A method and application of obtaining primary 100% gene mutation yellow eel by multi-target site genome editing

Abstract

The present invention belongs to the technical field of aquatic animal gene function research and genetic breeding, and discloses a method and application of obtaining primary 100% gene mutation yellow eel by genome editing of multiple target sites, and the steps are as follows: A: design of multiple editing sites in the target gene and sgRNA synthesis; B: co-microinjection of multi-target site sgRNA and Cas9 protein into yellow eel fertilized eggs; C: screening of genome-edited yellow eels to obtain yellow eel individuals with 100% mutation of the target gene. The method is easy to implement and simple to operate, and multiple sites in the target gene are edited simultaneously to obtain multiple mutation types to achieve complete loss of gene function. The method can directly obtain yellow eel individuals with 100% mutation of the primary target gene, can be effectively applied to yellow eel genetic breeding and gene function research, and has important application value.

Description

Technical Field

[0001] The present invention belongs to the field of aquatic animal genetic breeding technology and gene function research, and more specifically relates to a method and application of obtaining primary 100% gene mutant yellow eels through multi-target site gene editing. Background Art

[0002] Gene editing is a technology that uses nucleases to modify endogenous DNA or RNA accurately and efficiently. The emergence of technologies such as zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (CRISPR / Cas9) has provided new and efficient tools for the study of gene function. Gene editing technologies such as ZFNs, TALENs and CRISPR / Cas9 systems are based on the precise targeting of nucleases to induce double-stranded DNA breaks, thereby initiating the cell's internal repair mechanism, that is, heterologous end joining that is prone to random deletions or insertions that lead to inactivation of gene function. Compared with ZFNs and TALEN technologies, the CRISPR / Cas9 system only needs to construct sgRNA targeting a specific site, and the construction process is simpler and faster. In addition, Cas9 functions in the form of a monomeric protein, making it easier to design and assemble. Therefore, CRISPR / Cas9 technology is currently the most widely used gene editing tool.

[0003] Fish are mostly fertilized and developed in vitro, which provides good conditions for the application of gene editing technology in the study of fish gene function and the creation of excellent germplasm. However, gene-edited P0 generation individuals usually have genomic mosaic mutations, and they need to mate with wild-type individuals to obtain heterozygous mutant individuals, and self-fertilize female and male heterozygous individuals of the same mutation type to obtain homozygous mutant offspring, before gene function research and new germplasm creation can be effectively carried out.

[0004] Fish are the group with the largest number of vertebrate species, with more than 30,000 species. So far, about 2% of bony fish have been found to be hermaphroditic, belonging to 9 orders and 27 families (Gemmell et al., 2019; Zhao Huihong et al., 2020). The yellow eel is the first hermaphroditic bony fish discovered to be naturally sex-reversed, first female and then male. The yellow eel is an important aquaculture target in my country, but there are currently no excellent varieties. The applicant team used TALENs technology to establish a genome editing method for the yellow eel and obtained P0 generation individuals with mosaic genome mutations (Feng et al., 2017). Since some genes in the mosaic individuals obtained by gene editing are still functional, it is difficult to observe the phenotype caused by gene function loss in the P0 generation. Usually, gene-edited fish need to undergo multiple generations of hybridization and self-pollination to obtain pure lines for functional research and excellent germplasm creation. In the case of the rice field eel, the gene-edited P0 generation chimera rice field eels initially consisted of only female individuals, and it usually takes more than three years for females to revert to males. Therefore, establishing an efficient rice field eel gene editing method to obtain rice field eels with a complete loss of P0 generation target gene function is a technical bottleneck for conducting functional research.

[0005] Multi-target editing is an effective means to improve the efficiency of gene mutation. At present, there are only patent applications for the use of dual gRNA sites to knock out the dmrt1 gene and the amh gene in yellow catfish (application numbers: CN201910878588.3, ​​CN201910878579.4). Theoretically, dual-site gene editing still has a 1 / 3 probability of producing nonsense mutations and cannot produce the target phenotype. The type of mutation produced by CRISPR / Cas9 gene editing in the target area is uncertain. Even if an individual with 100% mutation is obtained, the mutation type is also an important factor affecting the target phenotype.

[0006] There are no research reports on multi-target gene editing methods for hermaphroditic fish.

[0007] The present invention uses the hermaphroditic eel as the object for the first time, performs 7 target gene editing on the sex differentiation-related gene cyp19a1a, and establishes a gene editing method with 100% primary mutation. The present invention analyzes and finds that increasing the number of editing sites can significantly increase the proportion of large fragment deletions of the target gene, which is more likely to lead to loss of gene function and produce the target phenotype.

[0008] References:

[0009] Gemmell, NJ; Todd, EV; Goikoetxea, A.; Ortega-Recalde, O.; Hore, TA (2019). Natural sexchange in fish. Sex Determination in Vertebrates, 134, 71-106.

[0010] Feng, K.; Luo, HR; Li, YM; Chen, J.; Wang, YP; Sun, YH; Zhu, ZY; Hu, W. (2017). High efficient gene targeting in rice field eel Monopterus albus bytranscription activator-likeeffector nucleases. Science Bulletin, 62, 162-164.

[0011] Zhao Huihong, He Qi, Zhang Chunli, Wang Qing, Zhang Yong, Yang Huirong, Lin Fangmei, Li Yusen, Shi Herong, Zhang Haifa. 2020,

[0012] Research progress on sex differentiation and sex change in hermaphroditic fish. Journal of Fisheries of China. Summary of the invention

[0013] The purpose of the present invention is to provide a method for obtaining primary 100% gene mutation yellow field eels by genome editing at multiple target sites, which is easy to implement and simple to operate. The method can obtain yellow field eel individuals with 100% mutation and functional loss of target genes in the primary genome editing, which can be used for gene function research and the cultivation of new genetic breeding materials.

[0014] Another object of the present invention is to provide the application of the above method in the breeding of transgenic rice field eels. The efficient multi-target site gene editing technology of the present invention avoids the need for multiple generations of hybridization and selfing to obtain rice field eels with homozygous gene mutations, which will significantly shorten the breeding period for obtaining rice field eels with gene function deletions and has obvious application value.

[0015] In order to achieve the above object, the present invention adopts the following technical measures:

[0016] A method for obtaining primary 100% gene mutation yellow eel by multi-target site genome editing, comprising the following steps:

[0017] (1) Design of multiple editing sites within the target gene: 5-15 genome editing sites were designed for the target gene of the rice field eel, with the editing sites spaced 50-200 bases apart;

[0018] (2) Gene editing sgRNA synthesis and microinjection: sgRNA is synthesized by in vitro transcription, and multiple sgRNAs and Cas9 proteins of equal concentrations are microinjected into fertilized eggs of yellow eel;

[0019] (3) Screening of eel individuals with 100% mutation of the target gene: Gene-edited eels are obtained through embryo hatching, fry cultivation, and adult fish farming. Genomic DNA is extracted from tail muscle tissue, and PCR is used to amplify the target gene DNA fragment. Gel electrophoresis and DNA sequencing analysis are used to screen eel individuals with 100% mutation of the target gene.

[0020] The protection scope of the present invention also includes the application of the above genome editing method in the breeding of transgenic rice field eels. By using this method, transgenic rice field eels without ovarian structures of the PO generation are obtained. The specific editing process is as follows:

[0021] (1) The target editing region of the wild-type rice field eel cyp19a1a gene was selected as follows:

[0022] ATGGATCTGATCCCTGCTTGTGAACGGGCAGTAGTTCCTGTTGGTTTGGATGCAGCAGCGGCAGACCTG

[0023] GACTCTGTGTCCTCAAATGCCACTGCAGTGGGATCAGCGGGCATCTCAGTGGCAACCAGAGCCTTGATG

[0024] CTGCTCGTCTGCCTGCTGCTGGTCACCTGGAACCACACAGAGAAGAAGCATGTACCAGGTGGGCTCAGT

[0025] GGTCACTAATCAGCTTGGACACTGTTTTTCTCTTGGTGCTGGAGACAATTTCTATTTTTATGTTATGTT

[0026] GGTATAAGTTAAAGTACATGTATTGTCATTTACCACAACAGGTCCTTCTTTCTGTCTGGGCTTGGGGCC

[0027] ACTTTTGTCATATGTGAGATTCATCTGGACTGGCATAGGCACAGCCAGCAACTACTACAACAACAAGTA

[0028] TGGAGATATTGTTAGAGTTTGGATCAATGGAGAGGAGACACTCATACTCAGCAGGTTGGTTGTCTCTGT

[0029] TAATGCTGATAAGTAAAGTAACCAAACAGTCAAACCAAGTGTAAAGTGATAATCTGAAGTTTGTTTTCC

[0030] TTTGTTTGTCCGATTTTTACAAAAAGGTCATCAGCGGTGCATCATGTATTGAAGAATGGACATTACACT

[0031] TCACGTTTGGGGAGCAAGCAGGGACTCAGCTGCGTTGGCATGAACGAGAGAGGCATTATATTTAACAAC

[0032] AACGTAGCTCTGTGGAAAAAGATACGCATGTTTTTCATCAAAGGTAACATTTTAACACATTCAGCCTTG

[0033] CAGAATTACTGATTGATCTAGTTATAGATTTTACAATATATTTGACTAACCAGAAAGCTGTCTGATTTC

[0034] CTGTGTCAGCCCTCACAGGTCCGGGGTTGCAGCAGACAGTGGAGGTTTGTGTCTCCTCCACACAGACTC

[0035] ACCTAGACGACCTGGACAATTTGGGTCATGTGGATGTCCTCAGTTTGCTGCGCTGCACCGTGATAGACA

[0036] TCTCCAACAGACTCTTCCTTGGTGTACCTGTCAATG

[0037] (2) Seven genomic editing sites were selected for the target region in (1) as follows:

[0038] Target a: GGCAGTAGTTCCTGTTGGTTTGG

[0039] Target b: GGATGCAGCAGCGGCAGACCTGG

[0040] Target c:GGGATCAGCGGGCATCTCAGTGG

[0041] Target d:GGACATTACACTTCACGTTTTGGG

[0042] Target e:GGGGTTGCAGCAGACAGTGGAGG

[0043] Target f:GGACCTGTGAGGGCTGACACAGG

[0044] Target g: GGTTCCAGGTGACCAGCAGCAGG;

[0045] (3) synthesizing sgRNA of the above target site, mixing it with Cas9 protein, and microinjecting it into fertilized eggs of yellow eel;

[0046] (4) The gene-edited eels are hatched and cultured to form gene-mutated individuals, and the target editing region in step (1) is sequenced. If the target editing region mutates into one of the following three genotypes, it is a transgenic eel of the PO generation without ovarian structure;

[0047] i

[0048] ATGGATCTGATCCCTGCTTGTGAACGGGCAGTAGTTCCTGTTGCAGAGCAGAGTCTGT

[0049] GTTCCTCCACACAGACTCACCTAGACAACCTGGACAATTTGGGTCATGTGGATGTCCT

[0050] CAGTTTGCTGCGCTGCACCGTGATAGACATCTCCAACAGACTCTTCCTTGGTGTACCTG

[0051] TCAATGii. ATGGATTCTGATCCCTGCTTTGTGAACGGGCAGTAGTTCCTGTTGGATGCAGCAGCGGCAGACCTGGACTCTGTGTCCTCAAATGCCACTGCAGCCCTCACAAGTCCGGGGTTGCAGCAGACAGTGGAGGTTTGTGTCTCCTCCACACAGACTCACCTAGACAACCTGGACAATTTGGGTCATGTGGATGTCCTCAGTTTGCTGCGCTGCACCGTGATAGACATCTCCAACAGAC

[0052] TCTTCCTTGGTGTACCTGTCAATG

[0053] iii

[0054] ATGGATCTGATCCCTGCTTGTGAACGGGCAGTAGTTTGTGTCTCCTCCACACAGACTCA

[0055] CCTAGACAACCTGGACAATTTGGGTCATGTGGATGTCCTCAGTTTGCTGCGCTGCACCG

[0056] TGATAGACATCTCCAACAGACTCTTCCTTGGTGTACCTGTCAATG

[0057] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0058] The existing eel genome editing technology performs single-site editing on the target gene, and the primary eel individuals are often mosaic, and it is difficult to observe the functional loss phenotype caused by gene editing. The eel is hermaphroditic, first female and then male, and it is difficult to establish homozygous gene mutations through mating between male and female individuals through gene editing. Therefore, the existing gene editing technology has not been effectively used in the study of gene function and new germplasm creation of the eel. The applicant established the eel genome editing technology with multiple target sites for the first time, and edited multiple sites in the target gene at the same time, causing various types of fragment deletions, insertions and inversions in the gene. The mutation efficiency of editing the genes of primary individuals of the eel can reach 100%. Physiological phenotypes caused by functional loss can be observed in individuals with high gene mutations. The present invention can obtain individuals with gene function loss in the primary generation, solve the problem of eel gene function research, and has important application value.

[0059] This method can be used to obtain individuals with completely missing gene functions in gene-edited primary eels. It is suitable for obtaining eels with completely missing gene functions in a short time and with high efficiency in the study of eel gene functions, and can also quickly obtain new eel germplasm with improved traits after precise editing of target genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 This is a schematic diagram of the sgRNA targeting position of the cyp19a1a gene in the yellow eel in Example 1, as well as the co-injection of multiple sgRNAs and Cas9 proteins to cause various types of large DNA deletion mutations in the embryo, and PCR amplification to obtain diffuse mutant fragment bands.

[0061] Figure 2This is a monoclonal analysis of the embryonic mutant fragments of the cyp19a1a gene-edited yellow eel in Example 2. Large fragments were deleted in most of the DNA amplification products; a small number of DNA amplification products were similar in size to the wild type (indicated by arrows), and DNA sequencing found that these DNA fragments also had base deletions or insertions.

[0062] Figure 3 For the gene mutation analysis of the tail tissue of the cyp19a1a gene-edited rice field eel in Example 2, 10 rice field eels with 100% mutation of the cyp19a1a gene were screened and obtained.

[0063] Figure 4 To implement the phenotype analysis of gonadal development in cyp19a1a gene-edited rice field eels in step 2;

[0064] The gonads of eels with cyp19a1a gene mutations cannot develop into ovaries, large fragments are deleted within the gene, and the expression level of cyp19a1a gene decreases significantly. DETAILED DESCRIPTION

[0065] In order to more clearly understand the technical solution of the present invention, the present invention is further described by the following specific examples. The technical solutions of the present invention, unless otherwise specified, are conventional solutions in the art; the reagents or materials, unless otherwise specified, are all from commercial channels. The present invention selects the key regulatory gene cyp19a1a (GenBank: EU841366.1) for multi-target gene editing of the eel gonad development as an example for illustration, and those skilled in the art also edit other genes of the eel.

[0066] Embodiment 1:

[0067] A method for obtaining primary 100% gene mutation of yellow eel by multi-target site gene editing, comprising the following steps: 1. Selection of target gene and sgRNA design

[0068] The present invention selects the key regulatory gene cyp19a1a (GenBank: EU841366.1) for gonadal development of yellow eel for multi-target gene editing. When using the CRISPR / Cas9 system for gene editing, the target site recognized by sgRNA is usually 20 bases, and the end is NGG base (N is any base, G is guanine deoxyribonucleic acid). The yellow eel cyp19a1a gene has a total of 9 exons, and the target editing region selected by the present invention is shown in SEQ ID NO.1. The present invention designs 7 target sites on the 4 exons at the front of the cyp19a1a gene, including 5 sites on the sense strand and 2 sites on the antisense strand ( Figure 1 ). The sequence of the Cyp19a1a gene editing site is shown in Table 1.

[0069] Table 1: Nucleic acid sequence of the editing site of the cyp19a1a gene in the yellow eel

[0070] Site name Nucleic acid sequence Target a GGCAGTAGTTCCTGTTGGTTTGG Target b GGATGCAGCAGCGGCAGACCTGG Target c GGGATCAGCGGGCATCTCAGTGG Target GGACATTACACTTCACGTTTGGG Target e GGGGTTGCAGCAGACAGTGGAGG Target f GGACCTGTGAGGGCTGACACAGG Target g GGTTCCAGGTGACCAGCAGCAGG

[0071] 2. Microinjection of multiple sgRNAs and Cas9 proteins into fertilized eel eggs

[0072] sgRNA synthesis: Specific sgRNA targeting the cyp19a1a gene was synthesized by in vitro transcription, and the integrity of sgRNA was detected by gel electrophoresis. sgRNA was dissolved in RNase-free water and the concentration was determined.

[0073] Obtaining fertilized eel eggs: During the breeding season, pregnant female eels are injected with oxytocin to induce egg cell maturation. Male eels are dissected, the testes are removed, cut into pieces, and ground into pieces to obtain a sperm mixture. The eggs are then artificially inseminated with sperm to obtain fertilized eggs.

[0074] Microinjection of sgRNA and Cas9: Multiple sgRNAs targeting the cyp19a1a gene were adjusted to the same concentration and mixed evenly with Cas9 before being microinjected into fertilized eggs of yellow eel. The concentration of each sgRNA was 50 ng / μl, and the concentration of Cas9 protein was 500 ng / μl. 2 nl of the mixture was injected per fertilized egg.

[0075] 3. Cultivation and breeding of gene-edited eels

[0076] After microinjection, the eel embryos were incubated in 0.3X Danien's Buffer in still water, and the embryos emerged after 7 days of incubation. The eel fry were cultured in aerated water, opened with water earthworms, and then tamed to eat compound feed.

[0077] Embodiment 2:

[0078] Analysis of mutation efficiency and physiological phenotype of gene-edited eel:

[0079] (I) Detection of mutation efficiency of P0 generation of rice field eel by multi-target genome editing

[0080] Using the method described in Example 1, multiple sgRNAs and Cas9 proteins were co-injected into whole eel embryos 5 days after the injection, genomic DNA was extracted, and DNA fragments containing the target site were amplified by PCR. Agarose gel electrophoresis analysis showed that eel individuals with multiple types of large gene fragment deletions at the internal editing position of the cyp19a1a gene ( Figure 1 ). The PCR amplified fragment was connected to the TA cloning vector and transformed into DH5α competent cells, which were revived and evenly coated on the surface of a fixed culture medium containing ampicillin resistance. Single DH5α cells grew into monoclonal colonies, and monoclonal colonies were picked for PCR amplification to obtain the inserted fragment. Agarose gel electrophoresis analysis and DNA sequencing of the PCR amplified product showed that the mutation efficiency could reach 100% ( Figure 2).

[0081] Using the method described in Example 1, when the cyp19a1a gene-edited eels were cultured to 12 months of age, the tail fin tissue of the adult fish was taken to extract genomic DNA for PCR amplification and gel electrophoresis detection. PCR amplification and gel electrophoresis detection found that the PCR products of the tail fin genome of 10 cyp19a1a gene-edited eels were different from those of the wild type, and were diffuse multiple electrophoresis bands. The mutation efficiency was analyzed by monoclonal detection of PCR amplification products and found that the gene knockout efficiency in the tail tissues of 10 cyp19a1a gene-edited eels reached 100% ( Figure 3 ).

[0082] (II) Phenotypic analysis of P0 representatives of multi-target genome editing yellow eel

[0083] Using the method described in Example 1, 10 highly efficient gene-edited eels were grown to 12 months of age for phenotypic analysis. The results showed that unlike the typical ovarian structure of the wild-type eel gonads, the gonad development of the cyp19a1a gene-edited eels was blocked. Only reproductive stem cells or oogonia were present in the gonads, which failed to develop into ovarian structures ( Figure 4 , A, B and B′). PCR and gel electrophoresis were used to analyze the mutation type of cyp19a1a gene and found that large DNA deletions occurred in these eels ( Figure 4 , C). The expression analysis of the target gene cyp19a1a in the gonads showed that the expression of cyp19a1a in the gonads of the three gene-edited eels decreased to a level that was difficult to detect. After gene editing, the sequence shown in SEQ ID NO.1 in the wild-type eel mutated to SEQ ID NO.2 to SEQ ID NO.4, respectively. The mutant eels that could not develop into ovarian structures had these three genotypes. In addition, we found that although the cyp19a1a mutation efficiency of some eels reached 100%, the cyp19a1a gene was still expressed in the gonads, and the gonads still developed into ovaries. Therefore, increasing the number of gene editing targets, causing a high proportion of large fragments to be deleted within the gene, and causing the target gene to be non-expressed or extremely low expressed is the key to obtaining gene-edited eels with useful phenotypes.

[0084] i

[0085] ATGGATCTGATCCCTGCTTGTGAACGGGCAGTAGTTCCTGTTGCAGAGCAGAGTCTGT

[0086] GTTCCTCCACACAGACTCACCTAGACAACCTGGACAATTTGGGTCATGTGGATGTCCT

[0087] CAGTTTGCTGCGCTGCACCGTGATAGACATCTCCAACAGACTCTTCCTTGGTGTACCTG

[0088] TCAATGii. ATGGATTCTGATCCCTGCTTTGTGAACGGGCAGTAGTTCCTGTTGGATGCAGCAGCGGCAGACCTGGACTCTGTGTCCTCAAATGCCACTGCAGCCCTCACAAGTCCGGGGTTGCAGCAGACAGTGGAGGTTTGTGTCTCCTCCACACAGACTCACCTAGACAACCTGGACAATTTGGGTCATGTGGATGTCCTCAGTTTGCTGCGCTGCACCGTGATAGACATCTCCAACAGAC

[0089] TCTTCCTTGGTGTACCTGTCAATG

[0090] iii

[0091] ATGGATCTGATCCCTGCTTGTGAACGGGCAGTAGTTTGTGTCTCCTCCACACAGACTCA

[0092] CCTAGACAACCTGGACAATTTGGGTCATGTGGATGTCCTCAGTTTGCTGCGCTGCACCG

[0093] TGATAGACATCTCCAACAGACTCTTCCTTGGTGTACCTGTCAATG

[0094] The invention establishes a method for editing the eel genome with multiple target sites, which can achieve 100% gene mutation in the primary culture of microinjection and obtain eel individuals with gene function loss. The physiological phenotype caused by gene function loss can be directly observed in gene-edited eels. Therefore, this method can quickly obtain eel individuals with gene mutations for functional research and cultivation of new germplasm for genetic breeding.

Claims

1. A method for obtaining primary 100% gene mutation yellow eel by multi-target site genome editing, comprising the following steps: (1) Design of multiple editing sites within the target gene: Seven genomic editing sites were selected for the target editing region of the cyp19a1a gene of the wild-type rice field eel, as follows: Target a: GGCAGTAGTTCCTGTTGGTTTGG Target b:GGATGCAGCAGCGGCAGACCTGG Target c:GGGATCAGCGGGCATCTCAGTGG Target d:GGACATTACACTTCACGTTTTGGG Target e:GGGGTTGCAGCAGACAGTGGAGG Target f:GGACCTGTGAGGGCTGACACAGG Target g: GGTTCCAGGTGACCAGCAGCAGG; The sequence of the target editing region is shown in SEQ ID NO.1, (2) Gene editing sgRNA synthesis and microinjection: The sgRNA of the target site in step (1) is synthesized by in vitro transcription, and multiple sgRNAs and Cas9 proteins of equal concentrations are microinjected into fertilized eggs of yellow eel; (3) Screening of eel individuals with 100% mutation of the target gene: Gene-edited eels are obtained through embryo hatching, fry cultivation, and adult fish farming. Genomic DNA is extracted from the tail muscle tissue, and PCR is used to amplify the target gene DNA fragment. The target editing region in step (1) is sequenced. If the target editing region mutates to one of SEQ ID NO.2 to SEQ ID NO.4, it is a transgenic eel without ovarian structure of the PO generation.

2. Application of the method according to claim 1 in breeding of transgenic ricefield eels.

Images