Cytochrome p450 genes associated with cucurbitadienol hydroxylation and their encoded products

Abstract

The present application relates to a cytochrome P450 gene and its encoding product related to cucurbitadienol hydroxylation, and belongs to the field of genetic engineering. The nucleotides of the gene are shown in SEQ ID NO: 1-5. The present application also provides an encoding protein related to the gene, a vector, an engineering bacterium and application.

Description

TECHNICAL FIELD

[0001] The present application relates to a cytochrome P450 gene related to cucurbitadienol hydroxylation and its encoding product, and belongs to the field of genetic engineering. BACKGROUND

[0002] Cucurbitadienol (Cuol) is a biosynthetic precursor of cucurbitacins, and cucurbitacin synthase (CBS) can promote its biosynthesis. Cucurbitacins are a class of highly oxidized tetracyclic triterpenoids, and Cuol skeleton introduces different position oxygenated groups. At present, the research on CYP450 hydroxylation gene mainly focuses on its characteristics and functions. In most cases, the triterpene skeleton catalyzed by OSC is catalyzed by cytochrome P450 (CYP) to introduce hydroxyl, carboxyl or epoxy group for specific site oxidation modification, thereby producing a variety of triterpenoids. Compared with dammarane saponins, oleanane saponins and other triterpenoids, cucurbitacins are a class of highly oxidized triterpenoids. The chemical diversity among cucurbitacins is generated by oxygenated groups located at different positions. For example, hydroxylation occurs at C-2, C-3, C-7, C-9, C-16 (α-OH), C-19, C-20 (β-OH), C-21, C-24 and C-25; the unsaturated double bond occurs between C-1 / C-10, C-1 / C-2, C-23 / C-24 and C-24 / C-25; and the ketone group occurs at C-2, C-3, C-11, C-15 and C-22. The diverse hydroxylation modification is one of the characteristics of cucurbitacin molecular structure, and is also the difficulty in analyzing the biosynthetic pathway. The multi-site hydroxylation of cucurbitacins indicates that multiple CYP family members are involved in the oxidation modification of Cuol precursor, and the discovery of the corresponding site CYP gene is one of the research hotspots for analyzing cucurbitacin biosynthesis.

[0003] So far, several P450s involved in cucurbitacin biosynthesis have been discovered in the laboratory, including CYP81Q59, CYP87D20, CYP88L2, CYP81Q58, which are responsible for the hydroxylation of cucurbitane skeleton, C2 hydroxylase of cucurbitadienol (Cuol), C11 carbonylase and C20 hydroxylase, C19 hydroxylase and C25 hydroxylase, respectively. A recent study reported that CYP81AQ19 in Momordica charantia can catalyze the C23α hydroxylation of cucurbitadienol (Cuol), and C23-OH can isomerize to C25-OH with double bond migration after acid treatment; CYP88L8 catalyzes the C7β hydroxylation of Cuol, and CYP88L7 catalyzes the C19 hydroxylation and forms an ether bond between C5 and C19. In Siraitia grosvenorii, CYP87D18 encodes C11 hydroxylation, which catalyzes the two-step oxidation reaction at C11, i.e. Cuol produces 11-hydroxy-Cuol and 11-carbonyl-Cuol. Although the molecular mechanism of catalyzing the hydroxylation of cucurbitacin sites (C-2, C-3, C-19, C-20β-OH, C-25) and the synthesis of C-11 ketone has been elucidated, so far the complete cucurbitacin pathway is still unclear.

[0004] Compared with cucurbitacins, sweet cucurbitacins mogrosides have a more extensive market application prospect. Sugar intake or sweetness is the most basic taste requirement for human beings (Castro DC, Berridge KC (2014) Opioid hedonic hotspot in nucleus accumbens shell: Mu, delta, and kappa maps for enhancement of sweetness“liking”and“wanting.” J Neurosci 34(12):4239-4250.), however, in order to meet this desire, the consumption of sugar has increased exponentially since nearly 250 years ago, and studies have shown that the consumption of sugar is associated with the development of obesity, diabetes, metabolic syndrome and cardiovascular disease (Bray GA, Popkin BM (2014) Dietary sugar and body weight: Have we reached a crisis in the epidemic of obesity and diabetes?: Health be damned! Pour on the sugar. Diabetes Care 37(4):950-956.), non-calorie artificial sweeteners provide hope for reducing calories, although it is generally accepted that many of these products can be safely consumed (Kroger M, Meister K, Kava R (2006) Low-calorie sweeteners and other sugar substitutes: A review of the safety issues. Compr Rev Food Sci Food Saf 5(2):35-47.), but recent studies have shown that the impact of synthetic sweeteners on the gut microbiota can lead to metabolic syndrome and glucose intolerance (Suez J, et al. (2014) Artificial sweeteners induce glucose intolerance by altering the gut microbiota. Nature 514(7521): 181-186. / Pepino MY (2015) Metabolic effects of non-nutritive sweeteners. Physiol Behav 152(Part B):450-455.). Given the problems associated with natural sugars and synthetic non-calorie sweeteners, there is great interest in developing alternative natural non-sugar sweeteners to meet the human “demand” for sweet foods.Natural compounds with strong sweet potency belong to many chemical families, including proteins, flavonoids, and terpenoids (Kim N-C, Kinghorn AD (2002) Highly sweet compounds of plant origin. Arch Pharm Res 25(6):725-746.). First discovered and classified in China in the 1930s as a natural sweetener (Swingle WT (1941) Momordica grosvenori sp. nov. The source of the Chinese Lo Han Kuo. J Arnold Arbor 22:197-203.), the triterpene glycoside mogroside V, which is 250 times sweeter than sucrose, and is derived from the ripe fruits of Siraitia siamensis (chi-zi luo-han-guo), a Chinese folk medicine (Kasai R, et al. (1989) Sweet cucurbitane glycosides from fruits of Siraitia siamensis (chi-zi luo-han-guo), a Chinese folk medicine. Agric Biol Chem 53(12):3347-3349.), is the only pure natural sweetener that can reduce fat (Zhang XB, Song YF, Ding YP, et al. Effects of mogrosides on high-fat-diet-induced obesity and nonalcoholic fatty liver disease in mice. Molecules, 2018, 23(8): 1894.). Mogrosides are derived from cucurbitane-type skeletons of triterpenoids that are widely present in Cucurbitaceae plants, and are one of hundreds of cyclic triterpenoid skeletons (Xu R, Fazio GC, Matsuda SP (2004) On the origins of triterpenoid skeletal diversity. Phytochemistry 65(3):261-291. / Thimmappa R, Geisler K, Louveau T, O'Maille P, Osbourn A (2014) Triterpene bio-synthesis in plants. Annu Rev Plant Biol 65:225-257.). The novelty of mogrosides, compared to bitter cucurbitacins, is its specific oxidation at C3, C11, C24, and C25 to form tetrahydroxylated mogrol, followed by glycosylation at C3, C24.Hydroxylation of triterpenoids at the C3 position is ubiquitous as it is inherent to the cyclization of squalene monooxygenase substrates, and hydroxylation of triterpenoids at the C11 position is fairly common. Hydroxylation of C24 and C25 in cucurbitane is rare and only a few cases have been reported in Cucurbitaceae (Chen JC, Chiu MH, Nie RL, Cordell GA, Qiu SX (2005) Cucurbitacins and cucurbitane glycosides: Structures and biological activities. Nat Prod Rep 22(3):386-399.).

[0005] Previous studies have reported that mogrol is formed from squalene by sequential catalysis by squalene epoxidase to form 2,3 epoxy squalene, 2,3;22,23-epoxy squalene, and then 24,25-epoxy cucurbitadienol under the catalysis of cucurbitadienol synthase (Itkin M, Davidovich-Rikanati R, Cohen S, et al. The biosynthetic pathway of the nonsugar, high-intensity sweetener mogroside V from Siraitia grosvenorii. Proc Natl Acad Sci U S A 2016, 113(19): E7619-E7628.), which is then hydroxylated at the C11 position by CYP87 family member CYP87D18 in the cytochrome P450 enzyme (CYP450) system to form mogrol (Zhang JS, Dai LH, Yang JG, et al. Oxidation of cucurbitadienol catalyzed by CYP87D18 in the biosynthesis of mogrosides from Siraitia grosvenorii. Plant Cell Physiol, 2016, 57(5): 1000-1007.).

[0006] However, unlike this study, we found in the Chinese medicinal material Hemsleya chinensis that CYP69 can catalyze the hydroxylation reaction of cucurbitadienol at the C24,25 position of the cucurbitacin skeleton, and the hydroxyl configuration at the C24 position has α and β two types. We have carried out nuclear magnetic detection on 24α,25-OH-epoxy cucurbitadienol, which has a relatively high product yield, to determine its structure. This result shows that we can form mogrol from cucurbitadienol by CYP69 and CYP87D18 catalysis, and then form mogroside V under the catalysis of UGT. SUMMARY

[0007] The first aspect of the present application provides a class of cytochrome P450 genes related to cucurbitadienol hydroxylation: HcCYP69, HcCYP101, HcCYP148, HcCYP150 and HcCYP155; the nucleotides of which are shown in SEQ ID NO: 1-5, respectively.

[0008] The second aspect of the present application provides proteins encoded by the genes, wherein:

[0009] The amino acid sequence of the protein encoded by the HcCYP69 gene is shown in SEQ ID NO: 6; the amino acid sequence of the protein encoded by the HcCYP101 gene is shown in SEQ ID NO: 7; the amino acid sequence of the protein encoded by the HcCYP148 gene is shown in SEQ ID NO: 8; the amino acid sequence of the protein encoded by the HcCYP150 gene is shown in SEQ ID NO: 9; and the amino acid sequence of the protein encoded by the HcCYP155 gene is shown in SEQ ID NO: 10.

[0010] In one embodiment, the cucurbitadienol hydroxylation refers to: a) hydroxylation of cucurbitadienol at C24 position, and / or b) hydroxylation of cucurbitadienol at C25 position.

[0011] The third aspect of the present application provides an expression vector containing the genes.

[0012] In one embodiment, the expression vector is obtained by connecting one or more of the genes to the Y33 vector.

[0013] The fourth aspect of the present application provides an engineered microbial strain, which is a yeast containing the expression vector.

[0014] The fifth aspect of the present application provides a method for hydroxylation of cucurbitadienol by biological catalysis, which is achieved by the yeast.

[0015] The sixth aspect of the present application provides the use of the genes or the proteins in regulating and producing plant triterpenoids, which is to hydroxylate cucurbitadienol at C24 position and / or C25 position.

[0016] The present application screens a class of key genes involved in cucurbitadienol hydroxylation from Hemsleya chinensis, and functional proteins encoded by the genes. Yeast in vitro functional verification shows that the genes have P450 hydroxylase function, and can catalyze cucurbitadienol to 24,25-dihydroxy-cucurbitadienol. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1Comparison of transcriptomic analysis of new CYP450 enzymes: A is a heat map of the expression of 251 CYP450 genes in different tissues; B is a block high expression of two modules of genes and backfill genomic sequence similarity analysis;

[0018] Figure 2 PCR electrophoresis map of HcCYP69, HcCYP101, HcCYP148, HcCYP150 and HcCYP155 after yeast recombination;

[0019] Figure 3 GC-MS spectrum of HcCYP69 fermentation product;

[0020] Figure 4 NMR spectrum of 24,25-dihydroxy-friedelinol;

[0021] Figure 5 Schematic diagram of hydroxylation at C24 and C25 positions of friedelinol;

[0022] Figure 6 TLC detection results of HcCYP69 fermentation product. DETAILED DESCRIPTION

[0023] The application can be further understood by the following examples, which demonstrate some of the preparation and use methods. It will be understood, however, that these examples do not limit the application. Presently known or further developed variations of the application are considered to fall within the scope of the application described herein and claimed below.

[0024] Example 1 Functional screening of cytochrome P450 genes in Hemsleya chinensis

[0025] 1. Materials and methods

[0026] 1.1 Test materials

[0027] The test material used in this test is the tuber of Hemsleya chinensis Cogn prepared in the laboratory in the early stage. According to the requirements of transcriptomics and content determination, the sample was taken and tested. In order to avoid test errors and improve test accuracy, three repeated tests should be carried out.

[0028] 1.2 Test instruments

[0029] Table 1 Test instruments

[0030]

[0031] 1.3 Test reagents

[0032] The test reagents are shown in Tables 2 and 3.

[0033] Reagents used in the test

[0034]

[0035]

[0036] Table 3 Enzymes, Competence and Kits

[0037] 1.4 Test Solvent Preparation

[0038] Table 4 Solution Preparation

[0039]

[0040] 1.5 Test Media Preparation

[0041] YPAD liquid / solid media was prepared as shown in the table below (Table 5):

[0042] Table 5 YPAD Media Preparation

[0043]

[0044] LB solid / liquid media was prepared as shown in the table below (Table 6):

[0045] Table 6 LB Media (Resistance) Preparation

[0046]

[0047] Complete Minimal Dropout (SC) liquid / solid media was prepared as shown in the table below (Table 7):

[0048] Table 7 Complete Minimal Dropout (SC) Liquid / Solid Media

[0049]

[0050] (Liquid pH = 5.6, Solid pH = 6.5, Sterilization conditions: 121 °C for 21 min)

[0051] Dropout powder composition was prepared as shown in the table below (Table 8):

[0052] Table 8 Dropout Powder Composition

[0053]

[0054] 2. Test Method

[0055] 2.1 Extraction of RNA from H. cum -binghamii and synthesis of cDNA

[0056] The fresh H. cum -binghamii sample was rapidly frozen by liquid nitrogen freezing method. The extraction process of RNA from H. cum -binghamii mainly followed the operation process of the RNA extraction kit. After reverse transcription of RNA, it became cDNA, which was then stored in a -20°C refrigerator.

[0057] 2.2 Gene amplification and recovery

[0058] The gene fragment to be amplified in the experiment was found in the open reading frame (ORF) of the candidate gene HcCYP450, and the cDNA prepared in “2.3.1” was used. First, the open reading frame of the candidate gene HcCYP450 was found using the NCBI online software (https: / / www.ncbi.nlm.nih.gov / orffinder / ), and then the primer design software (CE Design) v1.04 was used to design the primers for the homologous arms of the genes in this experiment (homologous arms on the yeast expression vector Y33), and then Q5 high-fidelity DNA polymerase (NEB: m0491) was used for gene amplification. The primer information for amplifying the gene is shown in the following table (Table 11).

[0059] The 2xTaq Master Mix produced by Nanjing Novogene Bioinformatics Technology Co., Ltd. was used to configure the total gene PCR reaction system of 25 μL. The PCR amplification reaction system is shown in the following table (Table 9):

[0060] Table 9 PCR amplification reaction system

[0061]

[0062] After the PCR reaction system was configured, the PCR instrument was used for amplification, and the PCR reaction program is shown in the following table (Table 10):

[0063] Table 10 PCR reaction program

[0064]

[0065] After the PCR program was completely stopped, the gel imaging system and ultraviolet lamp were used to detect the target gene band to confirm whether the target gene amplification was successful, and the target gene band was recovered after confirmation of success. The EasyPure rapid detection kit produced by Beijing Quanshi Gold Biotechnology Co., Ltd. was used to recover the target gene fragment. After the gene recovery was completed, the recovery concentration was detected on the NanoReady (UV-VET) ultraviolet-visible spectrophotometer, and then stored in a -20°C refrigerator for standby.

[0066] Table 11 Homologous arm primers of candidate genes

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073] Note: ttggtaccgagctcggatcc is the Y33 homologous arm of the F end of the target gene; cactggcggccgttactagt is the Y33 homologous arm of the R end of the target gene.

[0074] 2.3 Construction and identification of gene recombination vector

[0075] 2.3.1 Vector recombination

[0076] (1) Linearization of the vector. Y33 linearized vector was obtained by single enzyme digestion with BhmI enzyme, and was recovered according to the procedure of the reagent kit EasyPure Quick Gel Extraction Kit. After recovery, the vector concentration was detected to determine whether it could be used, and then stored in a -20°C refrigerator for standby use.

[0077] (2) Candidate gene recombination. The enzyme used for homologous gene recombination was II. Based on the concentration of gene fragments and vectors, the ratio of each component was calculated through recombination instructions, and was carried out in the recombination reaction system. The candidate gene recombination reaction system is shown in the following table (Table 12):

[0078] Table 12 Candidate gene recombination reaction system

[0079]

[0080] Wherein, X is 0.02 multiplied by the number of Y33 base pairs (ng) and then compared with the concentration of linearized Y33 (ng / μL); Y is 0.02 multiplied by the number of Y33 base pairs (ng) and then compared with the UGT recovery concentration (ng / μL).

[0081] (3) The detailed recombination steps of the candidate gene are shown in the following table (Table 13):

[0082] Table 13 Candidate gene recombination steps

[0083]

[0084]

[0085] 2.3.2 Recombination bacteria water PCR reaction detection

[0086] (1) Recombination bacterial colony selection. In the Ultra-clean workbench, prepare enough PCR tubes, add 20 uL of ddH2O to the PCR test tube, and then use a 10 uL pipette to randomly pick out 4 single strains from the culture dish, with each strain corresponding to a PCR tube. Repeat blowing and sucking the strain and ddH2O to mix them evenly.

[0087] (2) Establish a bacterial water PCR reaction detection system. This detection system uses 2x Taq Master Mix produced by Nanjing Nuowezan Biotechnology Co., Ltd. The detection system is 25 uL, as shown in the following table (Table 14):

[0088] Table 14 Bacterial water PCR detection reaction system

[0089]

[0090] Among them, the detection primer is designed using software (SnapGene), and the detection primer F: Y33PCR-PGK1-F and primer R: Y33PCR-CYC1-R.

[0091] After the bacterial water PCR reaction system is configured, use the PCR instrument for amplification, and the bacterial water PCR reaction program is shown in the following table (Table 15):

[0092] Table 15 Bacterial water PCR reaction program

[0093]

[0094]

[0095] After the bacterial water PCR reaction program is finished, the PCR product is detected by gel electrophoresis to be about 1500 bp, and if it is similar to the control band size, it means that the colony is a true positive and the homologous gene recombination is successful.

[0096] (3) PCR stock solution sequencing. The PCR stock solution of the true positive bacteria liquid is sent for sequencing, and at the same time, the remaining bacteria liquid when the bacterial water PCR detection system is configured is all added to 5 mL of LAB liquid medium. After 24 h of culture in a 37°C incubator, the bacteria are preserved and the plasmid is extracted.

[0097] (4) Bacterial liquid preservation. Prepare 50% glycerol in advance, and mix the glycerol and each of the bacterial liquids in (3) above at a ratio of 1:1 to obtain a uniform mixture, and then store the mixture in a -80°C ultra-low temperature refrigerator.

[0098] 2.3.3 Extraction of recombinant plasmid

[0099] The bacterial liquid used in the extraction of the recombinant plasmid was the bacterial liquid that had been cultured in a 37°C shaker for 24 hours in 2.3.3.2 PCR detection (3), and was extracted according to the instructions in GenStar, Shenzhen, China. After extraction, the concentration of the extracted substance was determined using a NanoReady UV-UV spectrometer, and the substance was stored in a -20°C refrigerator.

[0100] 2.4 Yeast transformation of recombinant plasmid

[0101] 2.4.1 Preparation of competent cells

[0102] The substrate Cuol (cucurbitadienol) required for this experiment, Cuol01 (engineered yeast cells), was prepared in the early stage.

[0103] The engineered yeast cell strain (Cuol01) cultured on a solid YPD plate was inoculated into 50 mL of liquid YPD medium, and cultured in a 30°C shaker until the OD value was 1.3-1.5. The cells were then collected on ice for 30 min, and then collected using a small centrifuge. The collected yeast cells were repeatedly washed with 25 mL of H2O, 2 mL of 1M sorbitol, and 2 mL of 0.1M lithium acetate, and finally, 100 μL of the yeast cells dissolved in 250 μL of 1M sorbitol were aliquoted into 1.5 mL sterile centrifuge tubes.

[0104] 2.4.2 Yeast transformation (lithium acetate transformation)

[0105] The transformation method used in this yeast transformation experiment is called lithium acetate transformation. The specific operation steps are as follows:

[0106] (1) The original yeast cells (Cuol01-1) stored in a -80°C ultra-low temperature refrigerator were taken out of the refrigerator, thawed, streaked on a solid YPD medium, and cultured in a 30°C incubator for 48 h.

[0107] (2) The single colonies on the plate were picked and placed in 4 mL of liquid YPD medium, and cultured in a 30°C shaker until the OD value was 0.2.

[0108] (3) Take 1.5 mL of the bacterial solution and transfer it to 30 mL of YPD liquid medium and incubate it in a 30°C shaker for 3 or 4 hours until the OD value is measured to be 0.6, which is used as the seed solution.

[0109] (4) Transfer the seed solution to a 50 mL sterile centrifuge tube, and after the 4°C centrifuge is cooled to below 4°C, centrifuge it at 5000 rpm for 5 min, collect the bacterial cells, and pour off the YPD medium.

[0110] (5) Wash the bacterial cells (resuspend the yeast cells) twice with 25 mL of ddH2O (placed on ice, sterilized on the same day) and centrifuge them at 5000 rpm for 5 min on a 4°C centrifuge to collect the bacterial cells and pour off the supernatant.

[0111] (6) Add 1 mL of 100 mM LiAc (0.1 M) to the sterilized 1.5 mL centrifuge tube to resuspend the bacterial cells, centrifuge them at 8000 rpm for 30 s, and pour off the supernatant.

[0112] (7) Resuspend the bacterial cells in 200 μL of 0.1 M LiAs, and divide 50 μL per 1.5 mL centrifuge tube.

[0113] (8) Mix the sample: add 360 μL of the transformation system to the bacterial cell precipitate, mix well by blowing, and let it stand in a 30°C incubator for 20 min. The transformation system is shown in the following table (Table 16).

[0114] Table 16 Yeast transformation system

[0115]

[0116]

[0117] (9) Heat shock the transformation system at 42°C for 25 min, and then place it in a 30°C incubator for 3 hours.

[0118] (10) Spread the transformation system on the corresponding auxotrophic plates. Take 100 μL and spread it on the Sc-U-L transformation system plate, and after spreading, seal the plate with a sealing film and incubate it in a 30°C incubator for 2-4 days.

[0119] 2.4.3 Positive strain clone screening and detection

[0120] In the Ultra-clean workbench, prepare enough PCR tubes. First, use a 20 μL pipette to add 20 μL of ddH2O to each PCR tube, then use a 10 μL pipette to randomly pick single colonies from the plate. Pick 8 single colonies from each plate and mix them evenly by repeatedly blowing and sucking the colonies with ddH2O. Divide the bacterial solution into two groups of PCR tubes. One group is boiled in a water bath for 10 minutes or ultrasonicated for 10 minutes to break the cell wall; the other group is reserved (shake the bacteria after confirming successful transformation).

[0121] (1) Configure the bacterial water PCR detection reaction system. The enzyme used for bacterial water detection is Super 2xMix, and the detection reaction system is 25 μL, as shown in the following table (Table 17):

[0122] Table 17 Bacterial water PCR detection reaction system

[0123]

[0124] Among them, the primers used in this test detection are universal primers, mainly designed by (SnapGene) software, and the upstream primer is Y33PCR-PGK1-F and the downstream primer is Y33PCR-CYC1-R.

[0125] The bacterial water PCR detection reaction system is shown in the following table (Table 18):

[0126] Table 18 Bacterial water PCR reaction program

[0127]

[0128] After the bacterial water PCR reaction program is completed, the PCR product is detected by gel electrophoresis to be about 1500 bp. If it is similar in size to the control band, it means that the yeast beads are true positive, that is, the lithium acetate transformation test is successful.

[0129] (2) Positive strain fermentation and preservation. Add all the other group of bacterial solution left after breaking the cell wall to 50 mL SC-U-L liquid medium and culture in a 30°C shaker for 3 days. After the bacterial solution is completely turbid, add 500 μL of glycerol and bacterial solution to the bacteria preservation tube according to a 1:1 ratio, mix thoroughly and store in a -80°C ultra-low temperature refrigerator for standby. The remaining bacterial solution is transferred to a conical flask for fermentation.

[0130] 2.4.4 Yeast fermentation product extraction

[0131] (1) Yeast product fermentation and OD value detection. Select a normally growing positive Coul01 yeast strain, culture in 50 mL SC-U-L-Glu liquid medium, and culture in a 30°C shaker for 6 days. After 6 days, dilute 25 times and detect the OD value as 12.

[0132] (2) Yeast fermentation product separation. Extract the yeast fermentation product, transfer the bacteria liquid in 250 mL conical flask to 50 mL centrifuge tube, use high-speed cell crushing centrifuge 5000 rpm for 3 min, collect the supernatant and yeast precipitate respectively.

[0133] (3) Extraction and collection of yeast precipitate. Add 5 mL of methanol to the yeast precipitate, stand for 30 min, then transfer to ultrasonic instrument for ultrasonic for 45 min, collect the supernatant by centrifugation at 5000 rpm for 3 min, and collect the supernatant in an ampoule bottle for evaporation concentration (or put into an oven for drying).

[0134] (4) Detection of extracted sample. Wash with 50 μL or 100 μL of methanol, filter the sample using a clean syringe, transfer it to a small brown bottle (with a lid), dry it in an oven, then spot the concentrated extract on a TLC plate, develop the plate with a solvent cyclohexane / ethyl acetate (volume ratio 12:1), and stain the TLC plate with 5% sulfuric acid-ethanol as a color developing agent. Analyze the metabolites by GC-MS.

[0135] 3. Results and analysis

[0136] 3.1 Mining of HcCYP450 genes

[0137] In the previous comparative transcriptome analysis, the key enzyme genes of cucurbitacin F pathway were analyzed, and it was found that the genes HcOSC6, HcACTs, HcSDR and HcCYPD20, which were successfully verified, had specific high expression in tuber tissues. Therefore, new CYP450 gene enzyme mining and verification were continued. The 251 CYP450 genes in the transcriptome were analyzed by tissue expression heat map, and the correlation with HcOSC6, HcACTs, HcSDR and HcCYPD20 genes was calculated.

[0138] From the heat map, according to the high expression pattern of tubers, two main modules can be divided, module 1 has 17 CYP450 enzymes with high expression in tubers, and module 2 has 22 CYP450 enzymes with high expression in tubers ( Figure 1 A). In the previous project, when verifying the genes HcOSC6, HcSDR and HcCYPD20, it was found that the sequence often appeared incomplete or broken into two segments (such as OSC6-1 / OSC6-2). Therefore, we carried out transcriptome sequence reassembly and genome sequence backfilling to obtain complete coding sequences, and found that the newly mined CYP450 enzyme genes appeared sequence breakage and incompleteness ( Figure 1B) The nucleotide sequences in the transcriptome of H. crenata and the CYP450 annotation sequences in the genome were aligned using TBtools, and 61 matching records were found, including some CYPs without full-length. The full-length ORF sequences were obtained by reassembling the reference and complementing the genomic data for gene function verification.

[0139] After successful sequencing of the gene construction plasmid, the product was transferred to the yeast strain for culture and extraction. GC-MS detection showed that 12 CYPs had signals, 21 CYPs had no signals, the similarity was greater than 90%, and 3 homologous CYPs were successfully obtained.

[0140] TLC point plate was performed, and the presence or absence of blue-purple spots was detected relative to the empty plasmid. It was found that CYP69, CYP101, CYP148, CYP150 and CYP155 had obvious blue-purple spots, which were similar to the oxidation modification on the cucurbitadienol skeleton. In the later stage, the chassis and large-scale fermentation were constructed for purification and separation of compounds, and the results of compound identification.

[0141] Example 2 Gene amplification, recombination and function verification of CYP69, CYP101, CYP148, CYP150 and CYP155

[0142] 1) According to the biological information analysis test results, a series of tests were performed on the candidate genes that may have high expression functions: gene amplification, vector recombination, yeast expression and final product detection. The method is described in Example 1.

[0143] 2) HcCYP450 gene amplification and recombination

[0144] The following figure shows the results of yeast recombination detection of candidate genes (HcCYP69, HcCYP101, HcCYP148, HcCYP150 and HcCYP155) Figure 2 ). The gene sequencing results were compared with BioEdit software, and the domain was predicted in NCBI, and sequence analysis was performed after successful assembly, wherein the length of HcCYP69, HcCYP101, HcCYP148, HcCYP150 and HcCYP155 was about 1500 bp (the gene sequence is shown as SEQ ID NO: 1-5, and the amino acid sequence is shown as SEQ ID NO: 6-10).

[0145] To identify the function of CYP450 from *Gentiana sinensis*, the entire CYP450 gene was cloned into the Y33 vector, which was then transformed into a *Saccharomyces cerevisiae* system using the lithium acetate conversion method. Yeast fermentation products were extracted and analyzed by TLC and GC-MS. Simultaneously, the empty Y33 vector was transformed into a yeast mutant as a negative control. GC-MS analysis was then performed, as detailed below:

[0146] 200 μL of N-methyl-N-(trimethylsilyl)trifluoroacetamide was added to the concentrated extract, and derivatization was performed at 70 °C for 1 H. The metabolites were analyzed by GC-MS under the following chromatographic conditions:

[0147] The HP-5MS column (5% phenyl methyl silox, 30m x 250μm internal diameter, 0.25μm film) was selected. The sample inlet, delivery line, and ion source temperatures were set at 280℃, 250℃, and 230℃, respectively. The oven temperature program was as follows: 70℃ for 2 min, then increased to 260℃ at 20℃ / min, and finally increased to 300℃ at 10℃ / min and held for 10 min. The carrier gas (He) flow rate was 1 mL / min, and the injection was split (split ratio 5:1). Mass spectrometry data with m / z ratios between 50 and 800 were recorded.

[0148] The results are as follows Figure 3 As shown, Figure 3 The mass spectrum of the HcCYP69 gene fermentation product is provided as an example, showing that the HcCYP69 gene can successfully dihydroxylate cucurbitacinol. Further NMR verification confirmed this. Figure 4 The hydroxylation sites of cucurbitadienol can be determined to be at C24 and C25, and the transformation diagram is shown below. Figure 5 As shown. Furthermore, similar results were also found in the yeast fermentation products of HcCYP101, HcCYP148, HcCYP150, and HcCYP155.

[0149] In further TLC analysis, the CYP69 gene-carrying cells exhibited significantly similar spots to CYP87D20, and the product was detected within the yeast. The TLC results are as follows: Figure 6 As shown.

[0150] The present invention provides only illustrative examples of some specific embodiments for protection. The technical features described in one or more technical solutions can be combined with any one or more technical solutions, and the resulting combinations are also within the scope of protection of this application, just as these resulting combinations have been specifically described in the disclosure of this invention.

Claims

1. A class of cytochrome P450 genes associated with cucurbitacinol hydroxylation: HcCYP69; its nucleotide sequence is shown in SEQ ID NO:

1.

2. A protein encoded by the gene according to claim 1, wherein: The amino acid sequence of the protein encoded by the HcCYP69 gene is shown in SEQ ID NO:

6.

3. An expression vector containing the gene of claim 1.

4. An engineered microbial strain, wherein the strain is a yeast containing the expression vector of claim 3.

5. A biocatalytic method for the hydroxylation of cucurbitadienol, wherein the biocatalysis is carried out by the yeast of claim 4.

6. The application of the gene of claim 1 or the protein of claim 2 in catalyzing cucurbitadienol to 24,25-dihydroxy-cucurbitadienol.

Images