Human y-chromosome str typing detection method based on amplicon sequencing
By designing amplification primers using the NGS platform and two-step PCR method, and combining them with magnetic bead screening technology, the limitations of the number of STRs and insufficient resolution in existing Y-STR detection technologies have been solved, achieving efficient and sensitive Y-STR detection and providing more in-depth genetic information.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-31
- Publication Date
- 2026-04-07
AI Technical Summary
Existing technologies for Y-STR detection suffer from limitations in the number of STRs that can be detected, insufficient resolution, and sample type restrictions, especially in capillary electrophoresis sequencing where it is difficult to distinguish allele sequence polymorphisms.
193 Y-STR loci were detected using an NGS platform. Amplification primers were designed using a two-step PCR method and magnetic bead screening technology was used. Data analysis was performed using next-generation sequencing to achieve high-throughput and high-sensitivity detection.
It enables simultaneous detection of 193 Y-STR loci, improving detection efficiency and sensitivity, and providing more in-depth genetic information by analyzing mixed and degraded materials.
Smart Images

Figure CN115896300B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetics and relates to a method for typing and detecting human chromosomes, particularly a method for typing and detecting human Y chromosome STRs. Background Technology
[0002] STRs (Short Tandem Repeats / Microsatellites) are widely distributed in the genomes of humans and mammals. They typically consist of 1-6 base pairs forming a repeat unit, and the number of repeat units determines STR polymorphism. Y-STRs refer to short tandem repeat sequences located on the Y chromosome. Male individuals within the same family, such as brothers, fathers and sons, uncles and nephews, cousins, and grandparents and grandchildren, usually have the same Y-STRs, except for a few cases of repeat unit number or base mutations. my country's Ministry of Public Security has recommended 20 core loci and 15 preferred loci as Y-STRs for applications such as paternity testing, individual identification in disaster and accident situations, analysis of individuals from different origins, examination of mixed-sex pigmentation, and criminal investigation.
[0003] The method used by domestic and international judicial institutions for Y-STR testing is capillary electrophoresis (CE). This technology distinguishes alleles by analyzing the size of fluorescently labeled amplification products in capillary electrophoresis. Common testing kits are summarized in Table 1. However, there are many limitations in practical applications, such as: the number of STRs that can be detected simultaneously is limited by the applicable number of fluorescent molecules; the limited resolution of CE makes it difficult to distinguish allele sequence polymorphisms; in order to distinguish different STR sites, the amplification length of the target fragment needs to be increased, which can also affect amplification efficiency and is limited by the type of sample to be tested.
[0004] Table 1 Comparison of some domestic and foreign Y-STR fluorescence detection kits
[0005]
[0006]
[0007] Note: All of the above kits can directly amplify blood spots or saliva spots using filter paper or FTA (Flinders Technology Associates) cards as carriers without template extraction and purification; when the ratio of male to female DNA samples is 1:1000, the Y-STR typing of male DNA can still be accurately detected.
[0008] Currently, next-generation sequencing (NGS) technology is also increasingly being applied to Y-STR detection. Compared to the PCR-CE platform, NGS detection offers significantly improved sample throughput and Y-STR count, and can also obtain other genetic information, such as single nucleotide polymorphisms (SNPs) and insertions / deletions (InDels), when analyzing Y-STR data. A common kit used in China for Y-STR detection using this technology is the AI-Y-STR-Multi Enrichment Kit (iGeneTech), which can detect 20 core Y-STR loci recommended by the Ministry of Public Security of my country. Kayser M et al. (Kayser M, Caglia A, CorachDA, et al. Evaluation of Y-chromosomal STRs: a multicenter study[J]. International journal of legal medicine, 1997, 110(3): 125-133.) have shown that Y-STRs exhibit different genetic polymorphisms in different populations, and the number of Y-STRs included in the detection is positively correlated with the pedigree screening efficiency. Therefore, considering the distribution characteristics of Y-STR genotypes in the Chinese population, it is essential to develop an NGS platform for detecting multiple Y-STRs and a visualization method for data processing and analysis. Summary of the Invention
[0009] The technical problem to be solved by the present invention is to provide a technology and data analysis method for simultaneously detecting 193 Y-STRs in the Chinese population based on the NGS platform.
[0010] This invention has the advantages of rapid amplification, balanced efficiency, high sensitivity, and good data visualization; due to the high depth of high-throughput sequencing, it is more conducive to the analysis of mixed materials and degraded materials.
[0011] To address the aforementioned technical problems, this invention provides 193 Y-STR loci for human Y-chromosome STR typing.
[0012] This invention relates to the selection of 193 Y-STR loci:
[0013] This invention includes 193 Y-STR loci (all of which are known loci) for detection, including 20 core loci recommended by the Ministry of Public Security of China, 15 preferred loci, and other sites that have good amplification effects in multiplex PCR, as detailed in Table 2.
[0014] Table 2. List of 193 Y-STR loci
[0015]
[0016]
[0017] Note: All Y-STRs are named according to the principles recommended by the DNA Committee of the International Society of Forensic Genetics (ISFG). Some alternative names for Y-STRs are indicated in parentheses.
[0018] The present invention also provides the following specific implementation steps:
[0019] Library construction was performed on the 193 selected Y-STRs using a two-step PCR method:
[0020] First, primers for the first round of specific amplification of the target fragment were designed using SnapGene software for 193 Y-STRs (as shown in Table 3).
[0021] Table 3. List of PCR primers for target fragment specificity
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045] Table 3 lists the primers used in the first round of PCR, including the upstream and downstream primers for each locus. The PCR primers had a Tm value of 61-63℃, a GC content of 40%-60%, and a product length of 100-450 bp with a GC content of 20%-45%. Sequence alignment was performed using UCSC (https: / / genome.ucsc.edu / ) to determine the specificity of the amplified products. IDT Oligo Analyzer Tool (https: / / sg.idtdna.com / pages) and Auto Dimer Check software were used to analyze for possible intra- and inter-primer dimers to avoid the generation of non-specific amplification products. To balance PCR amplification efficiency, based on the results of primer design and analysis, the 193 Y-STR loci were divided into three amplification groups (1 / 2 / 3, as shown in Table 3) for the first round of PCR amplification (i.e., target fragment-specific PCR; amplification systems and procedures are detailed in Tables 4 and 5).
[0046] After the first round of PCR, the PCR products were screened with magnetic beads (Table 6) to obtain the target fragments of 150–500 bp.
[0047] Then, PCR primers with index labels were designed according to NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1 / 2). The target fragments screened by magnetic beads were added with index labels through a second round of PCR (i.e., PCR with index labels). The 3' end of the primers for the second round of PCR has the same sequence as the 5' end of the primers for the first round of PCR, which is beneficial for the amplification of the second round of PCR. The primers for the second round of PCR were provided by the NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1 / 2) kit.
[0048] Since the first round of PCR amplification was set up with three amplification groups, the specific target fragments purified by magnetic beads after the first round of PCR for each amplification group were used as DNA templates for the second round of PCR amplification. The PCR reaction system and amplification procedure are detailed in Tables 7 and 8. After two rounds of PCR, PCR products (i.e., libraries) containing index identifiers that can distinguish samples and can be used for next-generation sequencing were obtained. These were then screened with magnetic beads (Table 9) to obtain library fragments of 150 bp or more, and the Qubit concentration was determined. Based on the determined concentration, the three amplification group libraries corresponding to each sample were mixed according to their corresponding primer pair ratios (amplification group 1:2:3 = 51:71:55) to obtain a mixed library, ensuring that the theoretical value of PCR products containing 193 Y-STR sites in each sample in the mixed library was consistent. Finally, the mixed library was subjected to next-generation sequencing using the Illumina sequencing platform and the NovaSeq PE250 (Paired-End, 2×250bp) sequencing mode. The amount of sequencing data required varied depending on the amount of starting DNA template: when the amount of starting DNA template was >20ng, the amount of sequencing data was 1G / sample; when the amount of starting DNA template was 2-20ng, the amount of sequencing data was 1.5G / sample.
[0049] High-fidelity, thermally stable hot-start DNA polymerase (NEB, Q5™ HotStart High-Fidelity DNA Polymerase, M0493S) was used in both the two-step PCR library construction process.
[0050] The template is male genomic DNA, which can be prepared from the following biological samples: blood (blood spots), semen (sperm spots), bones, hair, saliva (saliva spots), sweat, muscle, or tissues and organs. Testing has shown that the initial template amount is 2–100 ng, and in the BIO-RAD S1000... TMAmplification can be achieved on PCR amplification instruments such as Thermal Cycler and ABI ProFlex PCR System.
[0051] Table 4. Target fragment specific PCR amplification reaction system
[0052]
[0053] Table 5. PCR amplification procedure for target fragment specificity
[0054]
[0055] Note: The number of PCR cycles in the second and third steps can be adjusted according to the amount of initial template.
[0056] The adjustment principle is as follows: when 20ng < starting DNA template amount ≤ 100ng, the second and third steps are both 10 cycles; when 2ng < starting DNA template amount ≤ 20ng, the second and third steps are both 15 cycles.
[0057] Using magnetic bead purification technology, AMPure XP beads (Beckman, A63881) were used to perform two rounds of fragment screening on the first-round PCR amplification products (i.e., target fragment-specific PCR amplification) obtained above, thereby obtaining specific target fragments of 150–500 bp. See Table 6 for details.
[0058] Table 6. Screening of target fragment-specific PCR amplification products with magnetic beads
[0059]
[0060] illustrate:
[0061] 1. Before magnetic bead purification, remove the magnetic beads 30 minutes in advance and allow them to equilibrate to room temperature before performing the first round of fragment screening: Add the corresponding components according to Table 6, pipette to thoroughly resuspend the magnetic beads, let them stand for 5 minutes, and then place them on a magnetic rack for 10 minutes until the solution becomes clear. At this point, DNA fragments longer than 500 bp will adsorb onto the magnetic beads by forming an "electric bridge" with the carboxyl groups on the magnetic beads under the action of sodium ions through the negatively charged phosphate groups. Transfer all supernatant (approximately 73 µL) to a new centrifuge tube and discard the magnetic beads (i.e., remove DNA fragments longer than 500 bp).
[0062] 2. Perform a second round of fragment screening on the supernatant retained in step 1: Add the corresponding components according to Table 6, pipette to thoroughly resuspend the magnetic beads, let stand for 5 minutes, then place on a magnetic rack for 10 minutes until the solution is clear. At this time, DNA fragments of 150-500 bp will be adsorbed onto the magnetic beads by forming an "electric bridge" with the carboxyl groups on the magnetic beads under the action of sodium ions through the negatively charged phosphate groups. Discard all the supernatant with a pipette and retain the magnetic beads (i.e., remove DNA fragments below 150 bp and retain the target DNA fragments of 150-500 bp).
[0063] 3. Add 200 µL of 75% ethanol to wash the magnetic beads retained in step 2 twice (do not blow or agitate). After washing, discard all the supernatant and allow the ethanol to evaporate completely at room temperature.
[0064] 4. Elute the target DNA fragment adsorbed by the magnetic beads after washing with ethanol in step 3 above: Add 20 µL of EB buffer, pipette to thoroughly resuspend the magnetic beads, let stand for 2 min, then place on a magnetic rack for 10 min until the solution is clear. At this time, the target fragment of 150-500 bp will dissociate from the magnetic beads into the supernatant. Use a pipette to aspirate 18 µL of the supernatant into a new centrifuge tube and place it on ice for later use as a template for the second round of PCR (introducing index-labeled PCR).
[0065] Then, PCR primers with index identifiers were designed according to NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1 / 2). i501-i516 were forward primers containing the index, and i701-i724 were reverse primers containing the index. The primer sequences for i501-i508 and i701-i712 were provided by NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1), while the primer sequences for i509-i516 and i713-i724 were provided by NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 2). The 3' end sequence of the second-round PCR primers was identical to the 5' end sequence of the first-round PCR primers, which facilitated the amplification of the second-round PCR. Combining i501-i516 Primers and i701-i724 Primers ensures that each sample has a unique index identifier combination (e.g., i501 / i701 is one combination), facilitating intra-sample Y-STR identification based on index identifiers and specific primers during data analysis. Therefore, the primers provided by NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1 / 2) can be combined using forward and reverse primers, resulting in a maximum of 16*24=384 combinations. This allows for the pooling of 384 libraries containing different index identifier combinations into a single library for sequencing.
[0066] Note: Primers were derived from two NEBNext® Multiplex Oligos for Illumina® kits. Among them,
[0067] Primer sequences i501-i508 and i701-i712 were provided by Dual Index Primers Set 1. Primer sequences i509-i516 and i713-i724 were provided by Dual Index Primers Set 2.
[0068] Table 7. Introduction of indexes to identify PCR reaction systems
[0069]
[0070] Table 8. Introducing indexes to identify PCR reaction procedures
[0071]
[0072] Note: The number of PCR cycles in the second step can be adjusted according to the amount of initial template.
[0073] The adjustment principle is as follows: when the amount of starting DNA template is >20ng, the second step consists of 10 cycles; when the amount of starting DNA template is 2-20ng, the second step consists of 11 cycles.
[0074] Using magnetic bead purification technology, AMPure XP beads (Beckman, A63881) were selected to screen fragments from the second round of PCR amplification (i.e., PCR amplification with index markers) products obtained above, thereby obtaining library fragments larger than 150 bp. See Table 9 for details.
[0075] Table 9. Screening of PCR products using magnetic beads with index identifiers
[0076]
[0077] illustrate:
[0078] 1. Before purifying the magnetic beads, remove them 30 minutes in advance and allow them to equilibrate to room temperature before screening the fragments: Add the corresponding components according to Table 9, pipette to thoroughly resuspend the magnetic beads, let them stand for 5 minutes, and then place them on a magnetic rack for 10 minutes until the solution becomes clear. At this point, library fragments larger than 150 bp will adsorb onto the magnetic beads by forming an "electric bridge" with the carboxyl groups on the magnetic beads under the action of sodium ions through the negatively charged phosphate groups. Discard all the supernatant with a pipette, retaining the magnetic beads (i.e., retaining library fragments larger than 150 bp).
[0079] 2. Add 200 µL of 75% ethanol to wash the magnetic beads retained in step 1 twice (do not blow or agitate). After washing, discard all the supernatant and allow the ethanol to evaporate completely at room temperature.
[0080] 3. Elute the library fragments adsorbed by the magnetic beads after ethanol washing in step 2: Add 20 µL of EB buffer, pipette to resuspend the magnetic beads completely, let stand for 2 min, then place on a magnetic rack for 10 min until the solution is clear. At this time, the library fragments of 150 bp or more will dissociate from the magnetic beads into the supernatant. Use a pipette to aspirate 18 µL of the supernatant into a new centrifuge tube and place it on ice for later use.
[0081] The Qubit concentration of the library products obtained after fragment screening was determined. Based on the concentration, the three amplicon libraries corresponding to each sample were mixed according to their corresponding primer pair ratios (amplicon 1:2:3 = 51:71:55) to obtain a mixed library, ensuring that the theoretical value of PCR products containing 193 Y-STR loci in each sample of the mixed library was consistent. The mixed library was sent to a sequencing company for next-generation sequencing using the Illumina sequencing platform and the NovaSeq PE250 (Paired-End, 2×250bp) sequencing mode. The sequencing data volume varied depending on the starting DNA template amount: when the starting DNA template amount was >20ng, the sequencing data volume was 1G / sample; when the starting DNA template amount was 2–20ng, the sequencing data volume was 1.5G / sample. Finally, based on the obtained sequencing data, samples were first distinguished according to the index identifier in the fragment to ensure that the sequencing results came from the same sample source; then, the sequencing depth and sequence of the amplified sequence in the same sample were analyzed according to the target fragment specific PCR primers (Table 3), and the genetic information between samples was compared.
[0082] The key technical points of this invention are as follows:
[0083] 1. Multiplex amplification and library preparation techniques for 193 Y-STRs, including primer design and reaction conditions:
[0084] The library construction technique of the present invention includes a first round of PCR amplification, screening of the target fragments by magnetic beads from the first round of PCR amplification products, a second round of PCR amplification of the screened target fragments, screening of the products after the second round of PCR amplification, and mixing the final product with the number of target fragments in equal proportions. The mixed product is a sequencing library.
[0085] 2. NGS data analysis methods:
[0086] This invention targets second-generation sequencing data. First, samples are distinguished based on the index identifier in the fragment to ensure that the sequencing results are from the same sample source. Then, the sequencing depth and sequence of the amplified sequence in the same sample are analyzed based on the target fragment-specific PCR primers (Table 3), and the genetic information between samples is compared.
[0087] The beneficial effects of the technical solution of this invention include:
[0088] 1. This invention can simultaneously detect 193 Y-STRs from a single male DNA sample, exceeding the number of Y-STRs detected by Goldeneye based on CE technology. ®The DNA identification system Y-Plus (Peoplespot) has 41 Y-STRs, and the AI-Y-STR-Multi Enrichment Kit (iGenetech) based on NGS technology has 20 Y-STRs.
[0089] 2. The target fragment amplification primers of the present invention (Table 3) have strong amplification specificity and can be applied to DNA from different sources such as blood and different amounts of starting template. Good library construction results can be obtained by using different models of PCR instruments.
[0090] 3. This invention uses NGS detection technology to analyze changes in the number of repeating units and base mutations in Y-STRs, which can reveal the variation of Y-STRs in greater depth.
[0091] 4. This invention uses NGS detection technology, which has high throughput and can detect 384 samples at a time. Attached Figure Description
[0092] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0093] Figure 1 A graph showing the amplification effect of samples from the same family.
[0094] The amplification results were relatively consistent among samples from the same family, with most sequencing depths exceeding 100×. X-axis: 193 Y-STRs shared 172 primer pairs; Y-axis: sequencing depth.
[0095] Figure 2 A schematic diagram of Y-STRs showing repetitive sequence differences within the same family sample—DYS572;
[0096] The reference genome sequence for DYS572 is [AAAT]n (n=10); Grandfather: n=8; Father: n=10; Son: n=10. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results.
[0097] Original Sequence: UCSC reference genome sequence (AC012078); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results.
[0098] Figure 3 A graph showing the amplification effect of blood card samples;
[0099] The amplification effects among blood card samples were relatively consistent, with sequencing depths mostly above 100×. X-axis: 193 Y-STRs shared 172 primer pairs; Y-axis: sequencing depth.
[0100] Figure 4 A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS437;
[0101] The reference genome sequence for DYS437 is [TCTA]n[TCTG]2[TCTA]4 (n=9); NT1: n=9; NT2: n=10. Compared with the reference sequence, one base G was mutated to A in two samples. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC002992); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results.
[0102] Figure 5 A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS448;
[0103] The reference genome sequence for DYS448 is [AGAGAT]nN42[AGAGAT]m (n=11, m=8); NT1: n=11, m=8; NT2: n=11, m=9. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC025227); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results. This figure only shows some repetitive sequence information for DYS448.
[0104] Figure 6 A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS635;
[0105] The reference genome sequence for DYS635 (Y-GATA-C4) is [TCTA]4[TGTA]2 [TCTA]2[TGTA]n[TCTA]2[TGTA]m[TCTA]p (n=2, m=2, p=9); NT1: n=1, m=0, p=9; NT2: n=2, m=0, p=10. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC245171); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results. This figure only shows the partial repetitive sequence information of DYS635 (Y-GATA-C4).
[0106] Figure 7 A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS568;
[0107] The reference genome sequence for DYS568 is [AAAT]n (n=11); NT1: n=10; NT2: n=11. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC007967); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results.
[0108] Figure 8 A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS570;
[0109] The reference genome sequence for DYS570 is [TTTC]n (n=17); NT1: n=18; NT2: n=19. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC012068); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results. This figure only shows some repetitive sequence information from DYS570.
[0110] Figure 9 A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS622;
[0111] The reference genome sequence for DYS622 is [GAAA]nN5[GAAA]m (n=6, m=13); NT1: n=6, m=12; NT2: n=6, m=11. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC017020); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results. This figure only shows some repetitive sequence information for DYS622.
[0112] Figure 10 A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS576;
[0113] The reference genome sequence for DYS576 is [AAAG]n (n=17); NT1: n=17; NT2: n=19. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC010104); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results. This figure only shows some repetitive sequence information for DYS576.
[0114] Figure 11A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS460;
[0115] The reference genome sequence for DYS460 is [ATAG]n (n=10); NT1: n=10; NT2: n=11. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC009235); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results.
[0116] Figure 12 A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS557;
[0117] The reference genome sequence for DYS557 is [TTTC]n (n=16); NT1: n=16; NT2: n=14. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC007876); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results.
[0118] Figure 13 A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS534;
[0119] The reference genome sequence for DYS534 is [CTTT]n (n=15); NT1: n=16; NT2: n=15. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC053516); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results.
[0120] Figure 14 A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS578;
[0121] The reference genome sequence for DYS578 is [AAAT]n (n=9); NT1: n=10; NT2: n=8. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC009240); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results.
[0122] Figure 15 A schematic diagram of Y-STRs showing repetitive sequence differences in blood karyotes—DYS556;
[0123] The reference genome sequence for DYS556 is [AATA]n (n=11); NT1: n=11; NT2: n=10. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC011745); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results.
[0124] Figure 16 This is a pedigree chart comparing the method of this invention with the capillary electrophoresis detection method.
[0125] Figure 17 This is a graph comparing the amplification effect of the method of this invention with that of capillary electrophoresis detection;
[0126] The amplification effect of the method of this invention is consistent with that of capillary electrophoresis detection method, and the sequencing depth is mostly above 100×. X-axis: 193 Y-STRs share 172 primer pairs; Y-axis: sequencing depth.
[0127] Figure 18 This is a schematic diagram of Y-STRs showing differences in repetitive sequences when comparing the method of this invention with the capillary electrophoresis detection method—DYS635;
[0128] The reference genome sequence for DYS635 (Y-GATA-C4) is [TCTA]4[TGTA]2 [TCTA]2[TGTA]n[TCTA]2[TGTA]m[TCTA]p (n=2, m=2, p=9); E1: n=2, m=0, p=11; E7: n=2, m=0, p=12. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC245171); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results.
[0129] Figure 19 This is a schematic diagram of Y-STRs showing differences in repetitive sequences when comparing the method of this invention with the capillary electrophoresis detection method—DYS513;
[0130] The reference genome sequence for DYS513 is [TATC]aCA[TATC]bCG[TATC]c (a=4, b=3, c=12); E1: a=4, b=3, c=13; E3: a=4, b=3, c=14. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC007007); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results; F: forward sequencing; R: reverse sequencing.
[0131] Figure 20 This is a schematic diagram of Y-STRs showing differences in repetitive sequences when comparing the method of this invention with the capillary electrophoresis detection method—DYS572;
[0132] The reference genome sequence for DYS572 is [AAAT]n (n=10); E1: n=9; E7: n=10; E9: n=10. The bioinformatics analysis results are completely consistent with the first-generation sequencing validation results. Original Sequence: UCSC reference genome sequence (AC012078); Sanger seq: first-generation sequencing validation results; NGS: bioinformatics analysis results. Detailed Implementation
[0133] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:
[0134] Example 1: Y-STR testing of the same family
[0135] 1) Prepare the first round of PCR (i.e., PCR amplification of the target fragment) reaction system by adding 5 µL of whole blood DNA samples (concentration of 20 ng / µL) from the same family line (grandfather, father, son).
[0136] That is, perform the following steps (2) to (6) on the whole blood DNA samples of the grandfather, father, and son respectively:
[0137] 2) Amplify the target fragment:
[0138] Using the target fragment-specific PCR primers described in Table 3, PCR amplification was performed according to the target fragment-specific PCR amplification reaction system described in Table 4 and the target fragment-specific PCR amplification reaction procedure described in Table 5. The number of cycles for steps two and three in Table 5 is 10.
[0139] Three amplification groups were set up for each sample.
[0140] 3) Screening of PCR product fragments targeting the target fragment:
[0141] The screening conditions were as follows: AMPure XP beads (Beckman, A63881) were used, and the PCR products obtained in step 2) were screened using magnetic beads according to the magnetic bead screening process for the target fragment PCR amplification products described in Table 6. Finally, 18 µL of the target fragment with a size of 150–500 bp was obtained.
[0142] Each amplification group obtained its own target fragment.
[0143] 4) Perform a second round of PCR (i.e., PCR with index identifiers) amplification on the selected target fragments (150-500 bp in size) obtained in step 3). Introduce index identifier combinations that can distinguish samples; that is, assign a specific index identifier to each sample.
[0144] The target fragment (obtained in step 3 above) after screening with magnetic beads was amplified by PCR using PCR primers with index markings from NEBNext® MultiplexOligos for Illumina® (Dual Index Primers Set 1 / 2) according to the PCR reaction system with index markings in Table 7 and the PCR reaction procedure with index markings in Table 8.
[0145] The second step in Table 8 has 10 loops.
[0146] 5) Introduce index-identified PCR product fragment screening and Qubit quantification:
[0147] The screening criteria were as follows: AMPure XP beads (Beckman, A63881) were used, and the PCR products obtained in step 4) were screened using the magnetic bead screening procedure with index-based PCR products as described in Table 9. This resulted in 18 µL of library products with fragment sizes greater than 150 bp. The final product was then processed using Qubit (Thermo Fisher Scientific, Qubit...). ® Quantification using dsDNA HSAssay Kits (Q32854).
[0148] 6) Mix the libraries from the three amplification groups of each sample according to the primer pair ratio of the amplification groups:
[0149] Based on the concentration measured by Qubit in step 5), the three amplification group libraries corresponding to each sample are mixed according to their corresponding primer pair ratio (amplification group 1:2:3 = 51:71:55) to obtain a mixed library, so that the theoretical value of PCR products containing 193 Y-STR sites in each sample of the mixed library is consistent.
[0150] 7) Perform next-generation sequencing on each mixed library:
[0151] Next-generation sequencing was performed on the mixed library obtained in step 6). The sequencing platform was Illumina, and the sequencing mode was NovaSeq PE250 (Paired-End, 2×250bp). The total sequencing data of the three samples was 3G.
[0152] 8) Next-generation sequencing data analysis:
[0153] For the sequencing data obtained in step 7), samples are first distinguished according to the index identifier in the fragment to ensure that the sequencing results are from the same sample source; then, the sequencing depth and sequence of the amplified sequence in the same sample are analyzed according to the target fragment specific PCR primers (Table 3), and the genetic information between samples is compared.
[0154] This allowed us to obtain the Y-STR locus that showed differences among the three samples: "grandfather," "father," and "son"—DYS572.
[0155] 9) Perform first-generation sequencing to verify Y-STR loci with individual differences in genetic information within the same family lineage (i.e., grandfather, father, son).
[0156] Specifically, the amplified genome library (purified with magnetic beads) containing the Y-STR loci with different genetic information in step 5) is selected, serially diluted 10,000 times, and PCR amplification is performed using the target fragment-specific PCR primers described in Table 3, according to the first-generation sequencing PCR amplification reaction system described in Table 10 and the first-generation sequencing PCR amplification reaction procedure described in Table 11.
[0157] Table 10 First-generation sequencing PCR amplification reaction system
[0158]
[0159] Table 11. First-generation sequencing PCR amplification reaction procedure
[0160]
[0161] 10) Results Analysis:
[0162] Y-STR amplification efficiency analysis of different samples from the same family, as follows: Figure 1 As shown, the amplification efficiency among samples is relatively consistent, and the sequencing depth is mostly above 100×, indicating that the method of the present invention can achieve balanced and effective amplification of samples such as whole blood DNA.
[0163] The results showed that 192 out of 193 Y-STRs in this family were identical. When DYS572 was passed from grandfather to father, two additional repeat units (AAAT) were added, and the father passed this variation on to his son, meaning that the genetic information of the father and son's 193 Y-STRs was identical. This indicates that Y-STRs can be stably inherited within the same family, which is beneficial for paternity testing and pedigree tracing; however, due to the existence of repeat unit number or base mutations, Y-STR haplotypes in different male individuals exhibit a certain degree of polymorphism.
[0164] The results of this method analysis, the first-generation sequencing validation results, and the UCSC reference genome sequence (https: / / genome.ucsc.edu / ; Human GRCh38 / hg38; AC012078) were compared, and the results are as follows: Figure 2 As shown, the NGS analysis results and the first-generation sequencing validation results are completely consistent.
[0165] Based on this Example 1, it can be demonstrated that the method of the present invention can achieve multiplex amplification and sequence analysis of 193 Y-STRs in male whole blood DNA, further verifying the analysis data of three male samples from the same family, proving that the method of the present invention can ensure the accuracy of the test results.
[0166] Example 2: Y-STR detection of blood card samples
[0167] DNA was extracted from two unrelated male blood card samples (NT1, NT2) from the same village according to the QIAamp® DNAInvestigator Handbook, and then a library was constructed following the procedure in Example 1:
[0168] Specifically as follows:
[0169] 1) Prepare the first round of PCR (i.e., PCR amplification of the target fragment) reaction system by adding 15 µL of blood card DNA samples of NT1 and NT2, with concentrations of 0.17 ng / µL and 0.144 ng / µL, respectively.
[0170] Perform the following steps (2) to (6) on the blood DNA samples from NT1 and NT2 respectively:
[0171] 2) Amplify the target fragment:
[0172] The number of cycles in steps two and three in Table 5 increased from 10 in Example 1 to 15 because the DNA sample size was approximately 2 ng; the rest were the same as step 2 in Example 1.
[0173] 3) Screening of PCR product fragments targeting the target fragment:
[0174] (Equivalent to step 3 of Example 1); each amplification group obtains its corresponding target fragment.
[0175] 4) Perform a second round of PCR (i.e., PCR with index identifiers) on the target fragments obtained in step 3), introducing index identifier combinations that can distinguish samples; that is, each sample is assigned its own specific index identifier:
[0176] The number of loops in the second step of Table 8 increases from 10 in Implementation Case 1 to 11; the rest is the same as step 4 of Implementation Case 1.
[0177] 5) Introduce index-identified PCR product fragment screening and Qubit quantification:
[0178] (Equivalent to step 5 of Example 1).
[0179] 6) Mix the libraries from the three amplification groups of each sample according to the primer pair ratio of the amplification groups:
[0180] This is equivalent to step 6 of Example 1.
[0181] 7) Perform next-generation sequencing on each mixed library:
[0182] (Equivalent to step 7 of Example 1); the total sequencing data volume of the two samples is 3G;
[0183] 8) Next-generation sequencing data analysis:
[0184] (Equivalent to step 8 of Example 1); thereby obtaining the 12 Y-STR sites that differ between the two samples “NT1” and “NT2”.
[0185] 9) Perform first-generation sequencing to verify the genetic information differences between NT1 and NT2 Y-STRs.
[0186] (Equivalent to step 9 of Example 1).
[0187] 10) Results Analysis:
[0188] The Y-STR amplification efficiency of the two blood card samples is as follows: Figure 3As shown, the amplification efficiency among samples was relatively consistent, and the sequencing depth was mostly above 100×, indicating that the method of this invention can achieve balanced and effective amplification of trace samples such as blood swab DNA. The analysis results (Table 12) are as follows: 181 Y-STRs showed complete genetic information consistency between NT1 and NT2, while 12 Y-STRs showed differences in the number of repeat units or base pairs. This indicates that some Y-STRs exhibit polymorphism among different individuals, and detection can clarify the differences between individuals and help determine whether they are related. The analysis results of this method, the first-generation sequencing verification results, and the UCSC reference genome sequence (https: / / genome.ucsc.edu / , Human GRCh38 / hg38) were compared, and the results are as follows: Figure 4-15 As shown in Table 12, the NGS analysis results and the first-generation sequencing validation results are completely consistent.
[0189] Table 12 Summary of Y-STR validation results for repetitive sequence differences in blood karyotes.
[0190]
[0191] Based on this Example 2, it can be demonstrated that the method of the present invention can achieve multiplex amplification and sequence analysis of 193 Y-STRs in trace samples such as male blood cards, further verifying the analysis data of blood card samples, indicating that the method can be applied to samples with a small amount of DNA and can ensure the accuracy of the test results.
[0192] Example 3: Comparison of the method of the present invention with capillary electrophoresis detection method
[0193] 1) Prepare the first-round PCR (i.e., PCR amplification of the target fragment) reaction system by adding 1 µL of whole blood DNA samples (concentration of 20 ng / µL for each of the five male members of the same family). See the family pedigree chart for details. Figure 16 .
[0194] That is, perform the following steps 2) to 6) on DNA samples from the same family:
[0195] 2) Amplify the target fragment:
[0196] The number of cycles in steps two and three in Table 5 increased from 10 in Example 1 to 15 because the DNA sample size was 20 ng. The rest is the same as step 2 in Example 1.
[0197] 3) Screening of PCR product fragments for the target fragment:
[0198] (Equivalent to step 3 of Example 1), each amplification group obtains its corresponding target fragment.
[0199] 4) Perform a second round of PCR (i.e., PCR with index identifiers) amplification on the selected target fragments obtained in step 3), introducing index identifier combinations that can distinguish samples; that is, each sample is assigned its own specific index identifier.
[0200] The number of cycles in the second step of Table 8 is increased from 10 in Example 1 to 11; the rest is the same as step 4 in Example 1.
[0201] 5) Introduce index-identified PCR product fragment screening and Qubit quantification.
[0202] (Equivalent to step 5 of Example 1).
[0203] 6) Mix the libraries of the three amplification groups of each sample according to the ratio of primer pairs of the amplification groups.
[0204] (Equivalent to step 6 of Example 1).
[0205] 7) Perform next-generation sequencing on each mixed library:
[0206] (Equivalent to step 7 of Example 1); the total sequencing data of the 5 samples was 7.5 G.
[0207] 8) Next-generation sequencing data analysis.
[0208] This allowed us to obtain the Y-STR loci that differed among the five samples from five male members of the same family.
[0209] 9) Capillary electrophoresis was performed on 5 male members of the same family:
[0210] Goldeneye, containing 41 Y-STRs, was selected based on PCR-CE technology. ® The Y-Plus DNA Identification System Kit (Peoplespot) was used to perform capillary electrophoresis on DNA samples from five male members of the same family line. The testing methods and procedures were performed according to the kit's instructions.
[0211] 10) First-generation sequencing was performed to verify the genetic information differences between the Y-STRs detected by the method of this invention and the capillary electrophoresis detection method:
[0212] (Equivalent to step 9 of Example 1).
[0213] 11) Results Analysis:
[0214] Y-STR amplification results of 5 male samples from the same family as follows Figure 17As shown, the amplification efficiency among the samples was relatively consistent, and the sequencing depth was mostly above 100×. The analysis results (Table 13) are as follows: This family contains 5 pairs of fathers and sons (E1 / E3, E1 / E7, E1 / E9, E3 / E5, E3 / E6).
[0215] The results of capillary electrophoresis showed that only the genetic information of the core locus DYS635 in E1 / E7 differed between father and son (when DYS635 was passed from father E1 to son E7, an increase of 1 repeat unit (TCTA) occurred), while the genetic information of the other 4 father-son pairs was completely consistent and stably inherited.
[0216] The method of this invention can not only detect the difference in DYS635 genetic information between father and son in E1 / E7, but also further detect other information: the number of DYS513 repeat units in E1 / E3 increases from 20 in father E1 to 21 in son E3 (an increase of 1 repeat unit (TATC)), and the son inherits this variation information to his offspring (E5, E6); DYS572 does not show any addition or deletion of repeat units when passed from father E1 to son E3, but when passed to sons E7 and E9, an increase of 1 repeat unit (AAAT) occurs. Among 5 father-son pairs, capillary electrophoresis can only distinguish individuals in 1 father-son pair (E1 / E7), while the method of this invention can distinguish individuals in 3 father-son pairs (E1 / E7, E1 / E3, E1 / E9). This indicates that Y-STRs are stably inherited within the same family, which is beneficial for paternity testing and pedigree tracing; however, due to the presence of repeating units or base mutations, Y-STR haplotypes exhibit some polymorphism among different male individuals. The results of this method's analysis, capillary electrophoresis analysis, and first-generation sequencing validation were compared with the UCSC reference genome sequence (https: / / genome.ucsc.edu / , HumanGRCh38 / hg38), and the results are as follows: Figure 18-20 (The figure only shows the alignment results of the method of this invention, first-generation sequencing verification, and UCSC reference genome) and as shown in Table 13, the NGS analysis results, capillary electrophoresis analysis results and first-generation sequencing verification results are completely consistent.
[0217] Table 13 Overview of Y-STR verification results showing repetitive sequence differences in the method of the present invention and the capillary electrophoresis detection method.
[0218]
[0219] Based on this Example 3, it can be demonstrated that the method of the present invention can achieve multiplex amplification and sequence analysis of 193 Y-STRs in males, and can ensure the accuracy of the detection results. Compared with existing capillary electrophoresis kits on the market, the method of the present invention covers more loci, detects richer genetic information, and further improves individual identification capabilities.
[0220] Comparative Example 1-1: The use of DYS572 (a newly added locus based on the 20 core loci and 15 preferred loci recommended by the Ministry of Public Security) from the "193 Y-STR loci" in Table 2 was removed; the rest was the same as in Example 1. The results showed that the genetic information of the 192 Y-STR loci in the same family line (grandfather, father, and son) was completely identical, with no differences in genetic information. Compared to Example 1, this result could identify the grandfather, father, and son as belonging to the same family line during case investigation, but it could not further narrow down the investigation scope or differentiate individuals.
[0221] Comparative Examples 1-2 were used, but the following five Y-STR loci (DYS568, DYS622, DYS534, DYS578, and DYS556) were removed from the "193 Y-STR loci" in Table 2 (these five Y-STRs are newly added loci based on the 20 core loci and 15 preferred loci recommended by the Ministry of Public Security). The rest was the same as in Example 2. The results showed that 181 Y-STRs between NT1 and NT2 had completely identical genetic information, while 7 Y-STRs (all core / preferred loci) showed differences in the number of repeat units or base pairs. Compared to Example 2, the number of Y-STR loci with differing genetic information decreased from 12 to 7. This result still distinguishes NT1 and NT2 from different families, but the evidence for individual differentiation between the two is not as significant as the original data. China has a large population base, and when large-scale family tracing is required for cases spanning provinces and cities, comparing crime scene traces with the Y-STR database often results in a large number of families with similar or nearly identical Y-STR profiles to the suspect if the number of Y-STRs included in the test is small. This poses a significant burden for subsequent investigations and autosomal STR testing to further confirm kinship. The method of this invention covers a wider range of loci and detects richer genetic information, enabling a narrower search scope and even direct identification of suspects. This significantly reduces the consumption of manpower and resources in case investigations.
[0222] Comparative Examples 1-3 were performed without DYS513 and DYS572 (both Y-STRs are new additions to the 20 core loci and 15 preferred loci recommended by the Ministry of Public Security) from the "193 Y-STR loci" in Table 2. The rest was the same as in Example 3. The results showed that, among the 5 father-son pairs, capillary electrophoresis revealed genetic differences in only 1 pair; however, using the method of this invention, the number of father-son pairs with genetic differences decreased from 3 to 1. Compared to Example 3, removing the DYS513 and DYS572 loci significantly reduced individual differentiation.
[0223] Comparative Example 2-1: The primer sequences in DYS527a and DYS527b in Table 3 were changed to “ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCGCAAACATAGCACTTCAGC” and “GACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGATTAGCCACAACATAAGTAAGGTAG”, respectively, with the rest remaining the same as in Example 1. The results showed that 191 Y-STR loci within the same family (grandfather, father, son) yielded complete Y-STR sequence genetic information. However, the Ministry of Public Security's preferred loci DYS527a and DYS527b suffered from inappropriate primer settings, resulting in suppressed amplification efficiency during multiplex PCR amplification and a next-generation sequencing depth of 0, making sequence information unavailable.
[0224] Comparative Example 2-2: The primer sequences for DYF391_1 and DYF391_2 in Table 3 were changed to “ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCAGTGAGCCAAGATCATG” and “GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGATGTGAGTGAGTTCTCTGGAG”, respectively, with the rest remaining the same as in Example 1. The results showed that 191 Y-STR loci within the same family (grandfather, father, son) were able to obtain complete Y-STR sequence genetic information. However, due to improper primer settings, the amplification efficiency of loci DYF391_1 and DYF391_2 was suppressed during multiplex PCR amplification, resulting in a second-generation sequencing depth of 0 and the inability to obtain sequence information.
[0225] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.
Claims
1. A library construction method for 193 Y-STR loci used in human Y-chromosome STR typing, characterized by: The 193 Y-STR loci are as follows: Amplification groups DYS19, DYS385a, DYS385b, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS43 7. DYS448, DYS456, DYS458, DYS635, Y-GATA-H4, DYS438, DYS439, DYS481, DYS533, DYS576; DYS447, DYS527a, DYS527b, DYS596, DYS627, DYS557, DYF387S1a, DYF387S1b, DYS460, DYS444, DYS643, DYS549, DYS570, DYS449, DYS518; DYF371_1、DYF371_2、DYF371_3、DYF371_4、DYS482_1、DYS482_2、DYF382、DYF383_1、DYF383_2、DYF384_1、DYF384_2、DYF384_3、DYF384_4、DYF385_1、DYF385_2、DYS503_1、DYS503_2、DYS503_3、DYS503_4、DYF389、DYF391_1、DYF391_2、DYF392、DYR1、DYR76、DYR88_1、DYR88_2、DYS388、DYS426、DYS434、DYS435、DYS604、DYS436、DYS441、DYS442、DYS445、DYS446、DYS450、DYS453、DYS455、DYS459_1、DYS459_2、DYS461、DYS467、DYS470、DYS472、DYS473、DYS474、DYS476、DYS478、DYS479、DYS480、DYS484、DYS485、DYS486_1、DYS486)_2、DYS488、DYS492、DYS493、DYS475、DYS497、DYS498_1、DYS498_2、DYS499、DYS500_1、DYS500_2、DYS501、DYS502、DYS508、DYS509、DYS510、DYS511、DYS513、DYS517、DYS519_1、DYS519_2、DYS519_3、DYS522、DYS523、DYS525、DYS530、DYS534、DYS535_1、DYS535_2、DYS537、DYS538、DYS539、DYS540、DYS551、DYS556、DYS558、DYS561、DYS562、DYS564_1、DYS564_2、DYS565、DYS566_1、DYS566_2、DYS567、DYS568、DYS569、DYS571、DYS572、DYS573、DYS574、DYS575、DYS577、DYS578、DYS579、DYS580、DYS581、DYS583、DYS584、DYS585、DYS586_1、DYS586_2、DYS587、DYS590、DYS594、DYS595、DYS598、DYS600、DYS606、DYS607、DYS609、DYS610、DYS613、DYS616、DYS617、DYS618、DYS619、DYS620, DYS621, DYS622, DYS623, DYS629, DYS631, DYS632, DYS633, DYS634, DYS637, DYS638, DYS639, DYS641, DYS642, DYS65 5, DYS712, DYS717, DYS719, DYS723, YCAII_1, YCAII_2, DYS413_1, DYS413_2, Y-GATA-A10, Y-GGAAT-1B07, DYS645, DYS593; Library construction was performed using a two-step PCR method for 193 Y-STRs; The primers involved are listed in Table 3.
2. The library construction method according to claim 1, comprising obtaining a DNA sample of the sample to be tested, characterized in that... It also includes the following steps: 1) Amplification of the target fragment; The 193 Y-STR sites were divided into three amplification groups, and the DNA samples of the test samples were subjected to the first round of PCR amplification. The three obtained PCR products were subjected to the following steps 2) to 4). 2) Screening of PCR product fragments for the target fragment: The PCR products obtained in step 1) were screened with magnetic beads to obtain the target fragment of 150-500 bp. 3) Perform a second round of PCR amplification on the 150-500bp target fragment obtained in step 2), introducing index identifier combinations that can distinguish samples, with each sample assigned its own specific index identifier: 4) Screening of the PCR product fragments with introduced index identifiers obtained in step 3); This resulted in three amplicon libraries, each >150bp. 5) Mix the three amplification group libraries corresponding to each sample according to their corresponding primer pair ratios, amplification group 1:2:3 = 51:71:55, to obtain the mixed library.
3. A human Y-chromosome STR typing method based on amplicon sequencing using the mixed library obtained in claim 2, characterized in that... Includes the following steps: Next-generation sequencing was performed on the mixed library using the Illumina sequencing platform and the NovaSeq PE250 sequencing mode. The obtained second-generation sequencing data are analyzed to compare genetic information between samples.
Citation Information
Patent Citations
Composite amplification system based on Y-STR locus and specific primer combination thereof
CN108866201A
Human Y-STR detection method based on next generation sequencing and application thereof
CN112746096A