the preparation of bergenin, with significant application prospects and ease of widespread application.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to an Ardisia japonica carbonyl glycosyltransferase AjCGT1 gene and its application in the preparation of bergenin. Background Art

[0002] Ardisias Ardisia japonica ) belongs to the genus Myrsinaceae ( Ardisia The entire plant and roots of Ardisia scabra are used medicinally and contain numerous medicinal components, with bergenin being one of the main active ingredients. Bergenin exhibits multiple benefits, including antitussive, anti-inflammatory, anxiolytic, antioxidant, immunomodulatory, and neuroprotective properties (Shihao Xiang,. Bergenin Exerts Hepatoprotective Effects by Inhibiting the Release of Inflammatory Factors, Apoptosis and Autophagy via the PPAR-γ Pathway. Drug Des Devel Ther. 2020;14:129-143.). Researchers at home and abroad have also found that, unlike morphine-like central nervous system antitussives, bergenin selectively inhibits the cough center, without inhibiting other neural centers. It also exhibits minimal toxicity and adverse reactions, and does not induce drug tolerance with continuous use (Wang Jin, Pharmacokinetics of Bergenin in Humans and Animals and Its Effects on IgABA. Shandong University, 2010).

[0003] Bergenin belongs to the isocoumarin class of compounds. Previous studies have shown that the biosynthetic precursor of bergenin is 2-glucose-4-methoxygallic acid, which is formed by rearrangement after intramolecular dehydration or ring closure under the action of an unknown dehydratase (Gan B. Bajracharya. Diversity, pharmacology and synthesis of bergenin and its derivatives: potential materials for therapeutic usages. Fitoterapia. 2015;101:133-52.). 2-glucose-4-methoxygallic acid is produced by linking 4-methoxygallic acid to glucose at the 2-position under the catalysis of C-glucosyltransferase (CGT) using uridine diphosphate glucose (UDP-glucose) as the glycosyl donor. However, the biosynthesis of bergenin has not been reported so far. Therefore, the discovery of carbonyl glycosyltransferases that can catalyze 4-methoxygallic acid is of great significance for the study of the regulation of bergenin biosynthesis.

[0004] Research on the biosynthetic pathway of bergenin can provide a foundation for artificial cultivation measures in Ardisias and for increasing the content of its active ingredients. However, the raw materials used to extract bergenin require a long cultivation cycle and demand high standards for both the site and the cultivation techniques. Therefore, how to efficiently obtain these useful secondary metabolites has long been a topic of research for scientists. For high-value-added natural products, the efficient production of active pharmaceutical ingredients using modern biotechnology, either homologous or heterologous expression systems, is widely considered a key approach to addressing future shortages of pharmaceutical resources. However, understanding the biosynthetic pathways of these active ingredients requires identifying key genes involved in these pathways. Discovering these catalytic enzyme genes is a crucial step in studying the biosynthetic pathways of plant metabolites. Currently, the synthetic pathway for 4-methoxygallic acid to 2-glucose-4-methoxygallic acid, which undergoes glycosylation at the C-2 position, is unclear, and the function of the glycosyltransferase responsible for glycosylation has yet to be verified, hindering the advancement of bergenin biosynthesis. Therefore, overcoming the limitations of existing technologies is a pressing challenge in the biotechnology field. Summary of the Invention

[0005] The purpose of the present invention is to solve the deficiencies of the prior art and provide an Ardrus japonicus glucosyltransferase AjCGT1, which can be used as a biosynthesis regulatory gene for bergenin and for the preparation of bergenin.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides an Ardrus japonicus carbon glycosyltransferase AjCGT1 gene. The nucleotide sequence of the Ardrus japonicus carbon glycosyltransferase AjCGT1 gene is shown in SEQ ID NO. 1, and the full length of the sequence is 1353 bp.

[0008] The second aspect of the present invention provides the protein encoded by the Ardisia japonica carbonyl glycosyltransferase AjCGT1 gene. The amino acid sequence of the encoded protein is shown in SEQ ID NO. 2, encoding 451 amino acid residues.

[0009] The third aspect of the present invention provides a recombinant plasmid containing the above-mentioned Ardisia japonica carbonyl glycosyltransferase AjCGT1 gene.

[0010] Furthermore, preferably, the Ardisia spp. carbonyl transferase AjCGT1 gene is homologously recombined with the pET28a vector to obtain pET28a- AjCGT1 Recombinant plasmid.

[0011] The fourth aspect of the present invention provides a genetically modified engineered bacterium, comprising the above-mentioned recombinant plasmid, or the genome of the genetically modified bacterium is integrated with the exogenous above-mentioned Ardisia japonica carbonyl glycosyltransferase AjCGT1 gene.

[0012] Furthermore, preferably, the genetically modified bacteria is Escherichia coli BL21 (DE3) strain.

[0013] The fifth aspect of the present invention provides the Ardisia japonica glucosyltransferase AjCGT1 encoded by the Ardisia japonica carbon glycosyltransferase AjCGT1 gene.

[0014] The sixth aspect of the present invention provides the use of the above-mentioned Ardisia japonica carbonyl glycosyltransferase AjCGT1 gene in the preparation of bergenin.

[0015] Furthermore, it is preferred that 4-methoxygallic acid is used as a substrate and uridine diphosphate glucose is used as a sugar donor, and a carbon glycosylation reaction is carried out at the C-2 position of 4-methoxygallic acid under the catalysis of the Ardisia glucosyltransferase AjCGT1 encoded by the Ardisia carbon glycosyltransferase AjCGT1 gene, and the ring is closed to generate bergenin under the action of intramolecular dehydration and rearrangement.

[0016] The present invention obtains the target protein after in vitro expression through a recombinant plasmid, and directly generates bergenin by further catalyzing the substrate 4-methoxygallic acid.

[0017] The Ardisia spp. carbonyl glycosyltransferase (AjCGT1) gene described in the present invention was identified from Ardisia spp. plants through transcriptome sequencing and bioinformatics techniques, followed by extensive experimental screening. RNA from the entire Ardisia spp. plant was extracted using an RNA kit, reverse-transcribed into cDNA, and then amplified by PCR. The primers for amplifying the Ardisia spp. carbonyl glycosyltransferase (AjCGT1) gene are as follows:

[0018] 5'F: atgtctaacaccggcaacc; (SEQ ID NO.3)

[0019] 3'R: ctaatttttcttcaccgtagtaattaaatcagataaagc. (SEQ ID NO.4)

[0020] In addition, when homologous recombination is performed with the vector pET28a, BpOMT1 Genes need to be amplified and recovered using primers with homologous walls. The primers with homologous walls are as follows:

[0021] Upstream homology arm primer: 5′F: gtggacagcaaatgggtcgcggatccatgtctaacaccggcaacc (SEQ ID NO. 5).

[0022] Downstream homology arm primer: 3'R::tgtcgacggagctcgaattcggatccctaatttttcttcaccgtagtaattaaatcagataaagc (shown in SEQ ID NO. 6).

[0023] Transferase isolated and identified from Ardisia japonica AjCGT1 This gene can be used as an important marker gene for molecular-assisted breeding of Ardisia spp., and can also be used as an important candidate gene for producing bergenin in the construction of yeast chassis cells.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention provides an Ardisia truncatula carbonyl glycosyltransferase AjCGT1 gene which can be used as a biosynthesis regulatory gene for bergenin and is applied to the preparation of bergenin.

[0026] (1) The rapid development of bioinformatics has greatly advanced the discovery of key enzyme genes in the biosynthesis pathway of bergenin. The present invention identifies and successfully validates the bergenin biosynthesis regulatory gene, the carbonyl glycosyltransferase AjCGT1, for the first time, opening up a new biosynthetic method for producing bergenin. The present invention obtains the target product by heterologously expressing the protein in Escherichia coli and performing enzymatic catalysis in vitro. This method utilizes in vitro biosynthesis for targeted production, resulting in fewer by-products.

[0027] (2) The present invention provides a recombinant plasmid, genetically engineered bacteria and recombinant protein containing the carbon glycosyltransferase AjCGT1 gene, which lays the foundation for the large-scale synthesis of bergenin by bioengineering methods and further for the construction of cell factories producing bergenin.

[0028] (3) In vitro biosynthesis of bergenin is highly controllable, reducing the need for raw material cultivation, producing a single product, and facilitating the subsequent separation and purification of bergenin. It also reduces the difficulties of chemical synthesis and the complexity of the synthesis pathway. The bergenin C-glycosyltransferase AjCGT1 gene, as a key gene for bergenin biosynthesis, can also be used in breeding research on bergenin-rich plants such as Ardisia spp. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the deduced synthetic route of bergenin;

[0030] Figure 2 Schematic diagram of the construction of the recombinant expression plasmid Pet28a-AjCGT1;

[0031] Figure 3 The results of electrophoresis detection of the recombinant AjCGT1 gene of Ardisia japonica are shown in Figure 1. M represents the nucleic acid Mar, and 1 represents the result of a positive single colony detection.

[0032] Figure 4 This is an SDS-PAGE protein electrophoresis analysis of AjCGT1, a glycosyltransferase from Ardisia truncatula. M represents the protein molecular weight standard; lanes 1, 2, 3, 4, 5, 6, and 7 represent the protein in the precipitate, flow-through eluate, 20 mmol / L imidazole eluate, 40 mmol / L imidazole eluate, 60 mmol / L imidazole eluate, 80 mmol / L imidazole eluate, and 250 mmol / L imidazole eluate, respectively.

[0033] Figure 5HPLC detection of the glycosylation of 4-methoxygallic acid by glycosyltransferase AjCGT1; the horizontal axis is time, in min; the vertical axis is response value, in mAU; where CK is the enzyme activity reaction result of the control group (4-methoxygallic acid + uridine diphosphate glucose + inactivated A. japonica glycosyltransferase AjCGT1); standard: 4-methoxygallic acid standard + bergenin standard; AjCGT1 is the enzyme activity reaction result of the experimental group (4-methoxygallic acid + uridine diphosphate glucose + A. japonica glycosyltransferase AjCGT1);

[0034] Figure 6 : is the mass spectrometry analysis (LC / MS / MS) spectrum of the standard, wherein A is the retention time of 22.59 minutes for the standard 4-methoxygallic acid; B is the retention time of 21.56 minutes for the standard bergenin;

[0035] Figure 7 Mass spectrometry (LC / MS / MS) spectra of the reaction products for enzyme activity verification, where Figure A shows the retention time of the substrate 4-methoxygallic acid at 22.58 minutes; Figure B shows the retention time of the reaction product bergenin at 21.48 minutes;

[0036] Figure 8 This is the fragment ion pattern of the standard substance bergenin (theoretical molecular weight 328) (LC / MS / MS);

[0037] Figure 9 The fragment ion pattern of the reaction product bergenin (theoretical molecular weight 328) (LC / MS / MS). DETAILED DESCRIPTION

[0038] The present invention is described in further detail below with reference to the embodiments.

[0039] Those skilled in the art will understand that the following examples are intended to illustrate the present invention only and should not be construed as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in the art or in the product specifications were used. Materials or equipment used without manufacturer identification are commercially available conventional products. Example 1

[0040] Based on the Unigene basic functional annotation information of the Ardisias transcriptome, CGT candidate genes were screened in the sequencing annotation results. At the same time, the carbonyl glycosyltransferases (CGTs) identified in plants were analyzed by local BLAST analysis of the sequences. The screening results were then sorted and analyzed, and finally a carbonyl glycosyltransferase (CGT) gene was found. After a series of work including cDNA preparation, candidate gene amplification and recovery, homologous recombination, protein expression, in vitro enzyme activity reaction, and HPLC and LC / MS detection, the target candidate carbonyl glycosyltransferase that can catalyze the glycosylation reaction of 4-methoxygallic acid to produce bergenin was finally identified. AjCGT1 Gene( Figure 1 The steps for each stage of bergenin synthesis are as follows (the reagents, raw materials, instruments and equipment used in the following implementation are all commercially available):

[0041] (1) Preparation of cDNA template

[0042] Fresh samples of Ardisia japonica were sliced, quickly frozen in liquid nitrogen, and then RNA was extracted. Total RNA was extracted using the HiPure Plant RNA Mini Kit from Magen (Guangzhou Meiji Biotechnology Co., Ltd.). RNA was extracted according to the kit's protocol. Once qualified, it was reverse-transcribed into cDNA using the TAKARA Reverse Transcription Kit and stored at -20°C until further use.

[0043] (2) Gene amplification and recovery

[0044] The primer design software (CE Design v1.04) was used to design and amplify the glycosyltransferase of Ardisia truncatula. AjCGT1Primers for the gene, consisting of primer F (SEQ ID NO. 3) and primer R (SEQ ID NO. 4), were used according to the Q5 Mix DNA Polymerase instruction manual to amplify the gene using Bergenia cDNA as a template. The amplification system (50 μL) consisted of 25 μL of Q5 High-Fidelity 2X Master Mix, 2.5 μL of each forward and reverse primer (10 mmol), 1 μL of cDNA template, and 19 μL of double-distilled water. The PCR reaction program was as follows: 98°C for 30 s, 35 cycles of 98°C for 15 s, 58°C for 30 s, and 72°C for 1 min, followed by an extension at 72°C for 10 min. After PCR, the target band was recovered by gel run after confirmation of successful amplification. The target gene was recovered using the EasyPure Quick Gel Extraction Kit (Beijing Quanshijin Biotechnology Co., Ltd.). After recovery, the recovery concentration was measured on a NanoReady ultraviolet-visible spectrophotometer, and finally stored in a -20°C refrigerator for later use to obtain the Ardisia spp. carbonyl glycosyltransferase. AjCGT1 The nucleic acid sequence of the gene fragment is shown in SEQ ID NO.1 after sequencing.

[0045] 5'F: atgtctaacaccggcaacc; (SEQ ID NO.3)

[0046] 3'R: ctaatttttcttcaccgtagtaattaaatcagataaagc. (SEQ ID NO.4)

[0047] In addition, the Ardisia spp. carbonyl glycosyltransferase with carrier homology arms AjCGT1 When the gene fragment is homologously recombined with the vector pET28a (the homologous arm is Escherichia coli pET28a), the AjCGT1 The gene needs to be amplified and recovered using primers with homology walls (i.e. homology arm primers) to amplify the gene. AjCGT1The product recovered from gels lacking homology arms was used as a template. The amplification system (50 μL) was prepared according to the Q5 Mix DNA Polymerase instruction manual. The following components were used: 25 μL Q5 High-Fidelity 2X Master Mix, 2.5 μL forward and reverse primers (10 mmol each), 1 μL cDNA template, and 19 μL double-distilled water. The PCR reaction procedure was as follows: 98°C for 30 s; 98°C for 15 s, 58°C for 30 s, and 72°C for 1 min, for 35 cycles; followed by a 10-min extension at 72°C. The homology arm primers consisted of an upstream homology arm primer (shown in the sequence listing as SEQ ID NO. 5) and a downstream homology arm primer (shown in the sequence listing as SEQ ID NO. 6). The Ardisia truncatula glycosyltransferase with vector homology arms was obtained. AjCGT1 Gene fragment.

[0048] Upstream homology arm primer: 5′F: gtggacagcaaatgggtcgcggatccATGTCTAACACCGGCAACC (SEQ ID NO. 5).

[0049] Downstream homology arm primer: 3'R::tgtcgacggagctcgaattcggatccCTAATTTTTCTTCACCGTAGTAATTAAATCAGATAAAGC (shown in SEQ ID NO. 6).

[0050] The lowercase letters in the upstream homology arm primer (SEQ ID NO.5) and downstream homology arm primer (shown in SEQ ID NO.6) represent the pET28a homology arm, and the capital letters represent the amplified Ardisia truncatula carbonyl transferase. AjCGT1 Gene primer sequences.

[0051] (3) Construction and identification of gene recombination vectors

[0052] A schematic diagram of homologous recombination is shown in Figure 2 (For expression of carbonyl glycosyltransferase AjCGT1 Gene). First, the vector pET28a was linearized and digested with NEB BamHI-HF (Star Select Enzyme) to obtain the linearized vector. The digestion system (50 μL) consisted of 1 μg of circular pET28a vector, 5 μL of 10×NEBuffer, 1 μL of Restriction Enzyme, and double-distilled water to a total of 50 μL. The reaction solution was incubated at 37°C for 15 minutes to obtain the linearized vector pET28a. For homologous recombination, the assembly was performed according to the operating instructions of the homologous recombination enzyme. Then, the enzyme was inserted into the vector homology arm of the Ardisia spp. AjCGT1The concentrations of gene fragments and pET28a vectors were calculated and the dosage of each component was calculated according to the instructions for recombinant DNA. Finally, each component was added to the PCR reaction tube on ice, as shown in Table 1. AjCGT1 The recombinant plasmid was obtained by homologous recombination of the gene with the pET28a vector and named pET28a- BpOMT1 After assembly, the results were tested and sent to the company for sequencing. The electrophoresis test results after assembly are shown in Figure 3 , indicating that the assembly is successful. Reassemble the operation according to the following process:

[0053] Table 1 Candidate gene recombination reaction system

[0054] Components Recombination reaction μL Linearized pET28a X Insert gene fragment Y 5×CE II Buffer 4 Exnase II 2 ddH2O to 20 μL

[0055] Where, X = (0.02 × pET28a base pairs) ng / linearized pET28a concentration ng / μL; Y = (0.02 × pET28a base pairs) ng / Ardisia spp. glycosyltransferase AjCGT1 Recovery concentration ng / μL, the inserted gene fragment is the Ardisia spp. carbonyl glycosyltransferase inserted into the vector homology arm AjCGT1 Gene fragment.

[0056] (4) SDS-PAGE protein electrophoresis detection

[0057] Confirmed after protein expression test AjCGT1 The protein induction conditions are: 16°C, 0.1mM IPTG, 220r / min, induction for 12h; then shake vigorously, and use a large centrifuge at 50000r / min to collect the bacteria for 20min, ultrasonic disruptor to break the wall for 10min, and high-speed centrifugation (12000r / min) for 1h to obtain the protein supernatant. Slowly pour the supernatant into the Ni-NTA agarose affinity column, let it stand for 5 minutes, wait for the supernatant to drip naturally, use 5 column volumes of 50mM Tris-HCl (pH 8.0) to remove impurities, and then use 50mM Tris-HCl (pH 8.0) containing 20mM imidazole, 40mM imidazole, 60mM imidazole, 80mM imidazole, and 250mM imidazole to elute it for 2 column volumes in sequence, and collect them separately. The proteins under different imidazole concentrations were then electrophoresed and detected by SDS-PAGE. The detection results are shown in Figure 4 , Figure 4 The results showed that AjCGT1 protein could be eluted and purified in 250mmol / L imidazole eluent.

[0058] (5) Enzyme activity reaction

[0059] Ardisia suspensa carbonyl glycosyltransferase AjCGT1The enzyme activity of the gene was determined by glycosylation reaction to synthesize bergenin in a 1.5 mL centrifuge tube. The experimental sample reaction system contained 2 μL of 100 mM UDP-glucose, 2 μL of 100 mM 4-methoxygallic acid, and 40 μg of purified Ardisia truncatula C-glycosyltransferase. AjCGT1 Protein was added to a total volume of 100 μL using 50 mM Tris-HCl buffer (pH 8.0). After incubation at 32°C for 2 hours, the reaction was terminated with an equal volume of 1 M hydrochloric acid. The reaction was centrifuged at 12,000 rpm for 15 minutes, and the supernatant was collected. The reaction products were analyzed by HPLC and LC-MS / MS.

[0060] Control (CK) reaction system: 2 μL of 100 mM 4-methoxygallic acid, 2 μL of 100 mM UDP-glucose, 40 μg of inactivated purified Ardisia truncatula glycosyltransferase AjCGT1 Protein, add 50 mM Tris-HCl buffer (pH 8.0) to a total volume of 100 μL, and the total volume of the reaction system is 100 μL.

[0061] Standard products: 50 μL of 10 mM 4-methoxygallic acid and 50 μL of 10 mM bergenin.

[0062] (6) Product testing

[0063] HPLC detection conditions are as follows:

[0064] The instrument used for HPLC detection was Agilent 1290 ultra-high performance liquid chromatograph. The chromatographic column was an XBridge ShieldRP18 (4.6 mm × 250 mm, 5 μm), with a column temperature of 30°C. The mobile phase for the determination of bergenin was 0.01% v / v formic acid aqueous solution (A)-acetonitrile (B), with a gradient elution of: 0-8 min, 1%-5% B; 8-13 min, 5%-10% B; 13-20 min, 10%-20% B; 20-25 min, 20%-45% B; 25-35 min, 45%-90% B; 35-38 min, 90%-90% B; 38-45 min, 90%-100% B; the mobile phase A+B used during elution totaled 100%; a linear gradient elution was used; the elution time was 45 min; the injection volume was 10 μL; the flow rate was 0.6 ml / min; the detection wavelength was 270 nm, and the detector was a diode array detector. The detection results are shown in Figure 2. Figure 5 , indicating that the experimental samples were in the presence of Ardisia spp. AjCGT1 Under the catalysis of bergenin, bergenin is produced.

[0065] LC-MS / MS detection conditions are as follows:

[0066] To further confirm the reaction products detected by HPLC, an Agilent 1290 UPLC / 6540 Q-TOF liquid chromatography-mass spectrometer (LC / MS / MS) was used for detection: mass spectrometry conditions: the ion source used was in negative ion mode, voltage: 3500 V; fragmentation voltage: 135 V; cone voltage: 60 V; radio frequency voltage: 750 V, scan range: 100-1000 m / z, scan mode: SRM. Chromatographic conditions: The chromatographic column was XBridge Shield RP18 (4.6 mm × 250 mm, 5 μm), the column temperature was 32°C, and the mobile phase for the determination of bergenin was 0.01% v / v formic acid aqueous solution (A)-acetonitrile (B). Gradient elution: 0-8 min, 1%-5% B; 8-13 min, 5%-10% B; 13-20 min, 10%-20% B; 20-25 min, 20%-45% B; 25-35 min, 45%-90% B; 35-38 min, 90%-90% B; 38-45 min, 90%-100% B; the mobile phase A+B used during elution totaled 100%; linear gradient elution was used; elution time: 45 min; injection volume: 10 μL; flow rate: 0.6 ml / min; detection wavelength: 270 nm, detector: diode array detector. Detection results are shown in Figures 6 to 9 The results show that the product's peak time and characteristic fragment ions are consistent with those of the standard substance bergenin, confirming that the reaction product is bergenin. Ultimately, it was concluded that the glycosyltransferase AjCGT1 has the ability to catalyze the glycosylation of 4-methoxygallic acid to produce bergenin.

[0067] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the foregoing embodiments. The foregoing embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of protection claimed in the present invention is defined by the appended claims and their equivalents.

Claims

1. A gene of Ardisia truncatula carbonyl transferase AjCGT1, characterized in that: The nucleotide sequence of the Ardisia japonica carbonyl glycosyltransferase AjCGT1 gene is shown in SEQ ID NO.

1.

2. The Ardissa japonica glucosyltransferase AjCGT1 obtained by encoding the Ardissa japonica carbon glycosyltransferase AjCGT1 gene according to claim 1, characterized in that: The amino acid sequence of the Ardissatis japonica glucosyltransferase AjCGT1 is shown in SEQ ID NO.

2.

3. A recombinant plasmid containing the Ardisia japonica carbonyl glycosyltransferase AjCGT1 gene according to claim 1.

4. The recombinant plasmid containing the Ardisia japonica carbonyl glycosyltransferase AjCGT1 gene according to claim 3, characterized in that: The Ardisia spp. carbonyl transferase AjCGT1 gene was homologously recombined with the pET28a vector to obtain pET28a- AjCGT1 Recombinant plasmid.

5. A genetically modified engineered bacterium comprising the recombinant plasmid according to claim 3, or wherein the exogenous Ardisia japonica carbonyl glycosyltransferase AjCGT1 gene according to claim 1 is integrated into the genome of the genetically modified bacterium.

6. The genetically modified bacteria according to claim 5, characterized in that The genetically modified bacteria is Escherichia coli BL21DE3.

7. Use of the Ardisia japonica carbonyl glycosyltransferase AjCGT1 gene according to claim 1 in the preparation of bergenin.

8. The use of the Ardisia japonica carbonyl glycosyltransferase AjCGT1 gene in the preparation of bergenin according to claim 7, characterized in that: Using 4-methoxygallic acid as a substrate and uridine diphosphate glucose as a sugar donor, a carbon glycosylation reaction is carried out at the C-2 position of 4-methoxygallic acid under the catalysis of the Ardisia glucosyltransferase AjCGT1 encoded by the Ardisia carbon glycosyltransferase AjCGT1 gene, and the ring is closed to generate bergenin under the action of intramolecular dehydration and rearrangement.

Images