Nucleic Acid Combined Detection Kit for Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum

Abstract

The present invention relates to a kit for the combined detection of nucleic acids of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum. Specifically, the kit of the present invention uses specific primers and probes for Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum. After reverse transcribing mRNA into DNA using reverse transcriptase, the DNA and RNA of the pathogens are synchronously detected. Moreover, exogenous internal control yeast cells are added during the nucleic acid extraction and amplification processes of the kit of the present invention, which can monitor the nucleic acid extraction and amplification processes throughout, preventing false negative results.

Description

Technical Field

[0001] The present invention relates to a kit for the combined detection of nucleic acids of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum. Specifically, the present invention relates to a multiplex detection system that uses a multiplex fluorescence PCR amplification system to detect Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum with high specificity and high sensitivity. Background Art

[0002] Sexually transmitted diseases are mainly caused by viruses, bacteria, chlamydia, mycoplasma, etc., and are mainly transmitted among people through sexual contact. Secondly, some of them can also be transmitted through indirect contact, blood or mother-to-child transmission. Sexually transmitted diseases can cause great harm to the human body. When there are no symptoms or the symptoms are not obvious, resulting in long-term carriage and failure to be diagnosed and treated in time, various complications and sequelae will occur, and their incidence rate shows an increasing trend year by year.

[0003] These three pathogens, Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG) and Ureaplasma urealyticum (UU), often cause similar urogenital tract infection symptoms. Clinical research results in urology show that infected people with Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum generally have urogenital system symptoms, but there are still some people with asymptomatic carriage infections.

[0004] Asymptomatic carriage of Chlamydia trachomatis is likely to cause ascending infections, such as epididymitis in men, endometritis, salpingitis, pelvic inflammatory disease in women, and transmission to their sexual partners. The detection rate of Chlamydia trachomatis in asymptomatic men is about 4.4%. Neisseria gonorrhoeae usually causes urethritis and dysuria, and the carriage rate of asymptomatic people is only 0.4%. The carriage rate of Ureaplasma urealyticum is relatively high, about 22% in men and higher in women, about 48%. Its pathogenicity is related to its serotype and can cause non-gonococcal urethritis, cervicitis, infertility, etc. under certain conditions. Its pathogenicity is also related to the immunity of the host.

[0005] Chlamydia trachomatis is a type of Gram-negative bacterium that must parasitize in eukaryotic cells to obtain ATP, the energy required for metabolism. The two main types that can infect humans are the trachoma biovar and the lymphogranuloma venereum biovar. Among them, the trachoma biovar can be divided into 14 serotypes, namely A, B, Ba, C, D, Da, E, F, G, H, I, Ia, J, and K, according to the polymorphism of the outer membrane protein OMP1. Among them, serotypes D-K are related to genital infections. Diseases that can be caused by human infection with Chlamydia trachomatis include trachoma, inclusion conjunctivitis, urogenital tract infections, and non-gonococcal urethritis, etc. In a small number of adults, the condition is latent after infection. During pregnancy, most mothers have no obvious symptoms after infection. If not treated in time, it can not only cause infertility, ectopic pregnancy, premature birth, miscarriage, stillbirth, etc., but also cause fetal infection during pregnancy or childbirth, and can be transmitted to the baby through close contact after childbirth. Chlamydia trachomatis infection mainly causes neonatal inclusion conjunctivitis and infant pneumonia. Some pathogens can enter the nasopharynx and lower respiratory tract through the lacrimal gland, leading to chronic pulmonary inflammation in infants and young children.

[0006] Neisseria gonorrhoeae, commonly known as gonococcus, often causes acute urethritis or vaginitis in humans, commonly known as gonorrhea. Gonococcus mainly invades the columnar epithelial cells of the human urogenital tract and can also spread further from the urethra and cervix, leading to epididymitis, prostatitis, endometritis, salpingitis, pelvic inflammatory disease, etc. Some carriers even have no clinical symptoms, leading to the further spread of sexually transmitted diseases. In recent years, the number of gonorrhea cases in China has shown an upward trend. Due to the extensive use of antibiotics, some Neisseria gonorrhoeae have acquired drug-resistant plasmids, thus developing resistance to drug treatment. Its drug resistance mainly includes penicillins, quinolones, and tetracyclines. The World Health Organization (WHO) has identified WHO A-V strains based on the source of the first report of the strain and the specificity of its gene sequence. For example, WHO M (Philippines), WHO O (Canada), and WHO N (Australia) all contain penicillin-resistant plasmid fragments and express beta-lactamase; while WHO K (Japan) has a chimeric penA gene, WHO L (Asia) has a point-mutated (A501V) penA gene, and WHO G (Thailand) and WHO P (USA) have a frameshift mutation in penA, and have also acquired the ability to tolerate low concentrations of penicillins and cephalosporins; WHO G and WHO N contain tetracycline-resistant plasmid fragments (tetM). Due to the insignificant initial symptoms of some gonorrhea cases and its drug resistance, it is easy for patients to ignore sexually transmitted diseases or experience repeated treatment effects. Therefore, the early detection of Neisseria gonorrhoeae is helpful for people to use drugs correctly and avoid repeated illnesses caused by incorrect drug use.

[0007] Ureaplasma urealyticum is a prokaryotic microorganism between bacteria and viruses. It has no cell wall and is the smallest microorganism currently found that can grow and reproduce on an inorganic culture medium. Ureaplasma urealyticum is a common microorganism in the urogenital tract, with a higher prevalence in women than in men. The colonization rate in the genital tract of adult women is 40-80%, and it is higher during pregnancy. It exists as an opportunistic pathogen. Clinical statistics show that Ureaplasma urealyticum can cause clinical symptoms such as non-gonococcal urethritis, premature birth and chorioamnionitis in pregnant women, neonatal pneumonia, and infertility under certain conditions. Ureaplasma urealyticum can be classified into two categories according to the polymorphism of its Multi-banded protein (MBP) gene. One is biovar 1, also called parvo or Ureaplasma parvum, including serotypes 1, 3, 6, and 14; the other is biovar 2, T960, including serotypes 2, 4, 5, and 7-13. The detection of Ureaplasma urealyticum plays a positive role in improving women's reproductive health. It can help women of childbearing age improve the detection and prevention of Ureaplasma urealyticum, thus avoiding unnecessary infections in fetuses and newborns and providing guarantee for healthy childbearing and good prenatal and postnatal care.

[0008] Currently, the detection methods for Chlamydia trachomatis on the market are mainly divided into two categories. One is the immunoassay method, which mainly detects Chlamydia trachomatis antibodies in human serum or Chlamydia trachomatis antigens in swab samples of secretions; the other is the molecular method, which detects the DNA of Chlamydia trachomatis in swab samples of human secretions by PCR fluorescence probe method or other methods. There are three categories of detection methods for Neisseria gonorrhoeae. One is the traditional culture method, which is used for the isolation and culture of Neisseria gonorrhoeae; the second is the immunoassay method, which mainly detects Neisseria gonorrhoeae antigens in swab samples of secretions; the third is the rapidly developing molecular detection method, with the PCR-fluorescence probe method as the mainstream, which detects the DNA of Neisseria gonorrhoeae in swab samples of human secretions. There are also three categories of detection methods for Ureaplasma urealyticum. One is the traditional culture method, which is used for the isolation and culture of Ureaplasma urealyticum; the second is the immunoassay method, which mainly detects Ureaplasma urealyticum antibodies in human serum samples; the third is the rapidly developing molecular detection method, with the PCR-fluorescence probe method as the mainstream, which detects the DNA of Ureaplasma urealyticum in swab samples of human secretions.

[0009] It can be seen that the current detection methods for Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum on the market mainly include culture methods, immunoassay methods, and nucleic acid-based PCR methods. The culture method is cumbersome to operate and has a long test time, which is not suitable for large-scale detection. The sensitivity and specificity of the immunoassay method are limited and there is a window period. The polymerase chain reaction (PCR) method has shown its advantages in detection after gradual development. However, as mentioned above, in most of the existing PCR methods, the DNA of pathogens in the sample is detected.

[0010] Real-time fluorescence PCR technology adds a specific fluorescent probe while adding a pair of primers into a nucleic acid reaction tube. This probe is an oligonucleotide, with a reporter fluorescent group and a quencher fluorescent group labeled at both ends respectively. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; after the amplification reaction starts, the probe binds to any single strand of the target DNA; during PCR amplification, the 5'-3' exonuclease activity of Taq enzyme cleaves and degrades the probe, separating the reporter fluorescent group from the quencher fluorescent group, so that the fluorescence monitoring system can receive the fluorescent signal. That is, for each amplified DNA strand, a fluorescent molecule is formed, achieving complete synchronization of the accumulation of fluorescent signals and the formation of PCR products. Fluorescent PCR technology is a nucleic acid detection technology with higher sensitivity, specificity, and precision. Its detection results are accurate, with high repeatability, can timely reflect the changes of pathogens, and at the same time avoid the problem of post-treatment required by traditional PCR, reducing the possibility of contamination.

[0011] Multiplex PCR, also known as multiplex primer PCR or multiplex PCR, is a PCR reaction that adds more than two pairs of primers in the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments. Its reaction principle, reaction reagents, and operation process are the same as those of general PCR. The factors affecting multiplex PCR include primer specificity, the mutual influence between them, and primer annealing temperature.

[0012] The multiplex real-time fluorescence PCR method can achieve the simultaneous detection of multiple pathogens by using multiple fluorescent labels in the same reaction system. Moreover, it has strong specificity, high sensitivity, is simple and fast to operate, the instruments used are easy to popularize, and is easy to promote and use.

[0013] Since the culture method is cumbersome to operate and has a long test time, the sensitivity of the immunoassay is limited and there is a window period, and although the current molecular detection methods are good, they mainly measure DNA and are prone to false positives. Therefore, there is still a need in the art for a detection method that can simultaneously detect Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum with strong specificity, high sensitivity, and simple and fast operation. Summary of the Invention

[0014] One aspect of the present invention relates to a combined detection kit for Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum, which is a combined PCR-fluorescent probe detection kit, characterized in that it simultaneously detects the DNA and RNA of Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum.

[0015] In some embodiments, the combined detection kit for Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum further comprises an exogenous internal control. Preferably, the exogenous internal control is selected from yeasts, such as Saccharomyces cerevisiae BY4741.

[0016] In some embodiments, the target gene of Chlamydia trachomatis targeted by the PCR-fluorescent probe is selected from the insulinase family protein gene TncL2 gene, preferably, the sequences shown in SEQ ID No. 13 or 18, and / or the target gene of Neisseria gonorrhoeae targeted by the PCR-fluorescent probe is selected from the hypothetical protein gene, preferably, the sequences shown in SEQ ID No. 14 or 19, and / or the target gene of Ureaplasma urealyticum targeted by the PCR-fluorescent probe is selected from the UreD gene, preferably, the sequences shown in SEQ ID No. 15 or 16.

[0017] In some embodiments, the target gene of the exogenous internal control targeted by the PCR-fluorescent probe is selected from the YRA1 gene, preferably, the sequence shown in SEQ ID No. 17.

[0018] In some embodiments, the probes for the target genes of Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum and exogenous internal control are respectively labeled with a reporter group selected from one of 6-FAM, HEX / VIC, ROX and Cy5 at the 5' end, and are respectively labeled with a quenching group selected from BHQ1 and BHQ2 at the 3' end. Preferably, the reporter group of Chlamydia trachomatis is 5' 6-FAM and the quenching group is 3'-BHQ1, the reporter group of Neisseria gonorrhoeae is 5' HEX / VIC and the quenching group is 3'-BHQ1, the reporter group of Ureaplasma urealyticum is 5' ROX and the quenching group is 3'-BHQ2, and the reporter group of the exogenous internal control yeast is 5' Cy5 and the quenching group is 3'-BHQ2.

[0019] In some embodiments, the DNA polymerase used in the PCR is selected from Class A, hot start Taq DNA polymerase, such as the Luna Universal Probe One-Step Reaction Mix from New England Biolabs.

[0020] In some embodiments, the RNA is reverse transcribed into cDNA, and the RNA reverse transcriptase used is selected from the MLV class, warm start reverse transcriptase, such as the Luna Warm Start RT Enzyme Mix from New England Biolabs.

[0021] In some embodiments, the target gene of Chlamydia trachomatis targeted by the PCR-fluorescent probe is the insulinase family protein gene TncL2 gene, the target gene of Neisseria gonorrhoeae targeted by the PCR-fluorescent probe is the hypothetical protein gene, the target gene of Ureaplasma urealyticum targeted by the PCR-fluorescent probe is the UreD gene, the target gene of the exogenous internal control targeted by the PCR-fluorescent probe is the YRA1 gene, and the combination of the corresponding primer pairs and probes is selected from:

[0022] Chlamydia trachomatis: SEQ ID No.1-2 and 9;

[0023] Neisseria gonorrhoeae: SEQ ID No.3-4 and 10;

[0024] Ureaplasma urealyticum: SEQ ID No.5-6 and 11; and

[0025] External control: SEQ ID No.7-8 and 12.

[0026] In some embodiments, the instruments compatible with the kit for the combined detection of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum are selected from DXcellence TM Automatic nucleic acid detection and analysis system, ABI 7500 real-time fluorescence PCR instrument, Bio-rad CFX96.

[0027] The second aspect of the present invention relates to the use of the kit for the combined detection of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum as described above in the preparation of a device for simultaneously detecting Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum.

[0028] In other words, in view of the deficiencies of the prior art and the development of biotechnology, the present invention aims to provide a kit for the qualitative detection of the nucleic acids of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum based on the PCR-fluorescent probe method. Through extensive and in-depth research, the inventors selected multiple target genes based on experience, designed multiple pairs of primers and probes, and then selected them. Then, the different primers and probes for each pathogen screened out were combined and tested using a multiplex fluorescence PCR amplification system to examine their compatibility. Fragments without non-specific cross-reactions, suitable combinations of primers and probes were screened out. Through the optimization of the PCR program and the screening of the sample loading amount, a multiplex detection system with better specificity and sensitivity for Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum was obtained, and the present invention was completed.

[0029] Persons skilled in the art can conveniently and quickly use this kit to detect samples. This kit uses specific primers and probes for Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum. After reverse transcribing mRNA into DNA using reverse transcriptase, the DNA and RNA of the pathogens are synchronously detected, and it has the following characteristics:

[0030] 1) This kit can detect three pathogens, Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum, in a single tube, reducing the workload of detection.

[0031] 2) An exogenous internal control yeast cell is added during the nucleic acid extraction and amplification processes of this kit, which can monitor the nucleic acid extraction and amplification processes throughout, preventing false negative results.

[0032] 3) By simultaneously detecting DNA and RNA, this kit can comprehensively improve the ability of the kit to detect positive samples. This is manifested as the Ct value of sample detection being advanced, and the detection sensitivity of positive samples, especially weak positive samples, being improved.

[0033] 4) This kit has high sensitivity and good specificity.

[0034] 5) This kit is compatible with the DXcellence TM When used with the fully automatic nucleic acid detection and analysis system, it can achieve fully automatic nucleic acid extraction, amplification, and reporting from sample input to result output. It is a fully automated detection system that can effectively prevent false positive results caused by contamination in the external environment.

[0035] The beneficial results of this kit are also reflected in the following aspects: the specificity, sensitivity, accuracy, repeatability, storage and transportation stability, feasibility of implementation, economy, level of operation difficulty, requirements for the qualifications of operators, and / or requirements for the source of samples of the kit are as follows:

[0036] 1) Specificity of the kit

[0037] This kit has no cross-reaction with one, multiple, or all of the following: Treponema pallidum, Staphylococcus epidermidis, Trichomonas vaginalis, Chlamydia pneumoniae, Mycoplasma pneumoniae, Mycoplasma genitalium, SARS-CoV-2, HIV-1 virus, Lactobacillus crispatus, Streptococcus agalactiae, Gardnerella vaginalis, Adenovirus, Pseudomonas aeruginosa, Staphylococcus aureus, Neisseria meningitidis, Lactobacillus casei, Escherichia coli, Proteus strains, Salmonella typhi, Shigella flexneri strains, Candida albicans, Mycoplasma hominis, Herpes simplex virus type 2, Human papillomavirus type 18, Human cytomegalovirus, and Streptococcus agalactiae.

[0038] 2) Sensitivity of the kit

[0039] The minimum detection limit of Chlamydia trachomatis is 15 IFU / mL for Chlamydia trachomatis serotypes E, D, and F;

[0040] The minimum detection limit of Neisseria gonorrhoeae is 4 CFU / mL for ATCC 19424 and 100 / mL for the national reference strain NG-S;

[0041] The minimum detection limit of Ureaplasma urealyticum is 200 CCU / mL for ATCC 27815, ATCC 27618, and the national reference strains L1 - L4.

[0042] 3) Precision of the kit

[0043] This kit is used in DXcellence TMWhen measuring positive and weak positive samples on the full-automatic nucleic acid detection and analysis system and the ABI 7500 real-time fluorescence PCR instrument, the CVs of the intra-batch precision, inter-batch precision, intermediate precision and reproducibility of the Ct values of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum are all less than 5%.

[0044] 4) Accuracy of the kit

[0045] The positive coincidence rate of this kit is 100%.

[0046] The enterprise reference products P1 and P2 (Escherichia coli containing CT sequence) standardized by the ATCC E-type standard strain are positive for Chlamydia trachomatis, negative for Neisseria gonorrhoeae and Ureaplasma urealyticum; the enterprise reference products P3 and P4 (Escherichia coli containing NG sequence) standardized by the ATCC 19424 standard strain and the "National Reference Product for Gonorrhea PCR Kit" NG-P1 to NG-P10 are all positive for Neisseria gonorrhoeae, and negative for Chlamydia trachomatis and Ureaplasma urealyticum; the enterprise reference products P5 and P6 (Escherichia coli containing UU sequence) standardized by the ATCC 27618 standard strain, the enterprise reference products P7 and P8 (Escherichia coli containing UP sequence) standardized by the ATCC 27815 standard strain, and the "Second Generation National Reference Product for Human Ureaplasma Nucleic Acid Detection" UU-P1 to UU-P14 are all positive for Ureaplasma urealyticum, negative for Neisseria gonorrhoeae and Chlamydia trachomatis.

[0047] The negative coincidence rate of this kit is 100%.

[0048] The enterprise reference products N1 to N10 (Staphylococcus aureus, Pseudomonas aeruginosa, Candida albicans, Escherichia coli, Lactobacillus casei, Lactobacillus crispatus, Streptococcus agalactiae, Neisseria meningitidis, Gardnerella vaginalis, Escherichia coli containing adenovirus sequence) are all negative for Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum; the "National Reference Product for Gonorrhea PCR Kit" NG-N1 to NG-N10 are all negative for Neisseria gonorrhoeae; the "Second Generation National Reference Product for Human Ureaplasma Nucleic Acid Detection" UU-N1 to UU-N8 are all negative for Ureaplasma urealyticum.

[0049] 5) Storage and transportation stability of the kit

[0050] It can be stored at -20°C and below for 1 year;

[0051] It can be stored at 2 - 8°C for no more than 4 days;

[0052] It can be freeze-thawed no more than 3 times;

[0053] After opening the bottle, it can be stored at 2 - 8°C for no more than 8 hours;

[0054] After opening the bottle, in DXcellence TMThe reagent storage compartment of the fully automatic nucleic acid testing and analysis system operates for no more than 8 hours;

[0055] Under the conventional transportation conditions specified by the inventor (see Table 1 below for details), the reagent performance meets the requirements.

[0056] Table 1 Conventional transportation conditions

[0057]

[0058] 6) Feasibility of the kit implementation

[0059] Adapt to DXcellence TM Fully automatic nucleic acid testing and analysis system: Corresponding consumables produced by the inventor need to be prepared, including PCR reaction tubes, nucleic acid extraction and purification kits, pipette tips, and swab samples collected and stored according to the instructions.

[0060] Adapt to ABI 7500 real-time fluorescence PCR instrument: Fluorescent PCR tubes suitable for ABI 7500, nucleic acid extraction and purification kits (magnetic rod method) produced by the inventor, fully automatic nucleic acid extraction and purification instrument, and swab samples collected and stored according to the instructions need to be prepared.

[0061] 7) Economy of the kit

[0062] The prices of the kits, their supporting reagents and consumables produced by the inventor are all at the domestic average price. Compared with imported kits, the performance is not lower than that of imported kits and has an obvious price advantage.

[0063] 8) Level of operation difficulty

[0064] Adapt to DXcellence TM Fully automatic nucleic acid testing and analysis system: The reagents, consumables and samples need to be loaded according to the instructions and software prompts, then fully automatic nucleic acid extraction and amplification are carried out, and finally the test report is issued automatically. Therefore, the on-duty personnel with a laboratory training certificate can master the instrument operation proficiently after being trained by the inventor's engineers.

[0065] Adapt to ABI 7500 real-time fluorescence PCR instrument: This instrument is a mature real-time fluorescence PCR instrument with a high market share. The on-duty personnel with a laboratory training certificate can all perform nucleic acid extraction and amplification experiments according to the instructions of the kit without additional training.

[0066] 9) Requirements for operator qualifications

[0067] Laboratory operators must hold a work permit related to PCR tests.

[0068] 10) Requirements for the source of samples

[0069] The samples need to be collected by a nationally recognized medical institution and stored according to the conditions required by the sample preservation solution. The samples of this kit include female cervical swab samples, male urethral swab samples, and male and female urine samples.

[0070] When stored in sterile physiological saline, it can be stored at 2 - 8°C for no more than 1 day, at room temperature for no more than 8 hours, at -20°C for no more than 12 months, and the number of freeze-thaw cycles should not exceed 3 times.

[0071] When stored in the preservation solution containing guanidine salt, it can be stored at 2 - 8°C for no more than 5 days, at room temperature for no more than 48 hours, at -20°C for no more than 12 months, and the number of freeze-thaw cycles should not exceed 3 times.

[0072] When stored in UTM sample preservation solution, it can be stored at 2 - 8°C for no more than 3 days, at room temperature for no more than 24 hours, at -20°C for no more than 12 months, and the number of freeze-thaw cycles should not exceed 3 times. Description of the Drawings

[0073] Figure 1 Shows the verification of the minimum detection limit of Chlamydia trachomatis serotype D.

[0074] Figure 2 Shows the verification of the minimum detection limit of Chlamydia trachomatis serotype E.

[0075] Figure 3 Shows the verification of the minimum detection limit of Chlamydia trachomatis serotype F.

[0076] Figure 4 Shows the verification of the minimum detection limit of Neisseria gonorrhoeae ATCC 19424.

[0077] Figure 5 Shows the verification of the minimum detection limit of Neisseria gonorrhoeae NG-S.

[0078] Figure 6 Shows the verification of the minimum detection limit of Ureaplasma urealyticum UU-L1.

[0079] Figure 7 Shows the verification of the minimum detection limit of Ureaplasma urealyticum UU-L2.

[0080] Figure 8 Shows the verification of the minimum detection limit of Ureaplasma urealyticum UU-L3.

[0081] Figure 9 Shows the verification of the minimum detection limit of Ureaplasma urealyticum UU-L4.

[0082] Figure 10 Shows the determination of the negative reference of the enterprise reference product.

[0083] Figure 11Shows the determination of the negative reference product of the "National Reference Product for Gonorrhea PCR Kit".

[0084] Figure 12 Shows the determination of the negative reference product of the "Second-generation National Reference Product for Ureaplasma urealyticum Nucleic Acid Detection".

[0085] Figure 13 Shows the determination of the positive reference product of the enterprise reference product.

[0086] Figure 14 Shows the determination of the positive reference product of the "National Reference Product for Gonorrhea PCR Kit".

[0087] Figure 15 Shows the determination of the positive reference product of the "Second-generation National Reference Product for Ureaplasma urealyticum Nucleic Acid Detection". Detailed implementation mode

[0088] Definition

[0089] Unless otherwise specified, the terms used in the claims and the specification of the present invention are defined as follows.

[0090] Unless otherwise defined herein, scientific and technical terms used in connection with the kits and their uses described herein shall have the meanings commonly understood by those of ordinary skill in the art. Additionally, unless the context otherwise requires, singular terms shall include the plural, and plural terms shall include the singular. Generally, the nomenclature and techniques used in connection with the following are those well known and commonly used in the art: biochemistry, immunology, enzymology, molecular and cell biology, microbiology, and genetics as described herein.

[0091] Unless otherwise specified, the methods and techniques described herein are generally performed according to conventional methods well known in the art and as described in various general and more specific references cited and discussed throughout this specification. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and supplements through 2002).

[0092] All publications, patents, and other references mentioned herein are hereby incorporated by reference in their entirety.

[0093] Unless otherwise indicated, the following terms shall be understood to have the following meanings.

[0094] The term "moderate positive" refers to a moderately amplified sample with a Ct value between 26 and 30.

[0095] The term "weak positive" refers to a weakly amplified sample with a Ct value generally greater than 31.

[0096] In some embodiments, the primers of the present invention are required to have good sequence specificity for amplification and no cross-reactivity with other pathogens, with a primer length between 18 and 28 bp and no mismatch with the pathogen target sequence.

[0097] In some embodiments, the probes of the present invention are required to have good sequence specificity and no cross-reactivity with other pathogens, with a primer length between 23 and 35 bp and no mismatch with the pathogen target sequence. The main components of the kit of the present invention include: PCR reaction solution, reverse transcriptase, primers specific for Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum and exogenous internal control, Taqman probes specific for Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum and exogenous internal control, optional negative control, optional positive control, exogenous internal control, and blocking reagent. In some embodiments, the PCR reaction solution, reverse transcriptase, primers specific for Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum and exogenous internal control, Taqman probes specific for Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum and exogenous internal control, optional negative control, optional positive control, exogenous internal control and blocking reagent are provided in different containers. In some embodiments, the PCR reaction solution, reverse transcriptase, primers specific for Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum and exogenous internal control, Taqman probes specific for Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum and exogenous internal control are provided in the same container, while the exogenous internal control, blocking reagent, optional negative control and optional positive control are provided in separate containers. In some embodiments, the containers are selected from microtubes and vials.

[0098] The PCR reaction solution used in the present invention is a mixture of a PCR reaction solution conventionally used in the Taqman fluorescence probe method and an RNA reverse transcription reaction solution diluted according to the manufacturer's instructions. In some embodiments, the composition of the PCR reaction solution is: Taq DNA polymerase, Mg 2+and dNTP mixture, diluted to 1X according to the manufacturer's instructions; RNA reverse transcriptase, diluted to 1X according to the manufacturer's instructions; the primer concentrations of Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum are about 100 - 800 nM, preferably 200 - 600 nM, more preferably 300 - 500 nM, and the primer concentration of the exogenous internal control is about 50 - 600 nM, preferably 100 - 400 nM, more preferably 150 - 300 nM; the probe concentrations of Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, and the exogenous internal control are about 50 - 600 nM, preferably 100 - 400 nM, more preferably 150 - 300 nM. In some embodiments, the PCR reaction solution is a commercially available PCR reaction solution, such as Luna Universal Probe One-Step Reaction Mix (diluted from 2X to 1X), and the reverse transcriptase is commercially available Luna RT Enzyme Mix (diluted from 20X to 1X).

[0099] The negative control used in the kit of the present invention is an Escherichia coli suspension without the plasmid of the CT-NG-UU amplification fragment, and the test results need to meet that all of Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum are negative and the exogenous internal control is positive.

[0100] The positive control used in the kit of the present invention is an Escherichia coli suspension containing the plasmid of the CT-NG-UU amplification fragment, and the test results need to meet that all of Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum are positive.

[0101] The sealing reagent used in the kit of the present invention is paraffin oil, and the detectable impurity content is required to meet the factory quality inspection report, such as the heavy metal content is not higher than 0.001%, the relative density is between 0.830 and 0.860, and the distillation temperature is not lower than 300 °C, etc.

[0102] The samples that can be used in the kit of the present invention include cervical swab samples, urethral swab samples, and urine samples.

[0103] List of conserved genes and target sequences of CT available for use:

[0104] CT-SEQ1: SEQ ID No. 18;

[0105] CT-SEQ2: SEQ ID No. 13.

[0106] List of conserved genes and target sequences of NG available for use:

[0107] NG-SEQ1: SEQ ID No. 14;

[0108] NG-SEQ2: SEQ ID No. 19.

[0109] List of conserved genes and target sequences of UU available for use:

[0110] UU-SEQ1: SEQ ID No.16;

[0111] UU-SEQ2: SEQ ID No.15.

[0112] The available exogenous internal control gene is the YRA1 gene, and its target sequence is:

[0113] IC-SEQ: SEQ ID No.17.

[0114] The available DNA polymerase is Class A, hot start Taq DNA polymerase.

[0115] The available RNA reverse transcriptase is of the MLV class, warm start reverse transcriptase, containing RNase inhibitor.

[0116] In some embodiments, the concentration range of the specific primers in the kit of the present invention is 200-400 nM. In some embodiments, the concentration range of the specific probes in the kit of the present invention is 100-200 nM.

[0117] In some embodiments, the PCR reaction conditions involved in the kit of the present invention are: 55°C, 10 min, 95°C, 1 min, 1 cycle; 95°C, 10 s, 58°C, 10 s (collect fluorescence signal), 45 cycles. Those skilled in the art know that the above PCR reaction conditions can be slightly adjusted and still achieve the amplification effect.

[0118] In some embodiments, the kit of the present invention further includes nucleic acid extraction and purification reagents. In some embodiments, the nucleic acid extraction and purification reagents are provided in the form of another kit. In some embodiments, the nucleic acid extraction and purification kit can be selected from the nucleic acid extraction and purification kit or nucleic acid extraction and purification kit (magnetic rod method) produced by Jiaxing Aikenuo Company.

[0119] In some embodiments, the nucleic acid loading volume is 200-350 μL.

[0120] In some embodiments, the concentration range of the exogenous internal control is OD 600 0.02-0.1 OD / mL.

[0121] The technical solutions of the present invention will be specifically described below through embodiments. These embodiments are descriptive and illustrative, and do not mean to limit. The scope of the present invention will only be limited by the appended claims. The reagents used in the following embodiments, unless otherwise specified, can be easily commercially purchased from reagent companies such as Sigma Aldrich and Merck. The test methods, unless otherwise noted, can be found in textbooks such as Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Press, New York. Although any methods and materials similar or equivalent to those described in the present invention can be used in the implementation or testing of the present invention, preferred methods and materials are exemplified herein.

[0122] Example

[0123] Example 1 Composition of Experimental Materials, Methods and Kits

[0124] 1.1 Standard Strains of Pathogens

[0125] The Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum in the embodiments of the present invention are all standard strains purchased from the American Type Culture Collection (ATCC) strain library. The "Reference Product for Gonorrhea PCR Kit" and the "National Reference Product for the Second Generation of Nucleic Acid Detection of Ureaplasma urealyticum in Humans" are both purchased from the National Institutes for Food and Drug Control of China.

[0126] The nucleic acid of Treponema pallidum for the specific reference product is purchased from Vircell. Trichomonas vaginalis, Chlamydia pneumoniae, Mycoplasma pneumoniae, and Mycoplasma genitalium are all purchased from the American Type Culture Collection (ATCC) strain library. The SARS-CoV-2 pseudovirus is purchased from Nanjing Kebai. The HIV-1 virus is purchased from the NIBSC WHO reference product. Lactobacillus crispatus, Streptococcus agalactiae, and Gardnerella vaginalis are purchased from Beina Biotechnology. Staphylococcus epidermidis is purchased from Xinyang Laoyao. Adenovirus comes from a self-made reference product of the enterprise (Escherichia coli containing the adenovirus Ad5 sequence). Pseudomonas aeruginosa, Staphylococcus aureus, Neisseria meningitidis, Lactobacillus casei, Escherichia coli, Proteus strains, Salmonella typhi, Shigella flexneri strains, and Candida albicans all come from the "Reference Product for Gonorrhea PCR Kit". Mycoplasma hominis, Herpes simplex virus type 2, Human papillomavirus type 18, Human cytomegalovirus, and Streptococcus agalactiae non-typeable all come from the "National Reference Product for the Second Generation of Nucleic Acid Detection of Ureaplasma urealyticum in Humans".

[0127] 1.2 Primers, Probes and PCR

[0128] The present invention mainly adopts the Taqman fluorescence probe method. Specific primers and probes for fluorescence detection are designed for the target sequences of conserved genes of CT, NG, and UU and the exogenous internal control gene sequence of the kit. The probes for CT, NG, UU, and exogenous internal control are labeled with FAM, HEX / VIC, ROX, and Cy5 respectively. The probe is an oligonucleotide including a 5'-end reporter group and a 3'-end quenching group. The extracted RNA is reverse transcribed into cDNA. During the PCR amplification process, the specific primers and probes bind to their respective target sequences. When Taq enzyme encounters the probe bound to the target sequence, it exerts its 5'-exonuclease function to separate the reporter group and the quenching group, and fluorescence is emitted under specific light excitation. Thus, the fluorescence monitoring system can receive the fluorescence signal, that is, for each amplified DNA strand, one fluorescent molecule is formed, realizing the complete synchronization of the accumulation of fluorescence signals and the formation of PCR products, and achieving the qualitative detection of CT, NG, and UU in the sample through one reaction tube.

[0129] The exogenous internal control is a dilution of yeast (Saccharomyces cerevisiae BY4741), which is used as the quality control for reagents, nucleic acid quality, and operation procedures. Through the exogenous internal control, the effectiveness of the entire process from nucleic acid extraction to amplification in the system can be truly reflected.

[0130] The main raw materials used in this kit are PCR reaction solution, reverse transcriptase, specific primers, and probes. Through experiments to explore the concentrations of primers and probes, the composition of the amplification reaction solution of this kit is: Luna Universal Probe One-Step Reaction Mix (diluted to 1X), Luna RT Enzyme Mix (diluted to 1X), each amplification primer (for Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, and exogenous internal control) is 400 nM, and each probe (for Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, and exogenous internal control) is 200 nM. The sequence amplified by Chlamydia trachomatis is the sequence of the TncL2 gene of the insulinase family protein gene (as shown in SEQ ID No.13), the sequence amplified by Neisseria gonorrhoeae is the sequence of the Hypothetical Protein gene (as shown in SEQ ID No.14), the sequence amplified by Ureaplasma urealyticum is the UreD gene sequence (as shown in SEQ ID No.15 or 16), and the amplification sequence of the exogenous internal control is the yeast RNA-binding protein YRA1 gene sequence (as shown in SEQ ID No.17). The specific raw material information is as follows:

[0131] 1) The amplification primers for Chlamydia trachomatis are used to amplify the specific fragment of Chlamydia trachomatis, including:

[0132] CT-F AATTCGTGAGCAAGGAGGCGCTT(SEQ ID NO.1)

[0133] CT-R GCCACTTCCGGATCTCGGTAGCT(SEQ ID NO.2)

[0134] 2) Neisseria gonorrhoeae amplification primers are used to amplify Neisseria gonorrhoeae specific fragments, including:

[0135] NG-F TCTTTCCGGGCAACCCGACCATCTTTA(SEQ ID NO.3)

[0136] NG-R GGGATTTCACACGTGTTCTCCGT(SEQ ID NO.4)

[0137] 3) Ureaplasma urealyticum amplification primers are used to amplify Ureaplasma urealyticum specific fragments, including

[0138] UU-F CGTGATTTAGTTAAGGAAAAATATCC(SEQ ID NO.5)

[0139] UU-R GGTTTTTTATTGAATAATTTTCTTC(SEQ ID NO.6)

[0140] 4) Exogenous internal control amplification primers for Saccharomyces cerevisiae specific fragments, including

[0141] IC-F GAGAGGTCAAGGTCAACGTC(SEQ ID NO.7)

[0142] IC-R TGGCCCCTTTCGTTATAACTC(SEQ ID NO.8)

[0143] 5) Chlamydia trachomatis specific probe, which generates a Fam channel fluorescence signal under the action of Taq enzyme after binding to the target sequence,

[0144] CT-P Fam-CCTAGGTTTGCACTAGCGCCAGAGCCAT-BHQ1(SEQ ID NO.9)

[0145] 6) Neisseria gonorrhoeae specific probe, which generates a HEX / VIC channel fluorescence signal under the action of Taq enzyme after binding to the target sequence,

[0146] NG-P HEX-AGGCTCGAAATAAAAAACTTTCGACGTGTC-BHQ1(SEQ ID NO.10)

[0147] 7) A Ureaplasma urealyticum specific probe that generates a ROX channel fluorescence signal under the action of Taq enzyme after binding to the target sequence.

[0148] UU-P ROX-CATGTTGAAAAAATTAATGCTGTTGC-BHQ2 (SEQ ID NO.11)

[0149] 8) An exogenous internal control specific probe that generates a Cy5 channel fluorescence signal under the action of Taq enzyme after binding to the target sequence.

[0150] IC-P Cy5-CCTGCTTAATGTCCCTTGGCAAACC-BHQ2 (SEQ ID NO.12)

[0151] 9) Luna Universal Probe One-Step Reaction Mix (purchased from New England Biolabs) is a one-step reaction solution used for amplifying the target sequence and cleaving the fluorophore to generate a fluorescence signal.

[0152] 10) Luna RT Enzyme Mix (purchased from New England Biolabs) is a warm-start reverse transcriptase used to reverse transcribe mRNA into cDNA.

[0153] The primers and probes used in the present invention were all synthesized by Shanghai Sangon Biotech Co., Ltd., where the letter F represents the forward primer, the letter R represents the reverse primer, and the letter P represents the probe.

[0154] 1.3 Nucleic acid extraction and purification

[0155] The extraction was performed using a nucleic acid extraction and purification kit (Zhejia Medical Equipment Preparation No. 20200204) or a nucleic acid extraction and purification kit (magnetic rod method) (Zhejia Medical Equipment Preparation No. 20210072) produced by Jiaxing Aikenuo Biotechnology Co., Ltd., and the operation was carried out according to the kit instructions. The extracted nucleic acid was stored at -20°C or below.

[0156] 1.4 Multiplex fluorescence PCR reaction solution

[0157] The preparation of the reaction solution includes specific primers and probes for Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, and exogenous internal control, a one-step reaction solution, and a warm-start reverse transcriptase mix (all purchased from New England Biolabs, product number E3006E).

[0158] 1.5 System optimization experiment

[0159] After selecting the primer / probe combination and reaction solution, a multiplex PCR combination test was conducted. Under the condition of fixing the concentrations of other target primers and probes, the concentrations of primers and probes were tested for each target respectively, and finally the optimal primer and probe concentrations for each target were selected.

[0160] In addition, the nucleic acid loading volume was also compared, and the loading volume with the highest sensitivity was selected on the premise of being compatible with the nucleic acid extraction and purification kit produced by the inventor.

[0161] Yeast suspension was used as an exogenous internal control to monitor the entire process of the kit, including extraction and amplification. The inventor conducted tests on the concentration of the exogenous internal control and compared the added concentrations of the exogenous internal control on the premise of not affecting the detection of the target, in order to select an internal control concentration that can monitor the quality of the kit without affecting its sensitivity.

[0162] After a large number of screening tests, a reaction system determined by the present invention is as follows: the total volume is 20 μL, and 10 μL of Luna Universal Probe One-Step Reaction Mix, 1 μL of Luna Warm RT Enzyme Mix, 400 nM CT primer, 400 nM NG primer, 400 nM UU primer, 200 nM IC primer, 200 nM CT probe, 200 nM NG probe, 200 nM UU probe, 200 nM IC probe and 8 μL of sample were added respectively, and ddH2O was added to make up to 20 μL.

[0163] Under the condition that other conditions are relatively determined, the amplification efficiency and sensitivity at different annealing temperatures, the key parameters of the PCR program, were investigated, and finally 58 °C was selected as the annealing temperature.

[0164] 1.6 ABI 7500 Real-Time Fluorescent PCR Instrument / DXcellence TM The amplification conditions of the automatic nucleic acid detection and analysis system are as follows:

[0165] 55 °C, 10 min, 95 °C, 1 min, 1 cycle

[0166] 95 °C, 10 s, 58 °C, 10 s (collect fluorescence signal), 45 cycles

[0167] 1.7 Negative and positive controls of the kit

[0168] To monitor the effectiveness of this kit, negative and positive controls need to be tested simultaneously in each round of testing. Therefore, we constructed negative and positive control strains. Among them, the negative control is an Escherichia coli suspension without the plasmid of CT-NG-UU amplification fragments, and the test results need to meet the requirements that Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum are all negative and the exogenous internal control is positive; the positive control is an Escherichia coli suspension containing the plasmid of CT-NG-UU amplification fragments, and the test results need to meet the requirements that Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum are all positive.

[0169] 1.8 Main operation methods and detection processes

[0170] When using this kit, the operations include the following steps: nucleic acid extraction and purification of human swab samples, loading samples into PCR tubes, PCR amplification procedures, and interpretation of test results. Since there are mainly two types of instruments compatible with this kit, one is the company's DXcellence TM Automatic nucleic acid detection and analysis system, and the other is the ABI 7500 real-time fluorescence PCR instrument. Therefore, the usage process of this kit will be introduced separately for the two types of instruments.

[0171] · DXcellence TM Automatic nucleic acid detection and analysis system

[0172] 1) Take out the kit from the refrigerator, place it at room temperature to thaw, and centrifuge the reagents to the bottom of the tube with a centrifuge or equivalent tool;

[0173] 2) Enter the information of the PCR reaction solution and the exogenous internal control according to the operation guide of the DXcellence TM system, and load it to the corresponding position after opening the lid;

[0174] 3) Load the PCR reaction tubes and other consumables according to the test volume;

[0175] 4) Enter the information of the nucleic acid extraction and purification kit according to the operation guide of the DXcellence TM system and load it to the corresponding position;

[0176] 5) Enter the information of the appropriately stored samples according to the operation guide of the DXcellence TM system, and load it to the corresponding sample position after opening the lid;

[0177] 6) Mix the negative control and transfer all of it to the sample tube, label it with the negative control label, and load it to the corresponding sample position after entering the information;

[0178] 7) Mix the positive control and transfer all of it to the sample tube, label it with the positive control label, and load it to the corresponding sample position after entering the information;

[0179] 8) According to the DXcellenceTM The system operation guide selects the CT / NG / UU test program and starts the program after confirming that the reagent information is correct.

[0180] 9) When the program ends, the instrument automatically determines the results and presents the sample test report.

[0181] · ABI7500 Real-Time Fluorescent PCR Instrument

[0182] 1) Nucleic acid extraction of samples and positive and negative controls

[0183] Take 200 μL of the sample for nucleic acid extraction. Nucleic acid extraction can use the nucleic acid extraction and purification reagent (magnetic rod method) of Jiaxing Aikenuo Biotechnology Co., Ltd. The exogenous internal control in this kit participates in the extraction process, and 10 μL of exogenous internal control is added to each sample. The nucleic acid extraction is carried out according to the operation steps in the manufacturer's instruction manual. The negative and positive control products in the kit need to be extracted, and exogenous internal control also needs to be added before extraction. The extraction method is the same as that of the sample extraction.

[0184] 2) Sample loading

[0185] Take out the reagent kit from the refrigerator, place it at room temperature to thaw, and then use a centrifuge or equivalent tool to spin the reagent to the bottom of the tube. Take 12 μL of the PCR reaction solution and place it into a PCR tube, and then add 8 μL of the nucleic acid extraction products of the sample, positive reference product, and negative reference product into the PCR tube respectively. Cover the tube cap and immediately carry out the PCR amplification reaction.

[0186] 3) PCR amplification

[0187] The reaction tube is placed on the fluorescent PCR instrument. Select the FAM channel (Reporter: FAM, Quencher: none) to detect Chlamydia trachomatis (CT), select the VIC channel (Reporter: VIC, Quencher: none) to detect Neisseria gonorrhoeae (NG), select the ROX channel (Reporter: ROX, Quencher: none) to detect Ureaplasma urealyticum (UU), and select the Cy5 channel (Reporter: Cy5, Quencher: none) to detect the exogenous internal control (IC); the reference fluorescence (Passive Reference) is set to none, and the sample volume is set to 20 μL. The recommended cycling parameters are set as shown in Table 2:

[0188] Table 2: Recommended cycling parameter settings

[0189]

[0190] 3) Baseline and threshold setting

[0191] The results automatically saved after the reaction, adjust the Start value, End value and Threshold value of Baseline according to the analyzed image (users can adjust according to the image by themselves, the Start value is set between 3 - 15, the End value is set between 5 - 20, and the Threshold value is not lower than the highest fluorescence value of the negative control, which can be determined according to the specific situation), click Analyze to perform the analysis, and record the Ct value.

[0192] 4) Judge the results according to the positive judgment value

[0193] The positive reference values of Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum in this product are Ct value ≤ 40.

[0194] Example 2. Detection limit test of the combined detection kit for Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum

[0195] Dilute the ATCC Chlamydia trachomatis reference strain to different concentrations in the above table according to the COA concentration gradient and perform 20 detections respectively (Table 3). Among them, the positive rate of serotype D (VR - 885) is 100% when the concentration is higher than 7.5 IFU / mL. Take the lowest concentration, so the LoD of serotype D is determined to be 7.5 IFU / mL; the positive rate of serotype E (VR - 348B) reaches 100% when the concentration is higher than 7.5 IFU / mL. Take the lowest concentration, so the LoD of serotype E is determined to be 7.5 IFU / mL; the positive rate of serotype F (VR - 346) reaches 100% when the concentration is higher than 7.5 IFU / mL. Take the lowest concentration, so the LoD of serotype F is determined to be 7.5 IFU / mL.

[0196] Take the highest concentration of 7.5 IFU / mL of LoD among the three Chlamydia trachomatis serotypes. Therefore, take 15 IFU / mL not lower than this concentration and perform 20 verifications respectively. The results show that the positive rates of the three batches of reagents on the ABI 7500 and DXcellence TM fully automatic nucleic acid detection and analysis system are both 100%.

[0197] Therefore, the minimum detection limits of Chlamydia trachomatis serotypes D, E, and F are all 15 IFU / mL. The verification results of its LOD are shown in Figure 1 、 Figure 2 and Figure 3 .

[0198] Table 3 Establishment of the minimum detection limits of Chlamydia trachomatis serotypes D, E, and F

[0199]

[0200] Take a batch of reagents, dilute the reference strain of Neisseria gonorrhoeae ATCC 19424 and the reference product of the minimum detection limit of the gonorrhea PCR kit reference product NG-S to different concentrations, and perform 20 tests respectively (Table 4). Among them, when the concentration of ATCC 19424 is higher than 1 CFU / mL, the positive rate is 100%. Take the lowest concentration, so the LoD of ATCC 19424 is determined to be 1 CFU / mL; when the concentration of the reference product of the minimum detection limit of the gonorrhea PCR kit reference product NG-S is higher than 50 / mL, the positive rate is 100%. Take it as the lowest concentration, so the LoD of NG-S is determined to be 50 / mL. The LoDs of the two standard strains are initially set to 1 CFU / mL and 50 / mL respectively.

[0201] Samples of 4 CFU / mL and 100 / mL not lower than these 2 concentrations were taken respectively and verified 20 times. The results showed that the positive rates of the three batches of reagents on the ABI 7500 and DXcellence TM fully automatic nucleic acid detection and analysis system were all 100%.

[0202] Therefore, the minimum detection limit of Neisseria gonorrhoeae 19424 is 4 CFU / mL; the minimum detection limit of the international reference product NG-S is 100 / mL. The verification results of its LOD are shown in Figure 4 and Figure 5 .

[0203] Table 4 Establishment of the minimum detection limit of Neisseria gonorrhoeae

[0204]

[0205] Dilute the minimum detection limit reference products L1, L2, L3, and L4 of the second-generation national reference product for nucleic acid detection of Ureaplasma urealyticum to different concentrations and perform 20 tests respectively (Table 5). Among them, when the concentration of L1 is higher than 100 CCU / mL, the positive rate is higher than 100%. Take its lowest concentration, so the LoD of L1 is determined to be 100 CCU / mL; when the concentration of L2 is higher than 50 CCU / mL, the positive rate is higher than 95%. Take its lowest concentration, so the LoD of L2 is determined to be 50 CCU / mL; when the concentration of L3 is higher than 50 CCU / mL, the positive rate is higher than 100%. Take the lowest concentration, so the LoD of L3 is determined to be 50 CCU / mL; when the concentration of L4 is higher than 50 CCU / mL, the positive rate is higher than 100%. Take the lowest concentration, so the LoD of L4 is determined to be 50 CCU / mL. The minimum detection limit reference product of UU takes the highest concentration of the four LoDs, that is, 100 CCU / mL is initially set as the LoD of UU.

[0206] Take four reference products with the lowest detection limits. For samples with a concentration of not less than 100 CCU / mL and 200 CCU / mL respectively, conduct 20 validations. The results show that for three batches of reagents, the positive rates on the ABI 7500 and DXcellence TM fully automated nucleic acid detection and analysis systems are both 100%.

[0207] Therefore, the lowest detection limits of Ureaplasma urealyticum are all 200 CCU / mL. The validation results of its LOD are shown in Figures 6 - 9 .

[0208]

[0209] Example 3. Specificity tests for Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum

[0210] Using Treponema pallidum, Staphylococcus epidermidis, Trichomonas vaginalis, Chlamydia pneumoniae, Mycoplasma pneumoniae, Mycoplasma genitalium, SARS-CoV-2, Lactobacillus crispatus, Streptococcus agalactiae, Gardnerella vaginalis, adenovirus, Pseudomonas aeruginosa, Staphylococcus aureus, Neisseria meningitidis, Lactobacillus casei, Escherichia coli, Proteus strain, Salmonella typhi, Shigella flexneri strain, Candida albicans, Mycoplasma hominis, Herpes simplex virus type 2, Human papillomavirus type 18, Human cytomegalovirus, and Streptococcus agalactiae without cross-reaction as specific reference products, test the specificity of the nucleic acid combined detection kit for Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum.

[0211] The detection results show that there is no non-specific amplification reaction for co-existing and cross-reacting pathogens. Figure 10 For the enterprise negative reference products, Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum are all negative, and the exogenous internal control is all positive; Figure 11 For the "National Reference Product for Gonorrhea PCR Reagent", Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum are all negative, and the exogenous internal control is all positive; Figure 12 For the "Second-generation National Reference Product for Human Ureaplasma Nucleic Acid Detection", N1 is Neisseria gonorrhoeae, and the result is that Neisseria gonorrhoeae is positive, Chlamydia trachomatis and Ureaplasma urealyticum are negative. N5 is Chlamydia trachomatis, and the test result is that Chlamydia trachomatis is positive, Neisseria gonorrhoeae and Ureaplasma urealyticum are negative. For other reference products, Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum are all negative, and the exogenous internal control is all positive.

[0212] Example 4. Precision tests for Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma urealyticum

[0213] Chlamydia trachomatis serotype E ATCC VR-348B, serotype D ATCC VR-885, Neisseria gonorrhoeae ATCC 19424 and NG-S, and Ureaplasma urealyticum ATCC 27815 and ATCC 28618 were formulated into mixed medium positive samples (Ct value ~29) and weak positive samples (Ct value ~33) with a diluent. A combined nucleic acid detection kit for Chlamydia trachomatis / Neisseria gonorrhoeae / Ureaplasma urealyticum was used to detect medium positive and weak positive samples. A variety of bacterial strains (Pseudomonas aeruginosa, Candida albicans, Staphylococcus aureus, Escherichia coli, Lactobacillus casei, Gardnerella vaginalis) were mixed and diluted with a diluent to form negative samples.

[0214] The within-run precision is shown in Table 6 below. The medium positive, weak positive, and negative samples were measured 10 times each. The results showed that the precision of Chlamydia trachomatis was 0.67% and 2.5%, the precision of Neisseria gonorrhoeae was 1.30% and 1.75%, and the precision of Ureaplasma urealyticum was 0.56% and 1.16%. The precision of the external control for the negative samples was 0.91%.

[0215] Table 6 Results of within-run precision of the CTNGUU kit

[0216]

[0217]

[0218] The intermediate precision was determined by detecting medium positive, weak positive, and negative samples 8 times each in the morning and afternoon on 5 natural days, with a total of 80 tests per batch. The results (Table 7) showed that the intermediate precision of Chlamydia trachomatis was 1.97% and 2.06%, the intermediate precision of Neisseria gonorrhoeae was 1.99% and 3.69%, and the intermediate precision of Ureaplasma urealyticum was 1.97% and 2.33%. The intermediate precision of the negative samples was 2.22%.

[0219] The reproducibility was determined by testing medium positive, weak positive, and negative samples for 5 days, with 5 tests per day and a total of 75 tests per batch. The results (Table 8) showed that the intermediate precision of Chlamydia trachomatis was 1.26% and 1.95%, the intermediate precision of Neisseria gonorrhoeae was 1.72% and 2.09%, and the intermediate precision of Ureaplasma urealyticum was 0.99% and 1.79%. The intermediate precision of the negative samples was 1.96%.

[0220] The between-run precision was statistically analyzed using the data of 30 test results for each sample measured with three batches. The results (Table 9) showed that the precision of Chlamydia trachomatis was 1.35% and 2.89%, the precision of Neisseria gonorrhoeae was 1.14% and 2.05%, and the precision of Ureaplasma urealyticum was 1.16% and 2.06%. The precision of the external control for the negative samples was 1.88%.

[0221]

[0222]

[0223] Example 5, Accuracy Test of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum

[0224] It was determined that the enterprise reference products P1 and P2 standardized with the ATCC E-type standard strain were positive for Chlamydia trachomatis and negative for Neisseria gonorrhoeae and Ureaplasma urealyticum (Table 10); the enterprise reference products P3 and P4 standardized with the ATCC 19424 standard strain (Table 10) and the "National Reference Product for Gonorrhea PCR Kit" NG-P1 to NG-P10 (Table 11) were all positive for Neisseria gonorrhoeae and negative for Chlamydia trachomatis and Ureaplasma urealyticum; the enterprise reference products P5 and P6 standardized with the ATCC 27618 standard strain (Table 10), the enterprise reference products P7 and P8 standardized with the ATCC 27815 standard strain (Table 10), and the "Second-generation National Reference Product for Ureaplasma urealyticum Nucleic Acid Detection" UU-P1 to UU-P14 (Table 12) were all positive for Ureaplasma urealyticum and negative for Neisseria gonorrhoeae and Chlamydia trachomatis.

[0225] The coincidence rate of the positive reference products was 100%. The test results are shown in Figures 13 - 15 .

[0226] It was determined that the enterprise reference products N1 to N10 (Table 13,[[]] Figure 10 ) were all negative for Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum; the "National Reference Product for Gonorrhea PCR Kit" NG-N1 to NG-N10 (Table 14,[[]] Figure 11 ) were all negative for Neisseria gonorrhoeae; the "Second-generation National Reference Product for Ureaplasma urealyticum Nucleic Acid Detection" UU-N1 to UU-N8 (Table 15,[[]] Figure 12 ) were all negative for Ureaplasma urealyticum, where UU-N1 was Neisseria gonorrhoeae and UU-N5 was Chlamydia trachomatis.

[0227] The coincidence rate of the negative reference products was 100%.

[0228]

[0229]

[0230]

[0231] Example 6, Interference Substance Test of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum

[0232] Add the potential maximum concentration of each interfering substance (“worst condition”) to the medium-positive and weak-positive samples, and detect them simultaneously with the sample without interfering substance (control). A relative deviation of Ct value not greater than 10% can be regarded as no interference. The added interfering substances are shown in the following table. Under the condition of adding the interfering substance concentration, the deviations of the medium-positive samples (Table 16) and weak-positive samples (Table 17) are not more than 10% compared with the control.

[0233] Under the condition of the interfering substance concentration in this test, there is no significant interference with the test results of this kit.

[0234] Table 16 Interference determination results of medium-positive samples in the CTNGUU kit

[0235]

[0236] Table 17 Interference determination results of weak-positive samples in the CTNGUU kit

[0237]

[0238] Equivalent solutions

[0239] Although multiple embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision various other means and / or structures for achieving the functions described herein and / or obtaining the results and / or one or more advantages described herein, and each such variation and / or modification is considered to be within the scope of the present invention. More generally, those skilled in the art will readily understand that all parameters, materials, and settings described herein are intended to be exemplary, and the actual parameters, materials, and / or settings will depend on the specific application in which the teachings of the present invention are used. Those skilled in the art will recognize or be able to determine many equivalents of the specific embodiments of the present invention described herein using only routine experimentation. Accordingly, it should be understood that the foregoing embodiments and examples are presented by way of example only, and that within the scope of the appended claims and their equivalents, the present invention may be practiced in a manner different from that specifically described and claimed. Any combination of two or more such features, systems, articles, materials, and / or methods is included within the scope of the present invention if such features, systems, articles, materials, and / or methods are not mutually conflicting.

[0240] As used in the specification and claims of the present invention, the phrase "and / or" shall be understood to mean "either or both" of the elements so combined, i.e., elements that may be present together in some cases and absent together in other cases. Except for the elements specifically identified by the "and / or" clause, other elements may optionally be present, whether related or unrelated to those specifically identified, unless otherwise expressly stated. Thus, as a non-limiting example, when used in conjunction with open-ended language such as "comprising", a reference to "A and / or B" may, in one embodiment, refer to having A but not B (optionally including other elements in addition to B); in another embodiment, to having B but not A (optionally including elements in addition to A); in yet another embodiment, to having both A and B (optionally including other elements); and so on.

[0241] As used herein in the specification and claims, "or" shall be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be understood to be inclusive, i.e., including at least one of a plurality of elements or a list of elements, but also including more than one, and optionally, other unlisted items. Only terms that specifically state the contrary, such as "only one of" or "exactly one of", or when used in claims, "consisting of" will refer to exactly one element of a plurality of elements or a list of elements. Generally, the term "or" as used herein should be understood to denote only exclusive alternatives (i.e., "one or the other but not both") when preceded by an exclusive term such as "either", "one of", "only one of" or "exactly one of". When used in claims, "consisting essentially of" shall have its ordinary meaning in the field of patent law.

[0242] As used herein in the specification and claims, when referring to a list of one or more elements, the phrase "at least one" shall be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each element specifically listed in the list of elements, and not excluding any combination of the elements in the list of elements. This definition also allows elements other than those specifically identified in the list of elements referred to by the phrase "at least one" to optionally exist, whether related or unrelated to those specifically identified elements. Thus, as a non-limiting example, in one embodiment, "at least one of A and B" (or equivalently, "at least one of A or B", or equivalently, "at least one of A and / or B") can mean at least one, optionally including more than one A, with no B present (and optionally including elements other than B); in another embodiment, it can mean at least one, optionally including more than one B, with no A present (and optionally including elements other than A); in yet another embodiment, it can mean at least one, optionally including more than one A, and at least one, optionally including more than one B (and optionally including other elements); and so on.

[0243] In the claims and the above specification, all conjunctive terms such as "comprising", "including", "carrying", "having", "containing", "involving", "owning", etc. are to be understood as being open-ended, i.e., meaning including but not limited to. Only the conjunctive terms "consisting of" and "consisting essentially of" shall be closed or semi-closed conjunctive terms, respectively.

[0244] The use of ordinal terms such as "first", "second", "third", etc. in the claims to modify the claim elements themselves does not imply any priority, precedence, or order of one claim element with respect to another claim element, or the temporal order of acts in a method, but merely serves as a label to distinguish one claim element having a certain name from another element having the same name (but for ordinal terms) to distinguish claim elements.

Claims

1. A combined detection kit for Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum, which is a combined PCR-fluorescent probe detection kit, and is characterized in that It simultaneously detects the DNA and RNA of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum. The target gene of Chlamydia trachomatis targeted by the PCR-fluorescent probe is the insulinase family protein gene TncL2 gene with a sequence as shown in SEQ ID No. 13 or 18. The target gene of Neisseria gonorrhoeae targeted by the PCR-fluorescent probe is a hypothetical protein gene with a sequence as shown in SEQ ID No. 14 or 19. The target gene of Ureaplasma urealyticum targeted by the PCR-fluorescent probe is the UreD gene with a sequence as shown in SEQ ID No. 15 or 16. And the target gene of the exogenous internal control is the YRA1 gene of yeast with a sequence as shown in SEQ ID No.

17. And the corresponding primer pairs and probe combinations are: Chlamydia trachomatis: SEQ ID No. 1-2 and 9; Neisseria gonorrhoeae: SEQ ID No. 3-4 and 10; Ureaplasma urealyticum: SEQ ID No. 5-6 and 11; and Exogenous internal control: SEQ ID No. 7-8 and 12.

2. The kit for the combined detection of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum according to claim 1, wherein the probes for the target genes of Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum and exogenous internal control are respectively labeled with a reporter group selected from one of 6-FAM, HEX / VIC, ROX and Cy5 at the 5'-end, and are respectively labeled with a quenching group selected from BHQ1 and BHQ2 at the 3'-end.

3. The kit for the combined detection of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum according to claim 2, wherein the reporter group of Chlamydia trachomatis is 5'-6-FAM and the quenching group is 3'-BHQ1; the reporter group of Neisseria gonorrhoeae is 5'-HEX / VIC and the quenching group is 3'-BHQ1; the reporter group of Ureaplasma urealyticum is 5'-ROX and the quenching group is 3'-BHQ2; the reporter group of the exogenous internal control yeast is 5'-Cy5 and the quenching group is 3'-BHQ2.

4. The kit for the combined detection of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum according to claim 1, wherein the DNA polymerase used in the PCR is a hot-start Taq DNA polymerase.

5. The kit for the combined detection of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum according to claim 1, wherein the RNA is reverse transcribed into cDNA, and the RNA reverse transcriptase used is a hot-start reverse transcriptase.

6. Use of the kit for the combined detection of Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum according to any one of claims 1-5 in the preparation of a device for simultaneously detecting Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum.

Images