SNP Molecular Marker of Sorghum SbSOS1 Gene and Its Application

Abstract

The present invention discloses an SNP molecular marker in the gene SbSOS1 related to the above-ground dry weight of sorghum salt-tolerance related traits and its application. The present invention relates to an SNP molecular marker related to the above-ground dry weight of sorghum in the field of molecular biotechnology and its application. By detecting the genotypes of SNPs in the above-ground dry weight gene SbSOS1 of sorghum varieties, it is found that the above-ground dry weight of sorghum varieties with the genotype CC is significantly higher than that of sorghum varieties with the genotype GG. The above-ground dry weight of 68.05% of sorghum varieties with the genotype CC is higher than 0.12 kg. It shows that the SNP molecular marker in the SbSOS1 gene of the present invention can be used for sorghum molecular marker-assisted selection breeding, significantly improving the selection efficiency of sorghum varieties with high above-ground dry weight.

Description

Technical Field

[0001] The invention relates to a molecular marker related to the dry weight of the aerial part of sorghum and an application thereof in the field of molecular biotechnology, and in particular to a SNP molecular marker of a sorghum SbSOS1 gene and an application thereof. Background Art

[0002] Salt stress is an increasingly serious environmental problem worldwide, with approximately 1 billion hm 2 of cultivated land is affected differently by salinization. Salt stress is a key factor affecting crop growth, distribution and production, mainly affecting some intracellular processes such as photosynthesis, ion balance, protein and lipid synthesis, and hormone and metabolic imbalances. These harmful effects caused by salt ultimately lead to a reduction in crop yields. As an important type of abiotic stress, salt stress seriously restricts the sustainable development of agriculture.

[0003] Sorghum (Sorghum bicolor), also known as sorghum, is an annual herbaceous plant of the genus Sorghum in the Poaceae family. It is one of the world's five major cereal crops and a C4 crop. It is widely planted in arid, semi-arid tropical, subtropical and temperate regions. Globally, sorghum is used for animal feed, feed, and high-value products such as syrup and bioethanol. As an important food and cash crop, sorghum has strong drought resistance, waterlogging resistance and salt-alkali resistance. Among them, sweet sorghum is considered to be one of the C4 forage crops with the most potential for salt-alkali tolerant variety development. Sorghum has attracted much attention as a food, forage and energy crop. In particular, the increasing demand for forage in the development of my country's grass and animal husbandry industry has attracted more and more attention to sweet sorghum, a forage with high yield, high sugar content and rich nutrition. It is also widely regarded as a new forage crop with development potential.

[0004] KASP (Kompetitive Allele-Specific PCR) achieves the effect of genotyping by specifically identifying gene loci with fluorescent probes, and can be used to detect SNP loci and InDel loci. Compared with molecular markers such as SSR, RFLP, and InDel, KASP markers have the characteristics of rapid detection, low cost, and easy large-scale application. KASP markers do not need to be typed according to the size of DNA fragments, and can get rid of the relatively cumbersome steps and low throughput of traditional gel electrophoresis detection methods, and are suitable for high-throughput molecular detection platforms. Therefore, studying the genes that regulate the aboveground dry weight, obtaining KASP molecular markers that are closely linked to the aboveground dry weight genes, locating and detecting the main effect gene loci of the aboveground dry weight of sorghum, effectively regulating the aboveground dry weight type of sorghum, and breeding new sorghum varieties with the expected aboveground dry weight type have important application value for improving the breeding efficiency and breeding level of sorghum in my country. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to identify or assist in identifying the above-ground dry weight trait of sorghum or how to conduct sorghum breeding.

[0006] To solve the above technical problem, the present invention provides a method for identifying or assisting in identifying the above-ground dry weight of sorghum.

[0007] The method for identifying or assisting in identifying the above-ground dry weight of sorghum provided by the present invention includes detecting the genotype of SNPs in the sorghum to be tested, and identifying or assisting in identifying the above-ground dry weight of sorghum according to the genotype: the above-ground dry weight of sorghum with the genotype CC is higher than or candidate higher than that of sorghum with the genotype GG.

[0008] The SNP is a SNP in the sorghum genome, which is the 880th nucleotide of SEQ ID No.1 in the sequence listing, and it is C or G; the CC is a homozygous type in which the 880th nucleotide of SEQ ID No.1 in the sequence listing is C, and the GG is a homozygous type in which the 880th nucleotide of SEQ ID No.1 in the sequence listing is G.

[0009] The present invention also provides a method for sorghum breeding, including detecting the polymorphism or genotype of SNPs in the sorghum genome, and selecting sorghum with the genotype CC as a parent for breeding.

[0010] The application of the above method for identifying or assisting in identifying the above-ground dry weight of sorghum in sorghum breeding also belongs to the protection scope of the present invention.

[0011] The present invention also provides the application of a substance for detecting molecular markers of the above-ground dry weight of sorghum in detecting or assisting in detecting the above-ground dry weight trait of sorghum, and the application is the following P1 or Q1:

[0012] The P1 is the application of a substance for detecting the polymorphism or genotype of SNPs in identifying or assisting in identifying the above-ground dry weight of sorghum. The SNP is a SNP in the sorghum genome, which is the 880th nucleotide of SEQ ID No.1 in the sequence listing, and it is C or G.

[0013] The above SNP single nucleotide polymorphism locus is located in the SbSOS1 gene on chromosome 8 of the sorghum genome (BTx623 (v3.1) sorghum genome sequence information). The SbSOS1 gene is located at positions 62626697-62654054 on chromosome 8 of sorghum, is related to the above-ground dry weight of sorghum, and its nucleotide sequence is the DNA molecule shown in SEQ ID No.1 in the sequence listing.

[0014] The application of a substance for detecting the polymorphism or genotype of SNPs in the preparation of a product for identifying or assisting in the identification of the above-ground dry weight of sorghum; the SNP is an SNP in the sorghum genome, which is the 880th nucleotide of SEQ ID No.1 in the sequence listing, and it is C or G.

[0015] The present invention also provides the application of a substance for detecting the polymorphism or genotype of SNPs in sorghum breeding or the preparation of sorghum breeding products. The SNP is an SNP in the sorghum genome, which is the 880th nucleotide of SEQ ID No.1 in the sequence listing, and it is C or G.

[0016] The above-ground dry weight of sorghum may be the above-ground dry weight at the maturity stage of sorghum. The sorghum may be a sorghum inbred line. The genotype (i.e., allele) of the SNP may be genotype CC, genotype GG, or genotype CG. Genotype CC is the homozygous type where the SNP is C; genotype GG is the homozygous type where the SNP is G; genotype CG is the heterozygous type where the SNP is C and G. The above-ground dry weight of sorghum (such as a sorghum inbred line) with the genotype CC of the SNP is higher than or potentially higher than that of sorghum with the genotype GG.

[0017] To solve the above technical problems, the present invention also provides a product, which contains the above-mentioned substance for detecting the polymorphism or genotype of SNPs in the sorghum genome and may be any one of the following G1)-G3):

[0018] G1) A product for detecting the single nucleotide polymorphism or genotype related to the above-ground dry weight of sorghum;

[0019] G2) A product for identifying or assisting in the identification of the above-ground dry weight of sorghum;

[0020] G3) A product for sorghum breeding.

[0021] The sorghum to be tested mentioned above is a sorghum inbred line, and the sorghum inbred line is selected as the parent for breeding.

[0022] The sorghum breeding mentioned above is to cultivate sorghum varieties with a higher above-ground dry weight.

[0023] The above-ground dry weight of sorghum mentioned above may specifically be the above-ground dry weight at the maturity stage of sorghum.

[0024] In the above applications and methods, the substance for detecting the polymorphism or genotype of SNP may be a substance for determining the nucleotide type of SNP sites in the above sorghum genome by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography, and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single-base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein-DNA binding reaction, and a chip based on fluorescent molecule-DNA binding reaction.

[0025] In the above applications, methods or products, the substance for detecting the polymorphism or genotype of SNP may be any of the following D1), D2) or D3):

[0026] D1) An in vitro nucleic acid amplification primer containing an amplified sorghum genomic DNA fragment including the SNP site;

[0027] D2) An in vitro nucleic acid amplification reagent containing the PCR primer described in D1);

[0028] D3) A kit containing the PCR primer described in D1) or the in vitro nucleic acid amplification reagent described in D2).

[0029] The in vitro nucleic acid amplification may be polymerase chain reaction (PCR), strand displacement amplification (SDA), ligase chain reaction (LCR), nucleic acid sequence-based amplification (NASBA), rolling circle nucleic acid amplification (RCA), loop-mediated isothermal amplification (lamp), helicase-dependent isothermal amplification technology (HDA), or Qβ replication.

[0030] The above in vitro nucleic acid amplification primers are F1-1 and F1-2:

[0031] F1-1, a primer group composed of the single-stranded DNA shown in SEQ ID No. 2 in the sequence listing, the single-stranded DNA shown in SEQ ID No. 3 in the sequence listing, and the single-stranded DNA shown in SEQ ID No. 4 in the sequence listing;

[0032] F1-2, a primer group composed of the single-stranded DNA with the nucleotide sequence of positions 22-41 of SEQ ID No. 2 in the sequence listing, the single-stranded DNA with the nucleotide sequence of positions 22-41 of SEQ ID No. 3 in the sequence listing, and the single-stranded DNA shown in SEQ ID No. 4 in the sequence listing.

[0033] In the above applications and methods, the in vitro nucleic acid amplification primers may or may not be labeled with a labeling agent. The labeling agent refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Labeling agents include, but are not limited to, dyes; radioactive labels such as 32 P; binding moieties such as biotin; haptens such as digoxin (DIG); luminescent, phosphorescent, or fluorescent moieties; and individual fluorescent dyes or fluorescent dyes combined with moieties that can suppress or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative charge) or, optionally, can be charge-neutral. The label can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the label is detectable. In some embodiments, the nucleic acid is detected directly without a label (e.g., directly reading the sequence).

[0034] In the above applications and methods, the product can be a reagent or a kit or a system. The system can include a combined product of a reagent or a kit, an instrument, and analysis software, such as a product composed of PCR primers, PARMS master mix reagent, a microplate reader, and the online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), a combined product composed of PCR primers, PARMS master mix reagent, the online software SNP decoder, and a real-time fluorescence quantitative PCR instrument. The product can include the substances for detecting the polymorphism or genotype of SNPs in the sorghum genome as described above.

[0035] In the above applications and methods, the above-ground dry weight of the sorghum variety with a high above-ground dry weight is relative to the hybrid parent sorghum. If the above-ground dry weights of the two hybrid parent sorghums are the same, the above-ground dry weight of the sorghum variety with a high above-ground dry weight can be equal to or higher than the above-ground dry weight of the hybrid parent sorghum; if the above-ground dry weights of the two hybrid parent sorghums are different, the above-ground dry weight of the sorghum variety with a high above-ground dry weight can be equal to or higher than the above-ground dry weight of the hybrid parent sorghum with a higher above-ground dry weight among the two hybrid parent sorghums.

[0036] In the embodiments of the present invention, through the genetic variation analysis of the SbSOS1 gene in the sorghum inbred line association population, 1 SNP was found. The SNP is located in the SbSOS1 gene, which is related to the above-ground dry weight in the sorghum genome, that is, at the 880th position of the sequence listing SEQ ID No. 1. Through experiments, it was proved that the average above-ground dry weight of sorghum with the SNP genotype of CC was significantly higher than or potentially higher than that of sorghum with the genotype of GG. The above-ground dry weight of 68.05% of the sorghum with the genotype of CC was higher than 0.12 kg, and the above-ground dry weight of 55.84% of the sorghum varieties with the genotype of GG was lower than 0.12 kg. The SNP molecular marker of the present invention can be used for the early prediction and screening of the above-ground dry weight of sorghum, and can also be used for sorghum molecular marker-assisted selection breeding and the breeding of sorghum varieties with high above-ground dry weight. Detailed implementation manners

[0037] The present invention will be further described in detail below in conjunction with the specific implementation manners. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.

[0038] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0039] The following embodiments use GraphPad Prism v8.0 statistical software to process the data. The experimental results are expressed as mean ± standard deviation, and t-tests are used. P < 0.05 (*) indicates significant difference, P < 0.01 (**) indicates extremely significant difference, and P < 0.001 (***) indicates extremely significant difference.

[0040] The 246 sorghum inbred line association populations in the following examples were provided by the Jing Haichun Laboratory of the Key Laboratory of Northern Resource Plants, Institute of Botany, Chinese Academy of Sciences. The detailed information of this association population can be found in the published article: Xiaoyuan Wu, et al.. Genomic footprints of sorghum domestication and breeding selection for multiple end uses. Molecular Plant, 2022, VOLUME 15, ISSUE 3, P537 - 551 (DOI: https: / / doi.org / 10.1016 / j.molp.2022.01.002). The detailed variety information is shown in Table 1.

[0041] Example 1. Discovery of SNP molecular markers related to the dry weight of the above - ground part of sorghum

[0042] I. Statistics of the dry weight of the above - ground part of the test materials

[0043] 1. Planting of the test materials

[0044] In 2021, 246 sorghum inbred line association population germplasm resources were planted in the slightly saline - alkali soil of the Agricultural High - tech Zone in Dongying City, Shandong Province, China. A randomized complete block design was used. The experimental plot was 3 m long and 2 m wide, with 5 rows planted, 10 plants in each row, the plant spacing was 0.3 m, and the row spacing was 0.5 m. Normal irrigation was carried out.

[0045] 2. Statistics of the dry weight of the above - ground part of the test materials

[0046] After the 246 sorghum inbred line association populations were fully mature, 3 plants were selected from each material, and the dry weight of the above - ground part of the main stem of each plant was statistically analyzed. The average value of three replicates was used as the final result of the dry weight of the above - ground part of this sample, as shown in the dry weight of the above - ground part in Table 1.

[0047] II. Discovery of SNP molecular markers related to the gene SbSOS1

[0048] 1. Whole - genome sequencing of the 246 sorghum inbred line association populations

[0049] The whole - genome sequencing data of the 246 sorghum inbred line association populations were provided by the Jing Haichun Laboratory of the Key Laboratory of Northern Resource Plants, Institute of Botany, Chinese Academy of Sciences.

[0050] 2. Discovery of SNP molecular markers related to the gene SbSOS1

[0051] According to the dry weight of the above-ground part of sorghum inbred lines and their genome sequencing results, an SNP locus related to the dry weight of the above-ground part of sorghum, SbSOS1, was screened out. This SNP corresponds to the 62,627,576th position on chromosome 8 of sorghum inbred line BTx623 (BTx623(v3.1) sorghum genome sequence information), and its nucleotide is C or G, corresponding to the 880th position of SEQ ID No.1 in the sequence listing. In SEQ ID No.1 of the sequence listing, s represents g or c.

[0052] The genotype detection results of each sorghum variety are shown in Table 1. The results show that there are two genotypes at the SNP locus (abbreviated as SNP genotypes), namely CC or GG. Genotype CC is the homozygous type with SNP being C, and genotype GG is the homozygous type with SNP being G.

[0053] The genotype related to the gene SbSOS1 obtained above is selected for identifying or assisting in identifying the dry weight of the above-ground part of different sorghum lines; the sorghum with genotype CC is used as a molecular marker for identifying or assisting in identifying the dry weight of the above-ground part of different sorghum lines, and the dry weight of the above-ground part of the sorghum line containing sorghum with genotype CC may be higher than 0.12 kg.

[0054] III. Design of specific primers for the SNP molecular marker related to the gene SbSOS1 and establishment of its method

[0055] 1. Design of genomic specific primers for the SNP locus related to the gene SbSOS1

[0056] Specific primer sequences for the SNP (SEQ ID No.2, SEQ ID No.3, and SEQ ID No.4 in the sequence listing) were designed and all were synthesized by Zhongyu Jinmarker (Beijing) Biotechnology Co., Ltd.

[0057] The primer set F1 for identifying the polymorphism of the SNP locus is as follows:

[0058] Specific primer F1-A (SEQ ID No.2):

[0059] 5’-GAAGGTGACCAAGTTCATGCTGTTGCAGGGCCCTGGAAGAC-3’

[0060] Specific primer F1-B (SEQ ID No.3):

[0061] 5’- GAAGGTCGGAGTCAACGGATT GTTGCAGGGCCCTGGAAGAG-3’

[0062] Universal primer F1-C (SEQ ID No.4): 5’-CAACCTAGGCCTAGCAGCTGAGAT-3’

[0063] The primer set F1 for identifying the polymorphism of SNP sites above was designed according to the sense strand of sequence SEQ ID No.1.

[0064] The underlined sequence in the above primer F1-A is the FAM sequence; the underlined sequence in F1-B is the HEX sequence.

[0065] For the fragment of the single-stranded DNA molecule amplification sequence table SEQ ID No.1 with SNP site C shown by the above sequences SEQ ID No.2 and SEQ ID No.4, the fluorescence signal of the fluorophore combined with the FAM sequence in the template can be read by a microplate reader or a real-time fluorescence quantitative PCR instrument; for the fragment of the single-stranded DNA molecule amplification sequence table SEQ ID No.1 with SNP site G shown by the above sequences SEQ ID No.3 and SEQ ID No.4, the fluorescence signal of the fluorophore combined with the HEX sequence in the template can be read by a microplate reader or a real-time fluorescence quantitative PCR instrument.

[0066] 2. Establishment of detection method

[0067] 2.1 DNA extraction

[0068] Extract the genomic DNA of the leaves of the tested sorghum variety, dissolve it with ddH2O and use it as a template for PCR amplification.

[0069] 2.2 PCR amplification and fluorescence signal detection

[0070] Use the SNP primer set F1 in step 1 to perform PCR amplification on the template obtained in 2.1 respectively, and detect the polymorphism (nucleotide type) and genotype of the SNP site; use the Douglas-Araya high-throughput pipeline fluorescence signal scanner to read the fluorescence data of the PCR products of the F1 primer set, and use the Douglas dedicated software - Kraken to process the fluorescence signals.

[0071] Prepare a primer mixture: First, dilute the three primers, primer F1-A, primer F1-B, and primer F1-C, with ddH2O to 100 mmol·L -1 , and obtain primer F1-A solution, primer F1-B solution, and primer F1-C solution respectively. Take 60 μL of primer F1-A solution, 60 μL of primer F1-B solution, and 150 μL of primer F1-C solution, and add 230 μL of 10 mM Tris-HCL to obtain primer mixture F1.

[0072] The reaction system detected by a 2 μL PCR fluorescence quantitative analyzer includes: 50 ng of genomic DNA, 0.02 μL of primer mixture, 0.6 μL of 1×KASP Mix (Low Rox) from LGC Company, and the rest is ddH2O. According to the operation manuals of the Douglas-Nexar and Soellex water bath systems, edit the program and run it, and save the data.

[0073] If the PCR product of the F1 primer set shows only the fluorescence signal of the fluorophore bound to the FAM sequence, then the genotype of the SNP locus of the sorghum to be tested is CC (i.e., the homozygous type with SNP locus C in the sorghum genome); if it shows only the fluorescence signal of the fluorophore bound to the HEX sequence, then the genotype of the SNP locus of the sorghum to be tested is GG (i.e., the homozygous type with SNP locus G in the sorghum genome); if it shows both the fluorescence signal of the fluorophore bound to the FAM sequence and the fluorescence signal of the fluorophore bound to the HEX sequence, then the genotype of the SNP locus of the sorghum to be tested is CG (i.e., the heterozygous type with SNP locus C and G in the sorghum genome).

[0074] Determine the genotype related to the gene SbSOS1 to identify or assist in identifying the above-ground dry weight of the tested sorghum varieties: The above-ground dry weight of sorghum with the genotype CC of the SNP of the sorghum to be tested (such as sorghum inbred lines) is higher than or potentially higher than that of sorghum with the SNP genotype GG (such as sorghum inbred lines).

[0075] Example 2. Application of SNP molecular markers of the SbSOS1 gene significantly associated with the above-ground dry weight of sorghum

[0076] Sorghum to be tested: 246 sorghum inbred line association populations

[0077] I. Determination of the above-ground dry weight of sorghum

[0078] The method is the same as that in Example 1. The results show that when 246 sorghum inbred lines are planted in the farmland soil of the mild saline-alkali land in the Agricultural High-tech Zone of Dongying City, Shandong Province, China, there are significant differences in the above-ground dry weights of different sorghum varieties. The range of the above-ground dry weight of sorghum is 0.045 - 0.3 kg, and among them, the above-ground dry weights of 150 sorghum inbred lines exceed or are equal to 0.12 kg, accounting for about 60.98% of this association population.

[0079] II. Molecular identification or assisted identification of the above-ground dry weight of sorghum inbred lines

[0080] Extract the genomic DNA of the sorghum to be tested, dissolve it with ddH2O as a template. Use the genomic specific primer SNP primer set F1 of the SNP locus in Example 1 for PCR amplification to obtain the polymorphism information of the SNP locus of the SbSOS1 gene, thereby determining the genotype related to the gene SbSOS1 of the sorghum to be tested, and thus identifying or assisting in identifying the above-ground dry weight of the sorghum varieties to be tested: The above-ground dry weight of sorghum (such as sorghum inbred lines) with the CC genotype of the SNP to be tested is higher than or candidate higher than that of sorghum (such as sorghum inbred lines) with the GG genotype of the SNP.

[0081] The genotypes of the SNP locus and the above-ground dry weight phenotypes of sorghum in 246 sorghums to be tested are shown in Table 1. The SNP locus of the sorghum to be tested contains two genotypes, CC and GG (shown in the SNP genotype column).

[0082] The test results show that among 246 sorghum varieties, among 169 sorghum varieties with the CC genotype, 115 sorghum varieties with the CC genotype have an above-ground dry weight greater than or equal to 0.12 kg, that is, 68.05% of the sorghum varieties with the CC genotype have an above-ground dry weight greater than or equal to 0.12 kg; among 77 sorghum varieties with the GG genotype, 42 sorghum varieties have an above-ground dry weight less than 0.12 kg, that is, 54.55% of the sorghum varieties with the GG genotype have an above-ground dry weight less than 0.12 kg. This indicates that SNP molecular markers can be used to breed sorghum varieties with high above-ground dry weight of the CC genotype and eliminate sorghum varieties with low above-ground dry weight of the GG genotype. The SNP molecular markers in the present invention are practical and effective for the assisted selection of the above-ground dry weight of sorghum.

[0083] Table 1 Above-ground dry weight and genotype of SNP locus of 246 sorghum inbred lines

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098] Note: IS: Sweet Sorghum; IG: Grain Sorghum; LG: Grain Sorghum; AL: unknown; LB: Broom Sorghum

[0099] The significant difference analysis was carried out on the two genotypes and the above-ground dry weight. The results showed that there was a significant difference (P<0.05) in the above-ground dry weight between the homozygous genotype (CC) sorghum of SNP and the homozygous genotype (GG) sorghum. The above-ground dry weight of the sorghum corresponding to the genotype SNP-CC was higher than or potentially higher than that of the sorghum corresponding to SNP-GG.

[0100] Table 2 Above-ground dry weight and difference analysis of 246 sorghum inbred lines corresponding to different genotypes of the gene SbSOS1 SNP locus

[0101] Genotype Number of varieties / piece Median (kg) Dry weight (kg) CC 169 0.14 <![CDATA[0.1447±0.05021 a > GG 77 0.1133 <![CDATA[0.1254±0.04787 b >

[0102] The above has described the present invention in detail. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by using conventional techniques known in the art that depart from the scope disclosed in this application. Some basic features can be applied according to the scope of the following appended claims.

Claims

1. A method for identifying or assisting in the identification of the above-ground dry weight of sorghum, the method comprising detecting the genotype of SNPs in the sorghum to be tested, and identifying or assisting in the identification of the above-ground dry weight of sorghum according to the genotype: the above-ground dry weight of sorghum with the genotype of CC is higher than or potentially higher than that of sorghum with the genotype of GG; the SNP is a SNP in the sorghum genome, which is the 880th nucleotide of SEQ ID No.1 in the sequence listing, and it is C or G; the CC is a homozygous type in which the 880th nucleotide of SEQ ID No.1 in the sequence listing is C, and the GG is a homozygous type in which the 880th nucleotide of SEQ ID No.1 in the sequence listing is G.

2. A method for sorghum breeding, comprising detecting the polymorphism or genotype of the SNP described in claim 1 in the sorghum to be tested, and selecting sorghum with the genotype of CC as a parent for breeding; the sorghum breeding is to cultivate sorghum with a high above-ground dry weight or to select sorghum with a high above-ground dry weight.

3. The application of the method according to claim 1 in sorghum breeding; the sorghum breeding is to cultivate sorghum with a high above-ground dry weight or to select sorghum with a high above-ground dry weight.

4. Application, characterized in that: The application is P1 or Q1: The P1 is the application of a substance for detecting the polymorphism or genotype of the SNP in the identification or assistance in the identification of the above-ground dry weight of sorghum, the SNP is a SNP in the sorghum genome, which is the 880th nucleotide of SEQ ID No.1 in the sequence listing, and it is C or G; The Q1 is the application of a substance for detecting the polymorphism or genotype of the SNP in the preparation of a product for identifying or assisting in the identification of the above-ground dry weight of sorghum; the SNP is a SNP in the sorghum genome, which is the 880th nucleotide of SEQ ID No.1 in the sequence listing, and it is C or G.

5. The application according to claim 4, wherein: The substance for detecting the polymorphism or genotype of the SNP is one of the following D1), D2) or D3): D1) A PCR amplification primer containing a sorghum genomic DNA fragment amplifying the SNP locus; D2) An in vitro nucleic acid amplification reagent containing the PCR amplification primer described in D1); D3) A kit containing the PCR amplification primer described in D1) or the in vitro nucleic acid amplification reagent described in D2).

6. The application according to claim 5, characterized in that: The in vitro nucleic acid amplification primer is F1-1, F1-2: F1-1: A primer set composed of the single-stranded DNA shown in SEQ ID No.2 in the sequence listing, the single-stranded DNA shown in SEQ ID No.3 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.4 in the sequence listing; F1-2: A primer set composed of the single-stranded DNA with the nucleotide sequence being the 22nd - 41st positions of SEQ ID No.2 in the sequence listing, the single-stranded DNA with the nucleotide sequence being the 22nd - 41st positions of SEQ ID No.3 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.4 in the sequence listing.

7. Application, characterized in that: Use of a substance for detecting the polymorphism or genotype of SNP in sorghum breeding or for preparing sorghum breeding products; the SNP is an SNP in the sorghum genome, which is the 880th nucleotide of SEQ ID No.1 in the sequence listing, and is C or G; the sorghum breeding is to cultivate sorghum with high above-ground dry weight or to select sorghum with high above-ground dry weight.

8. The application according to claim 7, wherein: The substance for detecting the polymorphism or genotype of SNP is any of the following D1), D2) or D3): D1) A PCR amplification primer containing a sorghum genomic DNA fragment that amplifies the SNP site; D2) An in vitro nucleic acid amplification reagent containing the PCR amplification primer described in D1); D3) A kit containing the PCR amplification primer described in D1) or the in vitro nucleic acid amplification reagent described in D2).

9. The application according to claim 8, characterized in that: The in vitro nucleic acid amplification primer is F1-1, F1-2: F1-1: A primer group composed of the single-stranded DNA shown in SEQ ID No.2 in the sequence listing, the single-stranded DNA shown in SEQ ID No.3 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.4 in the sequence listing; F1-2: A primer group composed of the single-stranded DNA with the nucleotide sequence of positions 22-41 of SEQ ID No.2 in the sequence listing, the single-stranded DNA with the nucleotide sequence of positions 22-41 of SEQ ID No.3 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.4 in the sequence listing.

Images