A method for individualized detection of microscopic peritoneal metastases in gastric cancer patients to predict peritoneal metastasis

By designing individualized Panel in the abdominal irrigation fluid of gastric cancer patients to detect tumor tissue-specific mutations, the problem of low sensitivity to predict peritoneal metastasis in the prior art is solved, early screening and accurate prediction are achieved, and the patient's survival time is extended.

CN115896238BActive Publication Date: 2025-06-24CANCER INST & HOSPITAL CHINESE ACADEMY OF MEDICAL SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202111157454.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-09-30
Publication Date
2025-06-24
Estimated Expiration
2041-09-30

AI Technical Summary

Technical Problem

The prior art has low sensitivity to predict peritoneal metastasis in patients with gastric cancer, and it is impossible to effectively detect peritoneal metastasis in early stage, resulting in delayed the timing of therapeutic intervention and affecting survival time.

Method used

Design individualized Panel to detect tumor tissue-specific mutations in abdominal irrigation fluid of gastric cancer patients, and realize the detection and prediction of micro metastatic lesions through DNA extraction, library construction and specific primer design.

Benefits of technology

Through the individualized Panel detection method, early screening and prediction can be achieved at extremely low tumor cell ratio, improving the prediction accuracy of peritoneal metastasis and extending the patient's survival time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115896238B_ABST
    Figure CN115896238B_ABST
Patent Text Reader

Abstract

The present invention relates to a method for individually detecting micrometastatic foci in the abdominal cavity of gastric cancer patients to predict peritoneal metastasis, which may sequentially include the following steps: (1) Collecting tumor tissues, blood, and peritoneal lavage fluid of patients and performing DNA extraction and library construction; (2) Performing exon sequencing on the tumor tissue library and blood leukocyte library in (1) and selecting mutation sites to design primer combinations; (3) Amplifying the primer combinations in (2) in the lavage fluid library in (1); (4) Analyzing the authenticity of the mutations in the lavage fluid; (5) Calculating the proportion of tumor cells in the lavage fluid according to the mutation results and evaluating the risk of peritoneal metastasis. The present invention discloses a detection method and a data analysis method for individually detecting mutations of gastric cancer tissues in peritoneal lavage fluid. The tumor-specific mutation detection of peritoneal lavage fluid for gastric cancer patients in the present invention helps to predict peritoneal metastasis of patients at the early stage of the occurrence of metastatic foci, achieve early intervention for patients with early peritoneal metastasis, prolong the survival time of patients, and improve the quality of life of patients.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to a method for designing an individualized panel in the peritoneal lavage fluid of gastric cancer patients to detect micro-metastatic lesions in the peritoneal cavity. Background Art

[0002] Peritoneal dissemination (PD) is a common form of metastasis in patients with gastric cancer after surgery, accounting for approximately 50% of metastatic patients. Due to the complex environment within the abdominal cavity and the difficulty for conventional chemotherapy drugs to reach the abdominal cavity, when gastric cancer patients develop peritoneal metastases visible on imaging, subsequent treatment efficacy is poor. At the same time, patients are often accompanied by complications such as intestinal obstruction and ascites, so the 5-year survival rate of patients with peritoneal metastasis is only 13%. Although there are currently clinical methods such as intraperitoneal hyperthermic perfusion chemotherapy and intraoperative extensive peritoneal lavage plus intraperitoneal chemotherapy to prevent peritoneal metastasis in gastric cancer patients, the clinical application of intraperitoneal chemotherapy is limited due to the inability to predict which patients will develop peritoneal metastasis. Therefore, predicting peritoneal metastasis in gastric cancer patients can allow for early therapeutic intervention of peritoneal metastasis and prolong the survival time of patients with peritoneal metastasis of gastric cancer.

[0003] Currently, the commonly used method for predicting peritoneal metastasis in clinical practice is cytological testing, but the sensitivity of cytological testing is very low, only 30%. Many patients cannot receive early and effective preventive treatment due to missed detection, which is far from meeting clinical needs. In the early stages of peritoneal metastasis, due to the extremely low proportion of tumor cells, qPCR-based mRNA detection and other protein marker detection cannot detect changes in the peritoneal environment caused by tumor cells. Personalized mutation detection based on second-generation sequencing technology can achieve ultra-high sequencing depth (greater than 100,000 times) and reach an extremely low detection limit (1 in 100,000), which can detect low-proportion tumor cells and can be used for early screening of tumors, efficacy prediction, and prognosis monitoring. Therefore, we designed a personalized detection panel based on the tumor tissue-specific mutations of gastric cancer patients to detect tumor tissue-specific mutations in the peritoneal lavage fluid of target patients and predict peritoneal metastasis in gastric cancer patients. Summary of the Invention

[0004] The purpose of the present invention is to detect micrometastatic lesions in the abdominal cavity of gastric cancer patients in peritoneal lavage fluid through personalized customization of the panel and to predict peritoneal metastasis.

[0005] The present invention firstly provides a method for extracting DNA in a flushing solution, which may comprise the following steps in sequence:

[0006] (1) During the abdominal exploration phase before gastric tumor resection in patients with gastric cancer, flush the patient's upper abdominal cavity with 100 ml of normal saline and collect the flushing fluid;

[0007] (2) centrifuging the saline solution obtained in (1) to obtain a precipitate;

[0008] (3) The sediment in (2) is digested with protease, cell lysed, and eluted to obtain gDNA from the rinsing liquid sediment.

[0009] The present invention also protects a method for constructing a peritoneal lavage fluid sequencing library, which may include the following steps in sequence:

[0010] (1) Ultrasonic fragmentation of gDNA from peritoneal lavage fluid;

[0011] (2) The DNA sample after being sheared in step (1) is subjected to end repair and 3' end A addition treatment in sequence:

[0012] (3) connecting the DNA sample treated in step (2) to the adapter in the adapter mixture;

[0013] (4) The ligation product obtained in step (3) is amplified by PCR to obtain a library.

[0014] The adapter mixture consists of 12 adapters. The sequence of the adapter mixture is shown in Table 4. The detailed information of the adapter mixture and amplification primers used in library construction can be found in patent CN110669823A.

[0015] The eight Ns in sequence 1, sequence 3, sequence 5, sequence 7, sequence 9, sequence 11, sequence 13, sequence 15, sequence 17, sequence 19, sequence 21, and sequence 23 represent 8 bp of random bases, which can be used as random tags.

[0016] The underlined bases in the sequence 1-24 represent a 12 bp anchor sequence. The upstream sequence and the downstream sequence of each group of linkers can be complementary paired with each other through the 12 bp anchor sequence to form a "Y"-shaped linker.

[0017] The 1st to 21st positions from the 5' end of Sequence 1, Sequence 3, Sequence 5, Sequence 7, Sequence 9, Sequence 11, Sequence 13, Sequence 15, Sequence 17, Sequence 19, Sequence 21 and Sequence 23 are the sequencing adapter binding sequences of the Truseq sequencing kit of Illumina.

[0018] The sequencing adapter binding sequence of the Nextera sequencing kit of Illumina Company from position 13 to 41 from the 5' end of Sequence 2, Sequence 4, Sequence 6, Sequence 8, Sequence 10, Sequence 12, Sequence 14, Sequence 16, Sequence 18, Sequence 20, Sequence 22 and Sequence 24 is obtained.

[0019] The T in bold at the end of the upstream sequence is complementary to the "A" added at the end of the original molecule, and TA connection is performed.

[0020] Each single strand of the 12 groups of linkers is diluted to a concentration of 100 μM, and then two single stranded DNAs of the same group are mixed in equal volumes (may be 50 μL), and annealed to obtain a “Y”-shaped linker.

[0021] The method may further comprise the step of amplifying the library obtained in step (3). The primers for the amplification are designed based on the linker sequence, i.e., at least one sequence of the primers for the amplification must be completely identical to a sequence of the linker. The primer pair used for the amplification may specifically be composed of two single-stranded DNA molecules represented by Sequence 25 and Sequence 26.

[0022] Race pre F (sequence 25): GACACGACGTCTTCCGAT (5′-3′);

[0023] Race pre R (SEQ ID NO: 26): GTGGGCTCGGAGATGTGTATAA (5′-3′).

[0024] The present invention also protects the DNA library constructed by the above method.

[0025] The present invention also protects a method for selecting specific mutation sites in gastric cancer patients:

[0026] (1) Exome capture sequencing was performed on tumor tissue and paired blood leukocytes from gastric cancer patients;

[0027] (2) performing exon mutation analysis on the sequencing results obtained in (1);

[0028] (3) For each patient's exon mutation list, tumor driver genes in Table 8 were selected first, followed by high-frequency mutation genes, and a total of n tumor-specific mutation sites were selected;

[0029] (4) Design primers to detect n tumor-specific mutation sites.

[0030] Specifically, n may be 20.

[0031] The present invention also protects a kit and a primer combination design method for detecting tumor-specific mutations in flushing fluid DNA samples, comprising any of the above-mentioned linker mixtures and primer combinations; the primer combination comprises primer group I, primer group II, primer group III and primer group IV.

[0032] Each primer in the primer set I and the primer set II is a specific primer designed based on a region associated with tumor mutations, and its function is to locate a specific position in the genome to achieve PCR enrichment of the target region; the primer set I and the primer set II detect mutation sites from both positive and negative directions, respectively;

[0033] Each primer in the primer set III and the primer set IV includes a linker sequence and a specific sequence, and the specific sequence is used for further enrichment of the target region:

[0034] In the primer set III and the primer set I, the specific sequence of the primer set III may be consistent with a partial sequence of the primer set I, and the two primers designed for the same mutation site are in a "nested" relationship;

[0035] In the primer set IV and the primer set II, the specific sequence of the primer set IV may be consistent with a partial sequence of the primer set II, and the two primers designed for the same mutation site are in a "nested" relationship;

[0036] The linker sequence in the primer set III and the primer set IV is the portion that binds to the index primer;

[0037] The "specific primers designed according to regions associated with tumor mutations" can specifically be gene-specific primers designed according to regions of tumor-specific gene variations (such as point mutations, insertion and deletion mutations).

[0038] In the kit, the tumor may be gastric cancer.

[0039] The "tumor-specific mutation" may specifically be an exon mutation in a target patient.

[0040] When n=20, taking a target patient as an example, in any of the above-mentioned kits, the primer set I includes 20 single-stranded DNA molecules, and the nucleotide sequences of the 20 single-stranded DNA molecules are shown in sequence from SEQ ID NO: 47 to SEQ ID NO: 66 in the sequence listing. The primer set II includes 20 single-stranded DNA molecules, and the nucleotide sequences of the 20 single-stranded DNA molecules are shown in sequence from SEQ ID NO: 67 to SEQ ID NO: 86 in the sequence listing. The primer set III includes 20 single-stranded DNA molecules, and the 20 single-stranded DNA molecules include sequences shown in sequence from SEQ ID NO: 87 to SEQ ID NO: 106 in the sequence listing. The primer set IV includes 20 single-stranded DNA molecules, and the 20 single-stranded DNA molecules include sequences shown in sequence from SEQ ID NO: 107 to SEQ ID NO: 126 in the sequence listing.

[0041] The primer set I may specifically consist of the 20 single-stranded DNA molecules.

[0042] The primer set II may specifically consist of the 20 single-stranded DNA molecules.

[0043] The primer set III may specifically consist of the 20 single-stranded DNA molecules.

[0044] The primer set IV may specifically consist of the 20 single-stranded DNA molecules.

[0045] Different primer sets I, II, III and IV can be designed according to the exon mutation results of tumor tissues of different patients.

[0046] Any of the above-mentioned kits may specifically consist of any of the above-mentioned adapter mixtures and the primer combination.

[0047] Any of the above primer combinations may specifically consist of the primer set I, the primer set II, the primer set III and the primer set IV.

[0048] The above-mentioned primer combination design method can be used for any tumor patients, not limited to gastric cancer patients, and different primer combinations can be designed for different patients.

[0049] Any of the above-mentioned kits may further include reagents for DNA extraction, reagents for DNA library construction, reagents for library purification, reagents for library amplification, and other materials for library construction.

[0050] The present invention also protects the design of any of the above primer combinations. The primer combination can be used to detect tumor mutations in DNA samples of peritoneal lavage fluid.

[0051] The present invention also protects the use of any of the above primer combinations in preparing a kit for detecting tumor mutations in peritoneal lavage fluid DNA samples.

[0052] In the above application, the tumor may be a malignant tumor of the stomach, i.e., gastric cancer.

[0053] The present invention also protects a method for detecting a target mutation in a peritoneal lavage fluid DNA sample, which may include the following steps:

[0054] (1) constructing a library according to any of the methods described above;

[0055] (2) preparing a single-stranded template from the library obtained in step (1), performing two rounds of nested PCR amplification, sequencing the products, and analyzing the occurrence of target mutations in the DNA sample based on the sequencing results (see patent CN110669823A for details);

[0056] In step (2), for the target patient, according to the primer combination design principle, primer set I, primer set II, primer set III and primer set IV are designed, and the first round of PCR amplification is performed using primer set I and primer set II respectively;

[0057] The product of the first round of PCR was used as a template, and the second round of PCR amplification was performed using primer set III, primer set IV, index primer, and upstream primer 3355, respectively;

[0058] The product amplified using primer set I was used as the template for the second round of amplification using primer set III. The product amplified using primer set II was used as the template for the second round of amplification using primer set IV. Finally, equal volumes of the amplified products from the same sample were mixed.

[0059] The index primer includes a sequence for sequencing and an index sequence for distinguishing samples from the 5' end.

[0060] In any of the above methods, the target mutation may be a tumor mutation, and the tumor may be a gastric malignant tumor, i.e., gastric cancer.

[0061] In the above, the DNA sample is interrupted by a water bath sonicator to form DNA fragments; the DNA fragments are end-repaired and ligated with adapters (one adapter at each of the 5' and 3' ends, which may be the same adapter or opposite adapters). For the DNA molecule at this point, the DNA fragment between the two adapters is the DNA insert.

[0062] The present invention also protects a method for determining the authenticity of mutations detected in a rinsing fluid sample DNA, wherein the target patient's detection primer group I, primer group II, primer group III and primer group IV are subjected to the same amplification experiment in a standard DNA, and the amplified library is sequenced to obtain data of the same data amount, and the same analysis process is analyzed. Primer group I, primer group II, primer group III and primer group IV are primer combinations designed based on the target patient's tumor tissue mutation, and the tumor tissue mutation of the target patient's designed primer does not exist in the standard DNA, that is, there is no mutation at the same position and / or there is no mutation of the same type at this position. After the sequencing data is subjected to bioinformatics analysis, the mutation results of the target patient's rinsing fluid and the standard DNA at the target mutation point are obtained. When the mutation type of the target patient's rinsing fluid at this point is consistent with the mutation type of its tumor tissue, and the number of mutation support reads is greater than the number of reads of the same type of mutation at this site of the standard DNA, then the mutation is true (positive) and included in the subsequent calculation of the tumor cell ratio.

[0063] In a specific implementation, the standard DNA is HTERT RPE-1 cell line (human retinal pigment epithelial cell) DNA.

[0064] The present invention also protects a method for calculating the proportion of tumor cells in the flushing fluid.

[0065] We calculated the proportion of tumor cells in the peritoneal lavage fluid based on the number of mutations detected in the lavage fluid, the mutation frequency in the lavage fluid, and the maximum mutation frequency in the patient's tumor tissue. This allowed us to compare the proportion of tumor cells in the lavage fluid between patients and predict the patient's risk of peritoneal metastasis. The calculation method is as follows:

[0066] Calculate the average mutation frequency of all mutations in the flushing fluid that are judged as "true", that is, the average mutation frequency in the flushing fluid = the mutation frequency in the flushing fluid of all "true" mutations and / the number of mutations in the flushing fluid of all "true" mutations;

[0067] The proportion of tumor cells in the rinsing fluid was calculated using the average mutation frequency of the rinsing fluid and the maximum mutation frequency of the tumor tissue, that is, the proportion of tumor cells in the rinsing fluid = the average mutation frequency of the rinsing fluid * the maximum mutation frequency of the tumor tissue:

[0068] The mutation in the rinsing fluid judged to be “true” is the mutation judged to be a true mutation in the above-mentioned “True or false judgment of mutation detected in rinsing fluid sample DNA”.

[0069] The present invention provides a method for detecting mutations (including point mutations, insertion and deletion mutations, and other forms of mutations) of tumor-specific genes in DNA in a flushing fluid sample. The library constructed using this method can be used simultaneously for PCR hotspot detection and capture sequencing. This method designs n (n can be 20) specific amplification primers based on the exon mutation results of the patient's tumor tissue, achieving high-throughput sequencing of a small targeted area, and can detect one in ten thousand DNA mutations. At the same time, the library construction method is not only applicable to flushing fluid DNA samples, but also to genomic DNA and cfDNA samples of other sample types. The present invention has important clinical significance for the prognosis prediction of abdominal metastasis in gastric cancer patients and has significant application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 This is a personalized design of the peritoneal lavage fluid testing panel and data analysis flow chart for gastric cancer patients. DETAILED DESCRIPTION

[0071] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention.

[0072] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0073] Unless otherwise specified, the test materials used in the following examples were purchased from conventional biochemical reagent stores.

[0074] The TE buffer in the following examples is a product of ThermoFisher, with product catalog number 12090015.

[0075] In the following examples, the gastric cancer patients gave their informed consent to the contents of the present invention.

[0076] Example 1: Library Construction of Washing Fluid Samples from Gastric Cancer Patients

[0077] 1. Collection and separation of lavage fluid samples from gastric cancer patients

[0078] After laparotomy and before tumor resection, the peritoneal cavity of patients with gastric cancer should be flushed with 300-400 mL of sterile saline, and approximately 100 mL of peritoneal lavage fluid should be collected. The collected peritoneal lavage fluid should be sampled within 2 hours or immediately stored in a refrigerator at 4°C and separated within 1 day.

[0079] Wash solution precipitation separation: centrifuge the wash solution sample at 2,500 rpm for 10 minutes, discard the supernatant, and store the sediment at -80°C until DNA extraction.

[0080] 2. DNA Extraction from Flushing Fluid

[0081] The rinsing liquid sediment obtained in step 1 was extracted using the QIAGEN (QIAamp DNA Mini Kit) genomic DNA extraction kit.

[0082] The following reagents are all products of the QIAGEN (QIAamp DNA Mini Kit) kit.

[0083] 1. Add 180 μL of Buffer ATL and 20 μL of Proteinase K to the rinsing buffer sediment in a 1.5 mL centrifuge tube, vortex to mix, centrifuge briefly, seal with sealing film, and place in a metal heating shaker at 56°C, 1,000 rpm for 1-3 hours (wait until the metal heating shaker is heated to 56° before placing the centrifuge tube in the shaker) until the precipitate is completely dissolved.

[0084] 2. Centrifuge the tube prepared in step 1, cool to room temperature, add 200 μl of Buffer AL, vortex to mix for 15 seconds, and centrifuge.

[0085] 3. Place the centrifuge tube in step 2 in a metal heating shaker at 70°C for 10 minutes (wait until the metal heating shaker is heated to 70° before placing the centrifuge tube).

[0086] 4. Centrifuge the centrifuge tube in step 3, place it at room temperature, add 200 μl of anhydrous ethanol (96%-100%), shake and mix for 15 seconds, and centrifuge.

[0087] 5. Transfer the liquid in the centrifuge tube from step 4 to a QIAamp Mini spin column and centrifuge at 6000g (8000 rpm) for 1 minute at room temperature. Discard the waste liquid in the collection tube.

[0088] 6. Place the QIAamp Mini spin column from step 5 into a new 2 mL collection tube. Add 500 μL of Buffer AW1 (prepared with anhydrous ethanol). Centrifuge at 6000 g (8000 rpm) for 1 minute at room temperature. Discard the waste liquid in the collection tube.

[0089] 7. Place the QIAamp Mini spin column from step 6 into a new 2 mL collection tube. Add 500 μL of Buffer AW2 (prepared with anhydrous ethanol). Centrifuge at 20,000 g (14,000 rpm) for 3 minutes at room temperature. Discard the waste liquid in the collection tube.

[0090] 8. Place the QIAamp Mini spin column from step 7 into a new 2 ml collection tube and centrifuge at 20,000 g (14,000 rpm) for 1 minute at room temperature (to dry the filter and completely remove Buffer AW2).

[0091] 9. Place the QIAamp Mini spin column from step 8 into a new 1.5 ml centrifuge tube, add 100 μl of Buffer AE, incubate at room temperature for 10 minutes, and centrifuge at 6000 g (8000 rpm) for 1 minute.

[0092] 10. Pipette the DNA solution in the 1.5 ml centrifuge tube from step 9 back into the QIAamp Mini spin column, let it stand at room temperature for 10 minutes, and centrifuge at 6000 g (8000 rpm) for 1 minute at room temperature.

[0093] 11. Use the Exkubit Plus dsDNA HS Assay Kit to determine the DNA concentration in step 10. To 199 μl of Exkubit dsDNA HS Dilution Buffer, add 1 μl of Exkubit Plus dsDNA HS Assay Reagent, vortex to mix, and centrifuge briefly.

[0094] 12. Discard 1 μl of the mixture from step 11, add 1 μl of DNA solution, vortex to mix, centrifuge briefly, and store in the dark for 2 minutes. Measure the DNA concentration on a Qubit 2.0 Fluorometer.

[0095] 3. Construction of DNA library from rinsing fluid

[0096] The kit used for constructing the DNA library of peritoneal lavage fluid was KAPA Hyper Prep Kit (KK8505).

[0097] 1. DNA fragmentation in the washing solution

[0098] Take 50 ng of the washed DNA and adjust the volume to 50 μl (if the volume is less than 50 μl, use TE Buffer to make up. If the volume is larger than 50 μl, use vacuum concentration to 50 μl). Perform water bath sonication on a Covaris E220 instrument to shear the DNA into fragments of 300 bp in size.

[0099] 2. End Repair and A Addition of Fragmented DNA

[0100] Take the purified product obtained in step 1, prepare the reaction system according to Table 1, and then perform end repair and 3' end A addition treatment in a PCR instrument according to the reaction program in Table 2 to obtain a reaction product.

[0101] Table 1. Reaction system

[0102] Element volume Purified product 50 μl End Repair&A-Tailing Buffer(KAPA KK8505) 7 μl End Repair&A-Tailing Enzyme Mix(KAPA KK8505) 3 μl Total volume 60 μl

[0103] Table 2. Reaction procedures

[0104] temperature time 20℃ 30min 65℃ 30min

[0105] 3. Connect the reaction product to the linker

[0106] The reaction system was prepared according to Table 3 and reacted at 20°C for 1 hour to obtain the ligation product (stored at 4°C).

[0107] Table 3. Reaction system

[0108] Element volume The reaction product obtained in step 3 60 μl Linker mixture (50 μM) 1.5 μl DNase / RNase-Free Water 8.5 μl Ligation Buffer (KAPA KK8505) 30 μl DNA Ligase (KAPA KK8505) 10 μl Total volume 110 μL

[0109] See Table 4 for the adapter mixture sequence information. Dissolve the single-stranded DNA molecules listed in Table 4 in TE buffer and dilute to a concentration of 100 μM. Equal volumes of two single-stranded DNA molecules from the same group (50 μl each) were mixed and then annealed (annealing schedule: 95°C, 15 min; 25°C, 2 h) to obtain 12 DNA solutions. These 12 DNA solutions were then mixed in equal volumes to produce the adapter mixture (see patent CN110669823A for details).

[0110] Table 4. Linker sequence information

[0111]

[0112]

[0113] In Table 4, 8 Ns represent 8 bp random tags.

[0114] The underlined portion represents a 12-bp anchor sequence. Within each upstream sequence (those with an "F" in their name) and downstream sequence (those with an "R" in their name), the underlined portion is reverse-complementary. Annealing allows the upstream and downstream sequences to join together to form a linker. The anchor sequence also serves as a built-in tag for sequence fixation, marking the original template molecule.

[0115] The bold T at the end of the upstream sequence is complementary to the "A" added at the end of the original molecule, and TA ligation is performed.

[0116] In the upstream sequence, positions 1 to 21 from the 5' end (from Illumina's Truseq sequencing kit) are the sequencing primer binding sequence, wherein positions 1 to 19 from the 5' end are the library amplification primer portion.

[0117] In the downstream sequence, the non-underlined portion (from the nextera sequencing kit of Illumina) is the sequencing primer binding sequence, wherein positions 1 to 22 from the 3' end are part of the library amplification primer.

[0118] 4. Purification of Ligation Products

[0119] To the ligation product obtained in step 3, add 132 μL (i.e., 1.2 times the volume) of AMPure XP magnetic beads (Beckman A63880), vortex to mix, incubate at room temperature for 10 minutes, and adsorb on a magnetic stand for 5 minutes; after the solution is clarified, discard the supernatant, then add 200 μL of 80% (volume percentage) ethanol aqueous solution to wash twice, and discard the supernatant; after the ethanol is dried, add 30 μL of DNase / RNase-Free Water, vortex to mix, incubate at room temperature for 10 minutes, adsorb on a magnetic stand for 5 minutes, and aspirate the supernatant solution into a PCR tube as a PCR template.

[0120] 5. Library Amplification and Purification

[0121] (1) Take the PCR template obtained in step 4, prepare the reaction system according to Table 5, and perform PCR amplification according to Table 6 to obtain the PCR amplification product (stored at 4°C).

[0122] Table 5. Reaction system

[0123] Element volume HIFI(KAPA KK8505) 35 μl MC_F (33μM) 2.5 μl MC_R (33μM) 2.5 μl PCR template 30 μl Total volume 70 μl

[0124] In Table 5, the primer information is as follows:

[0125] MC_F (SEQ ID NO: 25): 5′-GACACGACGCTCTTCCGAT-3′;

[0126] MC_R (SEQ ID NO: 26): 5′-GTGGGCTCGGAGATGTGTATAA-3′.

[0127] Table 6. Reaction procedure

[0128]

[0129] (2) Add 91 μL (i.e., 1.3 times the volume) of AMPure XP magnetic beads to the PCR amplification product obtained in step (1), vortex to mix, let it stand at room temperature for 10 minutes, and adsorb it on a magnetic stand for 5 minutes; after the solution is clarified, discard the supernatant, then add 200 μL of 80% (volume percentage) ethanol aqueous solution to wash twice, and discard the supernatant; after the ethanol is dried, add 100 μL of DNase / RNase-Free Water, vortex to mix, let it stand at room temperature for 10 minutes, adsorb it on a magnetic stand for 5 minutes, and aspirate the supernatant solution to obtain the product (store at -20°C). The product is an MC library that can be stored for a long time and reused repeatedly.

[0130] The library construction method is not only applicable to genomic DNA samples from flushing fluid, but also to genomic DNA samples from tumor tissue and genomic DNA samples from leukocytes.

[0131] Example 2: Primer design for tumor-specific mutations

[0132] 1. Collection and Extraction of Tumor Tissue and Blood Samples: After surgical resection of the tumor, a soybean-sized piece of tumor tissue (approximately 1 g) was excised from the patient, and approximately 10 mL of blood was collected into an anticoagulant tube. Approximately 25 mg of tumor tissue was extracted for genomic DNA using the QIAGEN (QIAamp DNA Mini Kit) genomic DNA extraction kit according to the method described in "Example 1," "II. DNA Extraction from Flushing Fluid." 200 μL of blood was extracted for genomic DNA extraction using the QIAGEN (QIAamp DNA Blood Kit) blood DNA extraction kit.

[0133] 2. Construction of sequencing libraries of tumor tissue and blood samples: 1000 ng of genomic DNA from tumor tissue and blood leukocytes were used to construct libraries according to "3. Construction of DNA library from rinsing fluid" in "Example 1".

[0134] 3. Exon capture sequencing of tumor tissue and leukocyte libraries: 1000 ng of tumor tissue and leukocyte genomic libraries were taken and captured using Agilent (SureSelectXT Human All Exon V5) kits and probes. The captured libraries were sequenced on the Illumina HiSeqX platform, with approximately 25G of tumor tissue sequenced and approximately 15G of leukocyte sequenced.

[0135] 4. Exon mutation analysis of tumor tissue. The obtained exon sequencing data was paired with the exon sequencing results of blood leukocytes and tumor tissue to obtain the mutation list of the target patient7 (taking the exons of a certain patient as an example).

[0136] Table 7. Exon mutation detection results of gastric cancer tissue from a patient (reference sequence based on hg19)

[0137]

[0138]

[0139]

[0140] 5. Select the patient's tumor-specific detection sites, find the tumor's driver genes (Table 8) and high-frequency mutation genes in the patient's mutation list, and select 20 mutation sites (Table 9).

[0141] Table 8. List of tumor driver genes

[0142]

[0143]

[0144] Table 9. Tumor tissue mutation sites detected in the flushing fluid library of the target patient

[0145]

[0146]

[0147] VI. Primer Design for Mutation Detection Sites

[0148] 1. For each mutation detection site of the target patient, 49 bp was extended upstream of the detection site and 50 bp was extended downstream of the detection site to obtain the upstream and downstream sequences of the detection site (Table 10, sequences 27-46). The mutation type of the detection site can be a single point mutation, base insertion, or base deletion.

[0149] Table 10. Upstream and downstream sequences of the detection sites

[0150]

[0151]

[0152] The upstream two-round forward amplification primer is designed upstream of the detection site, and the 3' end of the primer is 1-4 bp away from the detection site. The downstream two-round reverse amplification primer is designed downstream of the detection site, and the 5' end of the primer is 1-4 bp away from the detection site. A "nested" one-round forward amplification primer is designed upstream of the two-round forward amplification primer of the detection site, and the 3' end of the one-round forward amplification primer has an overlapping region of about 5 bp with the 5' end of the two-round forward amplification primer. A "nested" one-round reverse amplification primer is designed downstream of the two-round reverse amplification primer of the detection site, and the 5' end of the two-round reverse amplification primer has an overlapping region of about 5 bp with the 3' end of the one-round reverse amplification primer. The length of each primer is between 15-22 bp.

[0153] The 5' end of each second-round forward and reverse amplification primer was modified with a moiety (5'CTTGGCACCCGAG3') that binds to the index primer (see patent CN110669823A for details). Equal amounts of all the first-round forward amplification primers for the patient were combined to form the primer pool GASP1Amix. Equal amounts of all the first-round reverse amplification primers for the patient were combined to form the primer pool GASP1Bmix. Equal amounts of all the second-round forward amplification primers for the patient were combined to form the primer pool GASP2Amix. Equal amounts of all the second-round reverse amplification primers for the patient were combined to form the primer pool GASP2Bmix. Positions 1 to 13 from the 5' end of the primers in the GASP2Amix and GASP2Bmix primer pools are moieties that bind to the index primer. Primer sequence information for tumor-specific site amplification for the target patient is shown in Table 11. Primers with the same last three digits of primer number in the GSP2A mix and GSP1A mix were designed to target the same mutation site, forming a "nested" relationship. Primers with the same last three digits of the primer number in the GSP2B mix and the GSPIB mix are designed for the same mutation site, forming a "nested" relationship. "GSP1A" is the first-round forward amplification primer for the "mutation detection target," targeting a specific genomic location to achieve PCR enrichment of the target region; "GSP1B" is the first-round negative amplification primer for the "mutation detection target," targeting a specific genomic location to achieve PCR enrichment of the target region. "GSP2A" and "GSP2B" include a "linker sequence" and a "specific sequence", respectively. The "specific sequence" of "GSP2A" is consistent with the partial sequence of "GSP1A", and the two primers designed for the same mutation site are in a "nested" relationship. The "specific sequence" of "GSP2B" is consistent with the partial sequence of "GSP1B", and the two primers designed for the same mutation site are in a "nested" relationship. The "linker sequence" of "GSP2A" and "GSP2B" is the part that binds to the index primer. The "GSP1A" primer set designed for the n "mutation detection targets" of the target patient is primer group I, the "GSP1B" primer set designed for the n "mutation detection targets" of the target patient is primer group II, the "GSP2A" primer set designed for the n "mutation detection targets" of the target patient is primer group III, and the "GSP2B" primer set designed for the n "mutation detection targets" of the target patient is primer group IV.

[0154] Table 11. Primer sequences for target sites of interest patient testing.

[0155]

[0156]

[0157]

[0158] The underlined portion in the table is the portion where the second-round forward amplification primer GASP2A and the second-round reverse amplification primer GASP2B bind to the Index primer (5'CTTGGCACCCGAG3').

[0159] Example 3: Targeted amplification using tumor-specific primers and sequencing library construction

[0160] For detailed information on this targeted amplification technology, please refer to patent CN110669823A.

[0161] 1. Preparation of single-stranded library

[0162] 1. Take 100 ng of the flushing liquid library prepared in "Example 1", add water to a total volume of 20 μl, and perform PCR amplification according to the following system (Table 12) and procedure (Table 13).

[0163] Table 12. Reaction system

[0164] Element volume Hifi(KAPA KK8505) 25 μl BS2355 1 μl water 4 μl MC Library 20 μl Total volume 50 μl

[0165] In Table 12, the primer information is as follows:

[0166] BS2355: T*T*TT / SpacerC12 / GAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (* means biotin)

[0167] Table 13. Reaction procedure

[0168]

[0169] 2. Take 50 μl of MyOne T1 magnetic beads (Dynabeads TM MyOne TM Streptavidin T1, Invitrogen TM , Catalog No.: 65601), add 200ul BWB solution (preparation method see Table 14), vortex mix for 5s, adsorb on a magnetic stand for 2min, and discard the supernatant.

[0170] 3. Repeat step 2 three times, then add 50 μl of BWB to resuspend the magnetic beads.

[0171] 4. Add the resuspended magnetic beads to the PCR product in step 1, incubate at 43°C, 1500 rpm, shake for 30 minutes, adsorb on a magnetic stand for 2 minutes, and discard the supernatant.

[0172] 5. Add 80 μl of 0.1% Tween-EB solution, vortex mix for 5 seconds, place at room temperature for 10 minutes, adsorb on a magnetic stand for 2 minutes, and discard the supernatant.

[0173] 6. Add 80 μl of 0.2 M NaOH solution, vortex mix for 5 seconds, incubate at room temperature for 8 minutes, adsorb on a magnetic stand for 2 minutes, and discard the supernatant.

[0174] 7. Add 80 μl of 0.1% Tween-EB solution, vortex mix for 5 seconds, adsorb on a magnetic stand for 2 minutes, and discard the supernatant.

[0175] 8. Repeat step 7 once.

[0176] 9. Add 20 μl of enzyme-free water to resuspend the magnetic beads, which will serve as a template for subsequent target region enrichment and sequencing library construction.

[0177] Table 14. Preparation of BWB buffer

[0178] Element volume Tris-HCl (1M) 250 μl NaCl (5M) 10 ml EDTA (0.5M) 50 μl Enzyme-free water 14.7 ml Tween-20 12.5 μl Total volume 25 ml

[0179] 2. Targeted Amplification with Tumor-Specific Primers and Sequencing Library Construction

[0180] The flushing liquid library was amplified by two rounds of PCR using the primer pool designed in "Example 2, Primer Design for Tumor-Specific Mutations" and the fixed primers. The amplified product was the sequencing library.

[0181] 1. Take 20 μl of the single-stranded template from the flushing solution library prepared in step 1 and divide it into two aliquots. Prepare the reaction system in Table 15 (add GSP1A mix to one aliquot and GSP1B mix to the other aliquot). Perform the first round of PCR amplification according to the reaction schedule in Table 16 to obtain the first-round amplification product (a total of two aliquots of first-round amplification products are obtained: one amplification product from the GSP1A mix and one amplification product from the GSP1B mix).

[0182] Table 15. Reaction system

[0183] Element volume Hifi(KAPA KK8505) 15 μl Upstream primer 1355 3 μl GSP1A mix / GSP1B mix 2 μl MC library single-stranded template 10 μl Total volume 30 μl

[0184] In Table 15, the primer information is as follows:

[0185] Upstream primer 1355 (SEQ ID NO: 127): 5′-TCTTTCCCTACACGACGCTCTTCCGAT-3′.

[0186] GSP1A mix: Dissolve each primer from primer pool GSP1A in Table 11 in TE buffer and dilute to a concentration of 100 μM. Then, mix equal volumes and dilute to 0.3 μM in TE buffer. Primers from primer pool GSP1A are used to amplify the positive strand of the template.

[0187] GSP1B mix: Dissolve each primer from primer pool GSP1B in Table 11 in TE buffer and dilute to a concentration of 100 μM. Then, mix equal volumes and dilute to 0.3 μM in TE buffer. Primers from primer pool GSP1B are used to amplify the negative strand of the template.

[0188] In primer pool GSP1A and primer pool GSP1B, primers with the same number (ie, the last four digits of the primer number are the same) detect the same mutation site from both positive and negative directions, and simultaneously use them to maximize the enrichment of original molecular information.

[0189] Table 16. Reaction Procedure

[0190]

[0191] 2. Purify the two first-round amplification products obtained in step 1 separately with 54 μl (i.e., 1.8 times the volume) of AMPure XP magnetic beads, and then elute with 25 μl of DNase / RNase-Free Water to obtain the first-round purified products.

[0192] 3. Using the first-round purified products obtained in step 2 as templates, prepare the reaction system in Table 17 (when the product amplified using GSP1A mix is ​​used as a template, amplify using GSP2A mix; when the product amplified using GSP1B mix is ​​used as a template, amplify using GSP2B mix). Perform a second round of PCR amplification according to the reaction procedure in Table 18 to obtain the second-round amplified products (stored at 4°C).

[0193] Table 17. Reaction system

[0194] Element volume Kapa Hifi 15 μl Upstream primer 3355 2 μl GSP2A mix / GSP2B mix 1 μl Index primer (10 μM) 2 μl Template (GSP1A mix / GSP1B mix) 10 μl Total volume 30 μl

[0195] In Table 17, the primer information is as follows:

[0196] Upstream primer 3355 (SEQ ID NO: 128):

[0197] 5'-AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCT -3'; the underlined portion is the same portion as the upstream primer 1355 in the first round. Both 3355 and 1355 are fixed sequences sequenced on the Illumina sequencing platform (they can also be replaced with sequences that can be sequenced on other sequencing platforms).

[0198] GSP2A mix: Dissolve each primer from the primer pool GSP2A in Table 11 in TE buffer and dilute to a concentration of 100 μM. Then mix equal volumes and dilute to 0.3 μM in TE buffer. Primers from the primer pool GSP2A are used to amplify the positive strand of the template.

[0199] GSP2B mix: Dissolve each primer from the primer pool GSP2B in Table 11 in TE buffer and dilute to a concentration of 100 μM. Then, mix equal volumes and dilute to 0.3 μM in TE buffer. Primers from the primer pool GSP2B are used to amplify the minus strand of the template.

[0200] Primers with the same primer number in GSP2A mix and GSP1A mix (i.e., the last four digits of the primer number are the same) are designed for the same mutation site, and the two primers form a nested relationship.

[0201] Primers with the same primer number in GSP2B mix and GSP2A mix (i.e., the last four digits of the primer number are the same) are designed for the same mutation site, and the two primers form a nested relationship.

[0202] Index primer: 5'-CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 129)********GTGACTGGAGTTC CTTGGCACCCGAGAA -3' (sequence 130); the underlined portion is the portion that binds to the GSP2A mix or GSP2B mix. ******** is the position of the index sequence, which is 6-8 bp long and serves to distinguish sequences between samples, facilitating mixed sequencing of multiple samples. Except for the index sequence, all other sequences are fixed sequences from the Illumina small RNA sequencing kit.

[0203] Table 18 Reaction procedure:

[0204]

[0205] 4. The products of the second round of amplification using the GSP2A mix and the products of the second round of amplification using the GSP1B mix obtained in step 3 were mixed in equal volumes, purified using AMPure XP magnetic beads at a ratio of 1:1.5, and then eluted with 50 μl of DNase / RNase-Free Water to obtain the second round of purified products, which are sequencing libraries suitable for sequencing on the Illumina HiSeq X platform.

[0206] Example 4: Determining the authenticity of mutations in targeted amplification sequencing results of the flushing fluid library

[0207] The flushing liquid sequencing library obtained according to "Example 3" was sequenced on a sequencer to obtain the corresponding data volume. After bioinformatics analysis, the mutation results of the target site were obtained (Table 19).

[0208] Table 19. List of mutation results of target patient flushing fluid

[0209]

[0210]

[0211]

[0212]

[0213] The rinsate libraries from "Standard DNA 1, Standard DNA 2, Standard DNA 3, and Standard DNA 4" in Table 19 were amplified using primer combinations specific to the "target patient" and subjected to the same data analysis process. This served as the basis for determining the authenticity of rinsate mutations from the "target patient" and their inclusion in subsequent analyses. The primer combinations used for amplification, "GSP1A mix, GSP1B mix, GSP2A mix, and GSP2B mix," were designed based on the target patient's tumor tissue mutations. The tumor mutations for which the primers were designed were not present in "Standard DNA 1, Standard DNA 2, Standard DNA 3, and Standard DNA 4," meaning that they did not harbor mutations at the same position and / or of the same type at that position. According to the principle of judging the authenticity of mutations detected in rinsate: when the mutation type at this point in the rinsate of the "target patient" is consistent with the mutation type in their tumor tissue, and the number of supporting reads for the mutation is greater than the number of reads for the same type of mutation at this site in "Standard DNA 1, Standard DNA 2, Standard DNA 3, and Standard DNA 4," the mutation is considered true (positive), marked as "True" in the "True / False" column, and included in the subsequent calculation of tumor cell proportions. When the mutation frequency and supporting reads at this point in the rinsate of the "target patient" are 0, the mutation frequency and supporting reads at this point are recorded as 0 in the subsequent calculation of tumor cell proportions, and marked as "0" in the "True / False" column. Mutations marked as "True" in the "Mutation Authenticity" column in Table 19 are included in the subsequent calculation of tumor cell proportions, while those marked as "0" are included in the calculation of tumor cell proportions with a mutation frequency and mutation read count of 0.

[0214] Example 5: Calculation of the proportion of tumor cells in the flushing fluid

[0215] According to Example 4, the mutation results of the flushing fluid of the target patient were analyzed. Mutations marked as "true" in the "Mutation True or False" column in Table 19 were included in the subsequent tumor cell ratio calculation, and those marked as "0" were not included in the tumor cell ratio calculation.

[0216] We calculated the proportion of tumor cells in the peritoneal lavage fluid based on the number of mutations detected in the target patient's lavage fluid, the mutation frequency in the lavage fluid, and the maximum mutation frequency in the patient's tumor tissue. The calculation method is as follows:

[0217] Calculate the average mutation frequency of all the mutations in the flushing fluids judged as "true" in Table 19, that is, the average mutation frequency in the flushing fluid = the mutation frequency in the flushing fluids of all "true" mutations and / the number of mutations in the flushing fluids of all "true" mutations;

[0218] The proportion of tumor cells in the rinsing fluid was calculated using the average mutation frequency of the rinsing fluid and the maximum mutation frequency of the tumor tissue, that is, the proportion of tumor cells in the rinsing fluid = the average mutation frequency of the rinsing fluid * the maximum mutation frequency of the tumor tissue;

[0219] The mutation in the rinsing fluid judged to be “true” is the mutation judged to be a true mutation in the above-mentioned “True or false judgment of mutation detected in rinsing fluid sample DNA”.

[0220] After the above steps, the proportion of tumor cells in the flushing fluid of the target patient is 0.02245362.

[0221] Example 6: Evaluation of the predictive ability of personalized mutation detection in lavage fluid for peritoneal metastasis of gastric cancer.

[0222] We collected peritoneal lavage fluid, tumor tissue, and blood from 98 gastric cancer patients. We constructed a library of the lavage fluid samples from gastric cancer patients according to the steps of Example 1, then designed primers for tumor-specific mutations according to Example 2, then performed targeted amplification and sequencing library construction using tumor-specific primers according to Example 3, determined the authenticity of mutations based on the targeted amplification sequencing results of the lavage fluid library according to Example 4, calculated the proportion of tumor DNA in the lavage fluid according to Example 5, and finally evaluated the ability of the proportion of tumor cells in the lavage fluid to predict peritoneal metastasis in patients. The flowchart for personalized panel design, targeted amplification, and prediction of peritoneal metastasis for gastric cancer patients is shown below. Figure 1 As shown: Figure 1 A personalized peritoneal lavage fluid testing panel and data analysis flowchart for gastric cancer patients were designed, which included collecting tumor tissue, blood, and peritoneal lavage fluid from gastric cancer patients; extracting DNA from tumor tissue, blood, and peritoneal lavage fluid and building libraries; performing exome sequencing on tumor tissue and blood leukocyte libraries and analyzing mutations; selecting target patient-specific mutation sites and designing primer combinations; performing primer combination amplification and sequencing in the peritoneal lavage fluid library; analyzing the peritoneal lavage fluid sequencing results to determine whether the mutation is true; and calculating the proportion of tumor cells in the peritoneal lavage fluid to predict the risk of peritoneal metastasis.

[0223] Based on the non-tumor mutations of 20 detection targets in the peritoneal lavage fluid of gastric cancer patients, we used the calculation method of tumor cell proportion to calculate the biological background noise of non-specific mutations in the peritoneal lavage fluid of 98 patients (Table 20).

[0224] Table 20. Calculation of biological background noise for nonspecific mutations in 98 patients

[0225]

[0226] The calculated biological background noise threshold for nonspecific mutations in the 98 patients listed in Table 20 was less than 0.01%. Therefore, we defined a peritoneal lavage tumor cell ratio greater than 0.01% as a positive peritoneal lavage tumor cell ratio, and a peritoneal lavage tumor cell ratio less than or equal to 0.01% as a negative peritoneal lavage tumor cell ratio. A positive peritoneal lavage tumor cell ratio predicts peritoneal metastasis, while a negative peritoneal lavage tumor cell ratio predicts the absence of peritoneal metastasis. The peritoneal lavage tumor cell ratio test results and patient prognoses for these 98 patients are shown in Table 20.

[0227] Table 20. Percentage of tumor cells in peritoneal lavage fluid and prognosis of 98 patients

[0228]

[0229]

[0230] In Table 20, the patients marked "Accurate" in the "Prediction Effect" column have peritoneal lavage fluid tumor cell ratio test results that are consistent with the patient's prognosis: when the patient's peritoneal lavage fluid tumor cell ratio test is positive (greater than 0.01%), the patient developed peritoneal metastasis during follow-up; or when the patient's peritoneal lavage fluid tumor cell ratio test is negative (less than or equal to 0.01%), the patient did not develop peritoneal metastasis during follow-up. The patients marked "Inaccurate" in the "Prediction Effect" column have peritoneal lavage fluid tumor cell ratio test results that are inconsistent with the patient's prognosis: when the patient's peritoneal lavage fluid tumor cell ratio test is positive (greater than 0.01%), the patient did not develop peritoneal metastasis during follow-up; or when the patient's peritoneal lavage fluid tumor cell ratio test is negative (less than or equal to 0.01%), the patient developed peritoneal metastasis during follow-up. Based on the results of peritoneal lavage tumor cell ratio testing in 98 gastric cancer patients and their prognoses, we calculated that the peritoneal lavage tumor cell ratio for predicting peritoneal metastasis had a sensitivity of 100%, a specificity of 85%, a positive predictive value of 71%, and a negative predictive value of 100% (Table 21). We also compared the peritoneal lavage tumor cell ratio test with the commonly used clinical cytology test for predicting peritoneal metastasis. The cytology-based diagnosis had a sensitivity of 30%, a specificity of 94%, a positive predictive value of 67%, and a negative predictive value of 78%. The specific comparison results are shown in Table 21.

[0231] Table 21. Comparative analysis of the diagnostic performance of peritoneal lavage tumor cell ratio and cytology

[0232] parameter Sensitivity (%) Specificity (%) Positive predictive value (%) Negative predictive value (%) Tumor cell ratio 100 85 71 100 cytology 30 94 67 78

[0233] The method of individualized detection of tumor-specific mutations based on peritoneal lavage fluid can effectively predict peritoneal metastasis, and performs better than conventional clinical cytological detection methods in terms of sensitivity, positive predictive value and negative predictive value. It can predict the prognosis of patients with gastric cancer during surgery, help patients to undergo clinical intervention in the early stage of peritoneal metastasis, thereby prolonging the patient's survival time and improving the patient's quality of life.

Claims

1. A primer combination for predicting tumor mutations in the DNA sample of the lavage fluid of gastric cancer patients with peritoneal metastasis detection, wherein the primers in the primer combination are the primers shown in SEQ ID NOs: 47 - 126.

2. Use of the primer combination defined in claim 1 in the preparation of a kit for predicting peritoneal metastasis by detecting tumor - specific mutations in the peritoneal lavage fluid of gastric cancer patients.

Citation Information

Patent Citations

  • Method for detecting variation and methylation of tumor specific genes in ctDNA

    CN112176419A