An efficient genetic transformation method for tumorous stem mustard based on Agrobacterium-mediated method

Abstract

The present invention relates to the technical field of efficient genetic transformation of tumorous mustard, and discloses a method for efficient genetic transformation of tumorous mustard based on the Agrobacterium-mediated method, comprising: (1) establishing a regeneration system, inducing tumorous mustard explants using a culture medium supplemented with 6-BA and NAA to obtain a tumorous mustard regeneration system; and (2) establishing a genetic transformation system, inducing sterile explants by placing them in an infiltration solution containing Agrobacterium, and subjecting the infiltration explants to callus induction, adventitious bud differentiation, rooting culture, and seedling hardening to form a tumorous mustard genetic transformation system. This scheme optimizes and screens the induction of different tumorous mustard explants by combining different concentrations of 6-BA (i.e., 6-benzylaminopurine) and NAA (i.e., α-naphthaleneacetic acid) during the establishment of the regeneration system, thereby obtaining a 6-BA and NAA concentration combination with a higher induction rate, and can obtain a regeneration system with an induction rate of up to 86%, thereby significantly improving the transformation rate of tumorous mustard.

Description

Technical Field

[0001] The invention relates to the technical field of high-efficiency genetic transformation of tumorous stem mustard, and in particular to a high-efficiency genetic transformation method of tumorous stem mustard based on an Agrobacterium-mediated method. Background Art

[0002] Tuberous stem mustard (Brassica juncea var. tumida Tsen et Lee), also known as green cabbage, is a plant of the genus Brassica in the Brassicaceae family. It is the primary raw material for making mustard tuber and is a major cash crop in Chongqing, Sichuan, and Zhejiang provinces of my country. For many years, research on tumorous stem mustard has primarily focused on traditional breeding techniques, including genetics, improved variety breeding, cultivation techniques, and quality and safety. However, the long time and low efficiency of traditional breeding have severely hampered the development of tumorous stem mustard.

[0003] To address these issues, recent reports of biological research have included gene cloning, functional studies, and research on the growth of tumorous stems in tumorous mustard. These efforts aim to improve the yield, quality, disease resistance, and stress tolerance of tumorous mustard through genetic engineering methods (gene editing). The application of transgenic and gene editing technologies requires efficient and mature plant genetic transformation systems. However, current research on genetic transformation systems for tumorous mustard is limited, with most studies focusing on the stress resistance and amplification of individual genes, rather than establishing efficient genetic transformation systems. Furthermore, existing methods for inducing genetic transformation in other plant species using 6-BA (6-benzylaminopurine) and NAA (α-naphthaleneacetic acid) are not only inefficient but also difficult to induce callus and regenerate plants from some explants. Furthermore, these methods are not applicable to other plant species, such as tumorous mustard. Therefore, the study of a transformation system with a high transformation rate and an efficient genetic transformation method of tumorous mustard based on Agrobacterium-mediated method suitable for tumorous mustard not only effectively makes up for the shortcomings of the existing research on tumorous mustard genetic transformation system, but also has important significance for the rapid breeding of tumorous mustard and meeting social needs. Summary of the Invention

[0004] The present invention aims to provide a highly efficient genetic transformation method for Tuberculosis juncea mediated by Agrobacterium, so as to solve the technical problem of low transformation efficiency in existing genetic transformation methods.

[0005] To achieve the above-mentioned objectives, the present invention adopts the following technical solutions: a method for efficient genetic transformation of tumorous stem mustard based on the Agrobacterium-mediated method, comprising: (1) establishing a regeneration system, inducing tumorous stem mustard explants using a culture medium supplemented with 6-BA and NAA to obtain a tumorous stem mustard regeneration system; and (2) establishing a genetic transformation system, inducing sterile explants in an infiltration solution containing Agrobacterium, and inducing the infiltration explants using a culture medium supplemented with 6-BA, NAA, and antibiotics to obtain a tumorous stem mustard genetic transformation system.

[0006] The principles and advantages of this solution are:

[0007] 1. Compared with the low conversion rate of existing transformation systems, this scheme can significantly improve the genetic transformation efficiency of tumorous mustard by transforming the regeneration system in advance to obtain a regeneration system with a high induction rate. Then, a genetic transformation system is established based on this regeneration system. This not only reduces the waste of materials and reagents in blind experiments, but also effectively shortens the time required to establish the genetic transformation system, thereby greatly improving batch production efficiency.

[0008] 2. This approach optimizes and screens the induction of tumorous mustard explants by combining different concentrations of 6-BA (i.e., 6-benzylaminopurine) and NAA (i.e., α-naphthaleneacetic acid) during the establishment of the regeneration system. This approach results in a combination of 6-BA and NAA with higher induction rates, thereby achieving a tumorous mustard regeneration system with higher induction rates, thereby effectively improving the genetic transformation rate of tumorous mustard. 6-BA is a synthetic cytokinin and a broad-spectrum plant growth regulator. Its primary function is to promote bud formation and can also induce callus formation; NAA is also primarily used to promote plant growth. Through long-term experiments, the applicant has discovered that by adding different combined concentrations of 6-BA and NAA to the basal culture medium, a regeneration system with an induction rate of up to 86% can be obtained, thereby significantly improving the transformation rate of tumorous mustard.

[0009] 3. This proposal establishes a regeneration system and a genetic transformation system to achieve an efficient genetic transformation method suitable for tumorous mustard. The applicant's experiments have found that compared to other existing plant species (such as mustard, sugarcane, and cabbage), tumorous mustard is more sensitive to Agrobacterium and has a lower survival rate in competition with Agrobacterium. Therefore, improving the induction rate of callus tissue after Agrobacterium infection and obtaining a transformation system for tumorous mustard is a major challenge in the genetic transformation of tumorous mustard. Through long-term experiments, the applicant has found that the pre-experimental establishment of a tumorous mustard regeneration system in this proposal can effectively improve the induction success rate of the transformation system, thereby increasing the Agrobacterium-mediated tumorous mustard transformation rate (the conversion rate in this proposal is greater than 37%).

[0010] Preferably, the establishment of the regeneration system specifically includes the following steps:

[0011] S1: sowing: sterilized tuberous mustard seeds were sown in seed germination medium M1;

[0012] S2: callus induction, part of the tissue of the sown tumorous stem mustard was cut as an explant and inoculated into callus induction medium M2 to induce callus tissue;

[0013] S3: Adventitious bud induction: the callus obtained in S2 was inoculated into a new callus induction medium M2 and cultured to obtain adventitious buds;

[0014] S4: Root induction: the adventitious buds obtained in S3 were inoculated into rooting medium M3 for rooting culture to obtain regenerated seedlings;

[0015] S5: Hardening the seedlings, transplanting the regenerated seedlings into nutrient soil to obtain regenerated plants and establish a tumorous stem mustard regeneration system;

[0016] The seed germination medium M1 is 1 / 2MS medium;

[0017] The callus induction medium M2 is MS medium + 6-BA + NAA;

[0018] The rooting medium M3 is 1 / 2MS+NAA.

[0019] Beneficial effects:

[0020] 1. This program uses MS culture medium as the basic culture medium, and different reagents are added to the culture medium at different stages to form culture mediums with different functions. For example, the callus induction and adventitious bud induction stages are mainly to induce explant growth, which requires the addition of additional plant growth promoters (including a combination of 6-BA and NAA); the rooting stage is mainly to induce explant rooting, so a plant growth promoter that promotes rooting (such as NAA alone) is added; and in the sowing stage, only the basic nutrients for seed germination need to be provided, so only 1 / 2 MS culture medium is needed, which can effectively promote seed germination and save the raw materials of the culture medium and reduce waste.

[0021] 2. All culture stages in this scheme are improved on the MS basal medium. On the one hand, it effectively simplifies the culture medium configuration process during the entire genetic transformation process and improves the culture medium configuration efficiency; on the other hand, it can also effectively avoid the increase in raw material costs and waste caused by using different culture media at different stages.

[0022] Preferably, the variety of the tumorous stem mustard is Yong'an Xiaoye, and the explant is a cotyledon.

[0023] Beneficial Effects: This protocol, through induction of callus from different varieties of tumorous mustard (such as Yong'an Xiaoye and the applicant's own early-maturing variety A168, mid-maturing variety ZLxuan, and late-maturing variety 4-16), revealed genetic differences among different varieties of tumorous mustard and differences in hormone sensitivity among different tissue sites. Specifically, the highest callus induction rate, exceeding 86%, was achieved only when the cotyledons of Yong'an Xiaoye were used as explants. In contrast, callus induction from other varieties of tumorous mustard and other parts of the mustard (such as the epicotyl) resulted in callus induction rates of less than 50%, and the calli appeared milky white, making further adventitious buds ineffective.

[0024] Preferably, the added concentration of 6-BA in the M1 and M2 is 1-2 mg / L, and the added concentration of NAA is 0.05-0.15 mg / L; the added concentration of NAA in the M3 is 0.1 mg / L.

[0025] Beneficial effects: This scheme optimizes the callus induction conditions of different varieties of tumorous mustard by adding different ratios of 6-BA and NAA, thereby establishing an efficient tumorous mustard regeneration system, further facilitating the establishment of an efficient genetic transformation system for tumorous mustard, and thus achieving efficient breeding of tumorous mustard. Through long-term experiments, the applicant found that when 1-2 mg / L of 6-BA and 0.05-0.15 mg / L of NAA are added in combination, the induction rate of tumorous mustard can be effectively improved. However, when 6-BA is lower than 1 mg / L and NAA is lower than 0.05 mg / L, the induction effect is reduced due to insufficient contact between the explant and the 6-BA or NAA concentration; and when 6-BA is higher than 3 mg / L and NAA is higher than 0.15 mg / L, the induction rate of the explant decreases, which is not conducive to the establishment of an efficient genetic transformation system. Therefore, a combination of higher concentrations of 6-BA and lower concentrations of NAA is used for callus induction and adventitious bud differentiation.

[0026] Preferably, the establishment of the genetic transformation system specifically includes the following steps:

[0027] Step 1: Sowing: sterilize the mustard seeds and sow them in the seed germination medium M1;

[0028] Step 2: Infection, placing the explant in an infection solution containing Agrobacterium;

[0029] Step 3: callus induction, inoculating the infected explants into callus induction medium M2' to induce callus tissue;

[0030] Step 4: Adventitious bud induction: inoculate the above callus into a new callus induction medium M2' and continue culturing to obtain adventitious buds;

[0031] Step 5: Root induction: inoculate the above adventitious buds into rooting medium M3' for rooting culture to obtain regenerated seedlings;

[0032] Step 6: Harden the seedlings, transplant the regenerated seedlings into nutrient soil, obtain regenerated plants, and establish a genetic transformation system for tumorous stem mustard.

[0033] The callus induction medium M2' is MS medium + 6-BA + NAA + antibiotics;

[0034] The rooting medium M3' is 1 / 2MS+NAA+antibiotics.

[0035] Beneficial Effects: Because the surface of induced callus is uneven, inoculation after callus induction makes it difficult to kill residual Agrobacterium, hindering callus growth. This protocol, by inoculating the explants before callus induction, not only effectively improves the transformation success rate but also effectively avoids Agrobacterium growth and callus waste caused by inoculation after successful callus induction.

[0036] Preferably, the impregnation solution is a 30% sterile sucrose solution used to resuspend Agrobacterium containing the p130035S-BjuSPL10c-GFP vector.

[0037] Beneficial effects: This scheme specifically uses Agrobacterium containing the p130035S-BjuSPL10c-GFP vector to infect the explants of Brassica juncea, and after infiltration, it is selectively cultured using a culture medium containing antibiotics to effectively eliminate the growth of callus tissue without genetically modified components, thereby increasing the positive rate of regenerated plants.

[0038] Preferably, the immersion is to place the explant in an immersion solution with an OD600 value of 0.05 for 10 minutes.

[0039] Beneficial Effects: By infecting explants in an impregnation solution with a low Agrobacterium concentration, this protocol improves transformation efficiency while reducing the amount of Agrobacterium required, thereby reducing explant death caused by residual Agrobacterium growth during subsequent induction. Furthermore, the applicants have found that prolonged infiltration or excessively high concentrations of the impregnation solution can easily lead to explant death and reduce the induction rate. Through long-term experiments, the inventors have found that when the OD600 value of the impregnation solution is 0.05 and the infiltration time is 10 minutes, the induction success rate of tumorous stem mustard explants reaches 84%, and the probability of vector transformation into the explants reaches 37%, significantly improving the genetic transformation rate of tumorous stem mustard.

[0040] Preferably, the infection further includes co-cultivation, wherein the co-cultivation is to absorb excess Agrobacterium on the surface of the cotyledons using sterile filter paper and then place the agrobacterium in a co-culture medium M4 for dark cultivation for 2 days; the M4 is MS+6-BA+NAA.

[0041] Beneficial effects: This solution facilitates Agrobacterium infection of the interior of the explant by co-culturing the infected explant for 2 days; the applicant's experiments found that too long a co-culturing time would lead to the death of the explant caused by the subsequent growth of residual Agrobacterium, while too short a co-culturing time would result in too low a transformation efficiency.

[0042] Preferably, the antibiotics in M2' and M3' are a combination of hygromycin and timentin.

[0043] Beneficial effects: This protocol uses the antibiotic timentin to effectively kill excessive Agrobacterium, preventing the rapid growth of Agrobacterium that may lead to the death of explants during induction. The addition of hygromycin for screening can effectively inhibit the growth of callus tissue without transgenic components.

[0044] Preferably, the M2' is MS + 2 mg / L 6-BA + 0.15 mg / L NAA + 20 mg / L hygromycin + 500 mg / L timentin + 0.8% agar; the M3' is 1 / 2MS + 0.1 mg / L NAA + 20 mg / L hygromycin + 500 mg / L timentin + 0.8% agar; and the M4 is MS + 2 mg / L 6-BA + 0.15 mg / L NAA + 0.8% agar.

[0045] Beneficial effects: Through long-term experiments, the inventors found that when 2 mg / L 6-BA and 0.15 mg / L NAA were added in combination, the callus induction rate of the tumorous stem mustard explants was higher, even as high as 84%; and the combined addition of 20 mg / L hygromycin + 500 mg / L timentin could effectively prevent Agrobacterium from affecting the induction process of the tumorous stem mustard explants and inhibit the growth of non-transgenic callus. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Schematic diagram of screening of tumor-bearing mustard p130035S-BjuSPL10c-GFP overexpressing plants in an embodiment of the present invention (in the figure: a, after Agrobacterium infection, the plants were transferred to screening medium and cultured for 7 days; b, cultured on callus induction medium for 15 days; c, cultured on callus induction medium for 20 days; d, cultured on adventitious bud differentiation medium for 10 days; e, cultured on adventitious bud differentiation medium for 20 days; f, cultured on rooting medium for 10 days; g, tumor-bearing mustard p130035S-BjuSPL10c-GFP overexpressing plants were transferred to nutrient soil and cultured for 10 days; h, tumor-bearing mustard p130035S-BjuSPL10c-GFP overexpressing plants were transferred to nutrient soil and cultured for 50 days).

[0047] Figure 2 a is a comparison of GFP conversion effects in the transgenic seedlings obtained in Example 7 of the present invention (in the figure, W1 to W6 are wild-type Brassica juncea, 1 to 65 are transgenic seedlings, and M is a marker).

[0048] Figure 2 b is a schematic diagram comparing the mRNA expression levels of BjuSPL10c in transgenic seedlings No. 1, 6, 8 and 12 obtained in Example 7 of the present invention (in the figure, WT is the wild-type plant, OX1, OX6, OX8 and OX12 are schematic diagrams comparing the mRNA expression levels of BjuSPL10c in transgenic seedlings No. 1, 6, 8 and 12, respectively). DETAILED DESCRIPTION

[0049] The following is further described in detail by means of specific embodiments, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art; the experimental methods used are all conventional methods; and the materials and reagents used are all commercially available.

[0050] The sources of the strains and tumorous mustard varieties used in this solution are:

[0051] biological strains source Agrobacterium GV310 Solebao Purchase Yongan Xiaoye Project team preservation A168 Project team preservation ZL selection Project team preservation 4-16 Project team preservation

[0052] This embodiment is basically as Figure 1 The invention discloses a method for efficiently genetically transforming tumorous mustard by Agrobacterium-mediated method, comprising: (1) establishing a regeneration system, inducing tumorous mustard explants using a culture medium supplemented with 6-BA and NAA to obtain a tumorous mustard regeneration system; and (2) establishing a genetic transformation system, infecting sterile explants of the regeneration system in an infiltration solution containing Agrobacterium, and inducing the infiltration explants using a culture medium supplemented with 6-BA, NAA and antibiotics to obtain a tumorous mustard genetic transformation system.

[0053] Example 1

[0054] A method for efficient genetic transformation of tumorous stem mustard based on Agrobacterium-mediated method comprises (1) establishing a regeneration system, specifically comprising the following steps:

[0055] S1: Sowing: sterilized Brassica juncea seeds were sown in seed germination medium M1 (in this protocol, M1 is 1 / 2 MS medium);

[0056] S2: Callus induction: Part of the tissue (specifically, the cotyledon) of the sown tumorous mustard plant was excised as an explant and inoculated into callus induction medium M2 (in this protocol, M2 is MS medium + 6-BA + NAA + 0.8% agar) supplemented with 1-2 mg / L 6-BA and 0.05-0.15 mg / L NAA to induce callus tissue;

[0057] S3: Adventitious bud induction: the callus obtained in S2 was inoculated into a new callus induction medium M2 and cultured to obtain adventitious buds;

[0058] S4: Root induction: The adventitious buds obtained in S3 were inoculated into rooting medium M3 (M3 in this protocol is 1 / 2 MS + 6-BA + NAA + 0.8% agar) supplemented with 0.1 mg / L NAA for rooting culture to obtain regenerated seedlings;

[0059] S5: Hardening the seedlings, transplanting the regenerated seedlings into nutrient soil to obtain regenerated plants and establish a tumor-bearing mustard regeneration system.

[0060] This scheme also includes Examples 2 to 6 and Comparative Examples 1 to 3; the difference between Examples 2 to 6 and Example 1 is that parameter combinations within the protection range of this scheme are used to demonstrate the process of establishing the tumorous mustard regeneration system; the difference between Comparative Examples 1 to 3 and Example 1 is that parameter combinations outside the protection range of this scheme are used to demonstrate the process of establishing the tumorous mustard regeneration system; in each Example and Comparative Example, 250 tumorous mustard plants (divided into 5 groups, 50 plants each) were repeatedly cultured to calculate the induction rate; the parameter differences and induction rate results during the establishment of the regeneration system in Examples 1 to 6 and Comparative Examples 1 to 3 are detailed in Table 1.

[0061] Table 1 Parameter differences and induction rates during the establishment of the regeneration system in Examples 1 to 6 and Comparative Examples 1 to 3

[0062]

[0063] Experimental data showed that callus induction was performed using cotyledons and epicotyls of different stem mustard varieties, including A168, ZL Select, 4-16, and Yong'an Xiaoye, as explants, with varying concentrations of 6-BA and NAA. The results showed that when 6-BA concentrations were 2.0 mg / L and NAA concentrations were 0.15 mg / L, the highest callus induction rate in Yong'an Xiaoye was 86%, while the highest induction rate in the epicotyl was only 14% (see Table 1). The highest callus induction rates in the cotyledons of A168, ZL Select, and 4-16 were 34%, 22%, and 0%, respectively, while the highest callus induction rates in the epicotyls were 10%, 20%, and 4%, respectively. In summary, the callus induction rate was the highest when the leaves of Yong'an small leaves of stem mustard were used as explants and placed in callus induction medium (MS+2mg / L 6-BA+0.15mg / L NAA), and each callus could differentiate into 3 to 4 adventitious buds, significantly improving the induction success rate of the regeneration system.

[0064] Example 7

[0065] A method for efficient genetic transformation of tumorous stem mustard based on Agrobacterium-mediated method, comprising (2) establishing a genetic transformation system, specifically comprising the following steps:

[0066] Step 1: Sowing: sterilize the stem mustard Yongan small leaf seeds and sow them in the seed germination medium M1 (in this scheme, M1 is 1 / 2 MS medium);

[0067] Step 2: Infection: The infiltration solution is 30% sterile sucrose solution to resuspend Agrobacterium GV3101 containing the p130035S-BjuSPL10c-GFP vector (this vector specifically contains the BjuSPL10c gene, which has the function of regulating plant bolting and flowering) until the solution OD600 value is 0.05; the leaves of Yong'an small leaves obtained by sowing are cut as explants and placed in the infiltration solution for 10 minutes.

[0068] Step 3: Co-cultivation: After absorbing the excess bacterial liquid from the cotyledons with sterile filter paper, the cotyledons were placed in the co-culture medium M4 (M4 in this scheme is MS + 6-BA + NAA, specifically MS + 2 mg / L 6-BA + 0.15 mg / L NAA + 0.8% agar in this embodiment) and cultured in the dark for 2 days.

[0069] Step 4: Callus induction: The co-cultured explants were inoculated into callus induction medium M2' (M2' in this protocol is MS medium + 6-BA + NAA + antibiotics, and in this embodiment, M2' is specifically MS + 2 mg / L 6-BA + 0.15 mg / L NAA + 20 mg / L hygromycin + 500 mg / L timentin + 0.8% agar) supplemented with 2 mg / L 6-BA and 0.15 mg / L NAA to induce callus tissue;

[0070] Step 5: Adventitious bud induction: inoculate the above callus into a new callus induction medium M2' and continue culturing to obtain adventitious buds;

[0071] Step 6: Root induction: The adventitious buds were inoculated into a rooting medium M3' (M3' in this protocol is 1 / 2 MS + NAA + antibiotics, and in this embodiment, M3' is specifically MS + 0.1 mg / L NAA + 20 mg / L hygromycin + 500 mg / L timentin + 0.8% agar) supplemented with 0.1 mg / L NAA for rooting culture to obtain regenerated plantlets;

[0072] Step 7: Harden the seedlings, transplant the regenerated seedlings into nutrient soil to obtain transgenic plants, establish a genetic transformation system for tumorous stem mustard, and use qRT-PCR to detect and screen positive transgenic seedlings.

[0073] This scheme also includes comparative examples 4 to 6; the difference between comparative examples 4 to 6 and Example 7 is that the parameter combination outside the protection range of this scheme is used to demonstrate the process of establishing the genetic transformation system of tumorous stem mustard; wherein, in each example and comparative example, 250 tumorous stem mustard explants (divided into 5 groups, 50 plants in each group) are repeatedly cultured to calculate the induction rate; the parameter differences and induction rate results during the establishment of the regeneration system in Example 7 and comparative examples 4 to 6 are detailed in Tables 2 and Figure 1 .

[0074] Table 2 Parameter differences and induction rates during the establishment of the regeneration system in Example 7 and Comparative Examples 4 to 6

[0075] Example OD value of infection fluid Infection time / min Induction rate Example 7 0.05 10 88.1％ Comparative Example 4 0.01 10 24.2％ Comparative Example 5 0.05 5 26.4％ Comparative Example 6 0.05 15 16.3％

[0076] Experimental data showed that the optimal infection concentration for this protocol was an OD600 value of 0.05 and an infection time of 10 minutes. When these conditions were applied to Yong'an Xiaoye leaves of the tumorous mustard plant, the induction success rate of the explants reached 88%, significantly improving the survival rate of the induced callus. However, infection concentrations and times above or below these parameters reduced the induction rate. For example, in Comparative Examples 4-6, the calli induced from some cotyledons appeared light yellow. After continued culture, the calli became encrusted with Agrobacterium, leading to their gradual death.

[0077] Experimental Example 1: Genomic level of p130035S-BjuSPL10c-GFP overexpressing plants in the Tuber Brassica juncea genetic transformation system

[0078] 65 transgenic seedlings (genetically transformed Brassica juncea p130035S-BjuSPL10c-GFP overexpressing plants) from Example 7 were randomly selected, and gDNA (genomic DNA) was extracted from the plants. Primers (1300-GFP-F: ATGGTGAGCAAGGGCGAGGAG, 1300-GFP-R: CTTGTACAGCTCGTCCATGC) were designed using GFP as a template. The extracted gDNA was used as a template to amplify wild-type Brassica juncea (W1-W6) and the selected Brassica juncea transgenic seedlings (1-65). The amplification results were run on a gel. The run results are detailed in [ 0 ]. Figure 2 .

[0079] The experimental results showed that GFP bands were detected in 24 of the 65 randomly selected transgenic seedlings ( Figure 2 The conversion rate was 37%.

[0080] Continue to run the gel results of transgenic seedlings 1, 6, 8 and 12 (corresponding to Figure 2 The cDNA synthesized by reverse transcription of RNA extracted from OX1, OX6, OX8 and OX12 in a was used as a template to detect the mRNA expression level of BjuSPL10c in transgenic plants (primers: dBjuSPL10c-F: ATGGACTGCAACATGGTATC, dBjuSPL10c-R: GTTTCTACCCCAAGTCTCTTC). The results are shown in Figure 5. Figure 2 As shown in b.

[0081] Results showed that mRNA expression in OX1 was upregulated by more than 2-fold, in OX6 by more than 7-fold, in OX8 by more than 4-fold, and in OX12 by more than 3-fold. Therefore, the p130035S-BjuSPL10c-GFP overexpressing plants in the tumorous mustard genetic transformation system established in this protocol significantly increased BjuSPL10c mRNA expression, providing a basis for validating the function of BjuSPL10c in regulating bolting and flowering in tumorous mustard.

[0082] The above is only an embodiment of the present invention, and the common knowledge such as the specific technical solutions and / or characteristics in the solution are not described in detail here. It should be pointed out that for those skilled in the art, without departing from the technical solution of the present invention, several variations and improvements can be made, which should also be regarded as the scope of protection of the present invention, and these will not affect the effect of the implementation of the present invention and the practicality of the patent. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the description can be used to interpret the content of the claims.

Claims

1. A method for efficient genetic transformation of Tuber Mustard L. based on Agrobacterium-mediated transformation, characterized by: The method comprises: (1) establishing a regeneration system, inducing a tumorous mustard explant using a culture medium supplemented with 6-BA and NAA to obtain a tumorous mustard regeneration system; (2) establishing a genetic transformation system, infecting a sterile explant in an infiltration solution containing Agrobacterium, and inducing the infiltration explant using a culture medium supplemented with 6-BA, NAA and antibiotics to obtain a tumorous mustard genetic transformation system; The genetic transformation system is established, comprising the following steps: Step 1: Sowing: sterilize the mustard seeds and sow them in the seed germination medium M1; Step 2: Infection: Place the explant in an infiltration solution containing Agrobacterium; the infiltration solution is a 30% sterile sucrose solution containing p130035S-BjuSPL10c-GFP Agrobacterium tumefaciens carrier, The explants were inoculated at an OD600 value of 0.

05. Dyeing in the dyeing solution for 10 min ; Step 3: Callus induction: Part of the tissue obtained from the sowing of the tumorous stem mustard was excised as an explant and inoculated into callus induction medium M2' to induce callus; the M2' medium was MS + 2 mg / L 6-BA + 0.15 mg / L NAA + 20 mg / L hygromycin + 500 mg / L timentin + 0.8% agar; Step 4: Adventitious bud induction: inoculate the above callus into a new callus induction medium M2' and continue culturing to obtain adventitious buds; Step 5: Root induction: The adventitious buds were inoculated into rooting medium M3' for rooting culture to obtain regenerated seedlings; the M3' was 1 / 2 MS + 0.1 mg / L NAA + 20 mg / L hygromycin + 500 mg / L timentin + 0.8% agar; Step 6: Harden the seedlings, transplant the regenerated seedlings into nutrient soil, obtain regenerated plants, and establish a genetic transformation system for tumorous stem mustard.

2. The method for efficient genetic transformation of Tuber Mustard L. based on Agrobacterium-mediated method according to claim 1, characterized in that: The establishment of the regeneration system specifically includes the following steps: S1: sowing: sterilized tuberous mustard seeds were sown in seed germination medium M1; S2: callus induction, part of the tissue of the sown tumorous stem mustard was cut as an explant and inoculated into callus induction medium M2 to induce callus tissue; S3: Adventitious bud induction: the callus obtained in S2 was inoculated into a new callus induction medium M2 and cultured to obtain adventitious buds; S4: Root induction: the adventitious buds obtained in S3 were inoculated into rooting medium M3 for rooting culture to obtain regenerated seedlings; S5: Hardening the seedlings, transplanting the regenerated seedlings into nutrient soil to obtain regenerated plants and establish a tumorous stem mustard regeneration system; The seed germination medium M1 is 1 / 2 MS medium; The callus induction medium M2 is MS medium + 6-BA + NAA; The rooting medium M3 is 1 / 2 MS+NAA.

3. The method for efficient genetic transformation of Tuberculosis juncea based on Agrobacterium-mediated method according to claim 2, characterized in that: The variety of the tumorous stem mustard is Yong'an Xiaoye, and the explant is a cotyledon.

4. The method for efficient genetic transformation of Tuber mustard seedlings based on Agrobacterium-mediated transformation according to claim 3, characterized in that: The added concentration of 6-BA in the M1 and M2 is 1-2 mg / L, and the added concentration of NAA is 0.05-0.15 mg / L; the added concentration of NAA in the M3 is 0.1 mg / L.

5. The method for efficient genetic transformation of Tuber Mustard seeds based on Agrobacterium-mediated method according to claim 4, characterized in that: After the infection, co-cultivation is further performed. The co-cultivation is performed by absorbing excess Agrobacterium on the surface of the cotyledons with sterile filter paper and then placing the co-culture medium M4 in dark culture for 2 days; the M4 is MS+6-BA+NAA.

6. The method for efficient genetic transformation of Tuber juncea based on Agrobacterium-mediated method according to claim 5, characterized in that: The M4 is MS+2 mg / L 6-BA+0.15 mg / L NAA+0.8% agar.

Images