Phytophthora capsici stt3b protein and coding gene and application thereof
By studying the STT3B protein PcSTT3B of Phytophthora capsici and knocking out its gene using CRISPR/Cas9 technology, the mycelial growth and infection ability of Phytophthora capsici were regulated, thus solving the threat of Phytophthora capsici to agricultural production and providing a new fungicide target and control method.
Patent Information
- Application Number
- CN202210971950.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-08-17
- Filing Date
- 2022-08-14
- Publication Date
- 2025-12-30
- Estimated Expiration
- 2042-08-14
AI Technical Summary
Phytophthora capsici causes severe damage to agricultural production, and existing technologies lack effective control methods, especially in understanding the role of its N-glycosylation in the pathogen's infection and evasion of host immunity.
The study investigated the STT3B protein PcSTT3B in Phytophthora capsici, and explored how gene editing technologies such as CRISPR/Cas9 can be used to knock out the PcSTT3B gene, affecting mycelial growth, zoospore production, and infectivity, thus developing it into a novel fungicide target.
Effective regulation of mycelial growth rate, zoospore release, and pathogenicity of Phytophthora capsici provides a new strategy for pathogen control, reducing the pathogen's ability to infect and its pathogenicity to the host.
Smart Images

Figure SMS_2 
Figure SMS_3 
Figure SMS_4
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to *Phytophthora capsici* (… Phytophthora capsici The STT3B (staurosporine and temperature-sensitive) protein PcSTT3B and its encoding gene and applications. Background Technology
[0002] *Phytophthora capsici* is a typical oomycete pathogen belonging to the genus *Phytophthora* in the family Pythaceae. It can infect various host plants, including those in the Solanaceae, Fabaceae, and Cucurbitaceae families, causing damping-off, wilting, and rotting, resulting in severe economic losses to agricultural production. *Phytophthora capsici* spreads via rainwater and irrigation water. Its sporangia can germinate directly and infect the host, or they can release zoospores upon contact with water. These asexual spores, which float in the water, come into contact with the host surface, germinate after dormancy, and produce germ tubes, which then colonize the host. Under suitable environmental conditions, *Phytophthora capsici* can produce a large number of sporangia on the infected host surface, initiating the next disease cycle. Therefore, sporangia and zoospores play a crucial role in the multiple infection cycles of *Phytophthora capsici* during a growing season.
[0003] N-glycosylation is widespread in mammals, plants, protozoa, prokaryotes, and fungi. Due to its crucial role in biological processes such as cell adhesion, molecular transport, receptor activation, signal transduction, and endocytosis, key enzymes in the N-glycosylation pathway have been discovered and studied in various species. N-glycosylation is catalyzed by oligosaccharide transferases, which are heterooligomeric membrane protein complexes found in animals, plants, and fungi that catalyze the transfer of oligosaccharides to the Asn residues of receptor polypeptides. STT3 is the largest molecular weight protein among eukaryotic oligosaccharide transferases, highly conserved and possessing catalytic activity. Because oligosaccharide transferases play a vital catalytic role in N-glycosylation, their catalytic mechanisms have been studied and investigated in various species.
[0004] In recent years, the biological functions of N-glycosylation in pathogens have been gradually analyzed, such as those in the human pathogen Candida albicans. Monilia albican ), plant pathogen corn smut fungus ( Ustilago maydis ), rice false smut ( Magnaporthe oryzae ) and Gramineae ( Mycosphaerella graminicola N-glycosylation plays a crucial role in the infection of plants by pathogens and their evasion of host plant immunity. *Aspergillus fumigatus* (… Aspergillus fumigatus ) AfSTT3Knockout disrupts the cell wall integrity of Aspergillus fumigatus and inhibits hyphal growth. N-glycosylation, the process of covalently linking N-glycans to proteins, has important biological significance for cell wall integrity and pathogenicity.
[0005] In conclusion, *Phytophthora capsici* is an important plant pathogen that poses a serious threat to agricultural production and the economy. Summary of the Invention
[0006] This invention conducts research on the function of PcSTT3B, a homolog of the STT3 protein in Phytophthora capsici, which will provide a deeper understanding of the role of N-glycosylation in regulating the growth and development of Phytophthora capsici and its interaction with the host, and provide reference and guidance for the design of novel targets for the control of oomycetes.
[0007] The inventors' research revealed that PcSTT3B in *Phytophthora capsici* is closely related to the mycelial growth rate, zoospore release, and pathogenicity of the fungus. These results indicate that the PcSTT3B protein in *Phytophthora capsici* plays a crucial regulatory role in the physiological and pathogenic processes of the pathogen. Developing this gene as a molecular drug target for the oomycete *Phytophthora capsici* holds significant application potential.
[0008] Therefore, one of the objectives of this invention is to provide the *Phytophthora capsici* STT3B protein, named PcSTT3B, derived from *Phytophthora capsici* strain BYA5, and is a protein as follows: A1) or A2) A3) or A4)
[0009] A1) The amino acid sequence of the protein is as shown in sequence 2;
[0010] A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein as shown in Sequence 2;
[0011] A3) Proteins derived from the protein shown in Sequence 2 that have the same function, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2.
[0012] A4) An amino acid sequence that has a similarity of 75% or more, preferably 85% or more, and more preferably 95% or more to the amino acid sequence shown in Sequence 2, and has the same function as the amino acid sequence shown in Sequence 2.
[0013] To facilitate the purification of proteins in A1, tags such as Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), and c-myc (EQKLISEEDL) can be attached to the amino or carboxyl terminus of proteins with amino acid sequences as shown in Sequence 2 of the sequence listing.
[0014] The proteins listed in A1)-A4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically. The encoding genes of the proteins listed in A2)-A4) above can be obtained by deleting one or more amino acid residues from the DNA sequence shown in Sequence 1 of the sequence listing, and / or by performing a missense mutation on one or more nucleotide pairs, and / or by attaching the coding sequence of the above tag to its 5' end and / or 3' end.
[0015] In A1), sequence 2 (PcSTT3B) in the sequence listing consists of 735 amino acid residues.
[0016] A second objective of this invention is to provide a nucleic acid molecule encoding the required STT3B protein. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; it can also be RNA, such as mRNA, hnRNA, or tRNA.
[0017] The gene encoding the STT3B protein is either B1, B2, or B3.
[0018] B1) The DNA molecule represented by the nucleotide sequence described in Sequence 1 of the sequence listing;
[0019] B2) has 75% or more, 85% or more, or 95% or more identity with the nucleotide sequence shown in B1) and encodes the above-mentioned PcSTT3B protein cDNA molecule or DNA molecule.
[0020] B3) hybridizes with the nucleotide sequence defined by B1) or B2) under strict conditions and is a cDNA molecule or DNA molecule encoding the above-mentioned PcSTT3B protein.
[0021] The above-mentioned coding gene, sequence 1 in the sequence listing consists of 2389 nucleotides; the coding sequence is from the 5' end of sequence 1, positions 1-90, 150-861, 922-1616 and 1679-2389, which encodes the protein PcSTT3B shown in sequence 2 in the sequence listing.
[0022] The RNA molecule mentioned above is the RNA molecule obtained by transcribing the coding gene mentioned above;
[0023] Preferably, the sequence of the RNA molecule is as follows (C1) or (C2):
[0024] C1) An RNA sequence transcribed from a DNA sequence as shown in Sequence 1 or Sequence 3 has a similarity of 75% or more, more preferably 85% or more, and more preferably 95% or more, and has the same function as the RNA sequence transcribed from the DNA sequence as shown in Sequence 1 or Sequence 3.
[0025] C2) An RNA sequence transcribed from a DNA sequence as shown in Sequence 1.
[0026] The DNA sequence of the present invention, under stringent conditions, can hybridize with the DNA sequence shown in Sequence 1 and encode a protein as shown in Sequence 2. The stringent conditions can be hybridization at 65 °C with a solution of 6×SSC, 0.5% SDS, followed by washing once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.
[0027] A third objective of this invention is to provide the above-mentioned nucleic acid molecule-related biological materials, including recombinant vectors, expression cassettes, recombinant microorganisms, or transgenic plant cell lines. The recombinant vector can be a recombinant expression vector or a recombinant cloning vector. In the above-mentioned biological materials, the vector can be a plasmid, granule, bacteriophage, or viral vector; the microorganism can be yeast, bacteria, algae, or fungi, such as Agrobacterium; the transgenic plant cell line does not include propagation material. Specifically, it can be any one of the following D1) to D10):
[0028] D1) An expression cassette containing the encoded gene;
[0029] D2) A recombinant vector containing the coding gene, or a recombinant vector containing the expression cassette described in D1);
[0030] D3) Recombinant microorganisms containing the coding gene, or recombinant microorganisms containing the expression cassette of D1), or recombinant microorganisms containing the recombinant vector of D2);
[0031] D4) A transgenic plant cell line containing the coding gene, or a transgenic plant cell line containing the expression cassette described in D1);
[0032] D5) Transgenic plant tissue containing the coding gene, or transgenic plant tissue containing the expression cassette described in D2);
[0033] D6) A transgenic plant organ containing the coding gene, or a transgenic plant organ containing the expression cassette described in D2);
[0034] D7) Nucleic acid molecules that inhibit the expression of the encoded gene;
[0035] D8) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in D7);
[0036] D9) Nucleic acid molecules that inhibit the translation of the above RNA molecules;
[0037] D10) produces expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines that generate the nucleic acid molecules described in D9).
[0038] The fifth objective of this invention is to provide the application of the PcSTT3B protein of Phytophthora capsici and the nucleic acid molecule encoding the PcSTT3B protein or biomaterials containing the nucleic acid molecule encoding the PcSTT3B protein.
[0039] The application is any one or more of the following 1)-5):
[0040] 1) Application in regulating (increasing or decreasing) the production of zoospores of Phytophthora capsici;
[0041] 2) Application in regulating (increasing or decreasing) the growth rate of *Phytophthora capsici* mycelium;
[0042] 3) Application in regulating (increasing or decreasing) the germination and host infection ability of Phytophthora capsici dormant spores;
[0043] 4) Application in regulating (increasing or decreasing) the pathogenicity of Phytophthora capsici to the host;
[0044] 5) Application in inhibiting and / or killing Phytophthora capsici;
[0045] Preferably, the application includes the application described in 1)-5) by inhibiting or inactivating transcription in the coding gene of sequence 1, or inhibiting translation of the RNA molecule, or inhibiting and / or inactivating the activity of the PcSTT3B protein of sequence 2.
[0046] In the aforementioned applications, by inhibiting the transcription of the coding genes described above, or inhibiting the translation of the RNA sequences described above, or inhibiting and / or inactivating the activity of the PcSTT3B protein described above, the growth rate of mycelia is interfered with, zoospore production is affected, and the ability to infect hosts is regulated, thereby inhibiting and / or killing the growth of Phytophthora capsici.
[0047] The sixth objective of this invention is to provide the application of the PcSTT3B protein shown in sequence 2 of the above sequence listing and the coding gene shown in sequence 1 of the above sequence listing as targets for screening antibacterial or fungicidal agents against Phytophthora capsici.
[0048] The seventh objective of this invention is to provide a method for screening or assisting in the screening of antibacterial and / or fungicidal agents against Phytophthora capsici. The method includes applying a test substance to the Phytophthora capsici pathogen. When the test substance can inhibit the transcription of the DNA sequence as shown above, or inhibit the translation of the RNA sequence as shown above, or inhibit and / or inactivate the PcSTT3B protein as shown above, the test substance is a candidate antibacterial and / or fungicidal agent against Phytophthora capsici.
[0049] The eighth objective of this invention is to provide a method for reducing the activity of Phytophthora capsici, comprising the following steps: inhibiting or deleting the transcription of the coding gene as described above, or inhibiting the translation of the RNA molecule described above, or inhibiting and / or inactivating the activity of the PcSTT3B protein as described above.
[0050] The reduction of the activity of Phytophthora capsici is to reduce the infectivity and / or pathogenicity of Phytophthora capsici to the host, and / or reduce the growth rate of Phytophthora capsici, and / or inhibit the production of zoospores of Phytophthora capsici.
[0051] In the above method, protein inactivation is achieved by inhibiting or reducing the expression of the gene encoding the protein whose activity is to be inhibited or inactivated. Specifically, this can be achieved through gene knockout or gene silencing.
[0052] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.
[0053] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing can occur at two levels: one is transcriptional gene silencing caused by DNA methylation, heterochromatinization, and position effects; the other is post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level by specifically inhibiting target RNA, including antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.
[0054] Preferably, the protein represented by sequence 1 in the sequence listing of Phytophthora capsici is knocked out to inactivate the protein represented by sequence 2 in the sequence listing;
[0055] In one embodiment of the present invention, the method for knocking out the above-mentioned gene is based on the CRISPR / Cas9 gene knockout method.
[0056] Specifically, the CRISPR / Cas9-based gene knockout method involves transfecting the Donor vector and sgRNA expression vector of the target gene, along with the Cas9 expression plasmid, into Phytophthora capsici and screening to obtain recombinant bacteria with inactivated target knockout proteins.
[0057] The Donor vector is a recombinant vector containing a sequence of 800-1500 bp upstream of the target gene to be knocked out, a Doodor DNA sequence (which can be a gene sequence such as NPTII, GFP, or RFP), and a sequence of 800-1500 bp downstream of the target gene to be knocked out, connected in sequence.
[0058] sgRNA expression plasmids are vectors that express sgRNA fragments targeting a gene to be knocked out, wherein the target gene to be knocked out is... PcSTT3B Genes, targeted PcSTT3B The sgRNA sequences of the gene are sgPcSTT3B: GTAGGCACTACAGTGTATCC
[0059] Preferably, the sgRNA expression plasmid uses the pYF2.3G-Ribo-sgRNA vector as the starting vector, and... PcSTT3B The double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the gene was inserted between the NheI and BsaI enzyme recognition sites of the pYF2.3G-Ribo-sgRNA vector to obtain the sgRNA expression plasmid.
[0060] The application of substances that inhibit the expression and / or activity of PcSTT3B protein in the preparation of fungicides against Phytophthora capsici, the causal agent of plant ...
[0061] In the above applications, the substance that inhibits the expression and / or activity of PcSTT3B protein is a substance that inhibits the expression of PcSTT3B protein and / or inhibits the transcription of the gene encoding PcSTT3B protein and / or inhibits the translation of RNA molecules obtained from the transcription of the gene encoding PcSTT3B protein.
[0062] Experiments have demonstrated that the PcSTT3B protein provided by this invention plays a role in the growth and development of *Phytophthora capsici*. Knockout transformants obtained using CRISPR / Cas9 gene editing technology exhibit significant changes in growth and development compared to the wild-type parent strain, primarily including:
[0063] PcSTT3BGene knockout leads to slower mycelial growth, reduced zoospore production, and weakened ability to infect host plants. Therefore, the PcSTT3B protein in *Phytophthora capsici* plays a crucial role in multiple processes, including vegetative growth, asexual reproduction, and host infection. This invention provides technical support for research on the pathogenic mechanism of *Phytophthora capsici* and offers a potential molecular target for the development of novel fungicides. Attached Figure Description
[0064] Figure 1 The strain was *Phytophthora capsici* BYA5 (WT), and the control transformant was CK. PcSTT3B A bar chart showing the colony diameter of the gene knockout transformant strains (B8, B146, and B159 represent three PcSTT3B gene knockout transformants) (cultured on V8 solid medium for 3 days).
[0065] Figure 2 The strain was *Phytophthora capsici* BYA5 (WT), and the control transformant was CK. PcSTT3B The pathogenicity of zoospores of gene knockout transformant strains (B8, B146, and B159 represent three PcSTT3B gene knockout transformants) in pepper leaves. Detailed Implementation
[0066] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0067] The *Phytophthora capsici* strain BYA5 was isolated, identified, and preserved in 2011 by the Seed Pathology and Fungicide Pharmacology Laboratory of the College of Plant Protection, China Agricultural University. It was isolated from diseased pepper samples in Gansu Province and is available to the public from China Agricultural University.
[0068] Culture medium or reagent formulation:
[0069] 10% V8 solid culture medium: 100 ml V8 vegetable juice, 1.4 g CaCO3, stir well, dilute 10 times with deionized water, i.e., add 900 ml deionized water, add 15 g Agar, autoclave at 121 ℃ for 20 min.
[0070] 10% V8 liquid culture medium: 100 ml V8 vegetable juice, 1.4 g CaCO3, stir well, centrifuge at 12000 rpm for 5 min, take the supernatant, dilute 10 times with deionized water, and autoclave at 121 ℃ for 20 min.
[0071] Nutrient pea broth (NPB): Add 125 g of peas to 1 L of deionized water, autoclave at 121℃ for 20 min, and filter through gauze to obtain the pea nutrient solution. Mix 2.0 g yeast extract, 5.0 g glucose, 5.0 g mannitol, 5.0 g sorbitol, 2.0 g CaCO3, 0.1 g CaCl2, 0.5 g MgSO4, 3.0 g KNO3, 1.0 g K2HPO4, and 1.0 g KH2PO4. Centrifuge at 3000 rpm for 10 min or let stand for 30 min. Take the supernatant and bring the volume to 1 L with the pea nutrient solution. Add 15 g agar powder to the solid medium (NPBA) and autoclave for 20 min. Before use, add 2 ml of vitamin stock solution (Biotin 6.7 × 10⁻⁶) in a sterile operating room. -7 g / ml; Folic acid 6.7 × 10 -7 g / ml; L-inositol 4.0 × 10 -5 g / ml; Nicotinic acid 4.0 × 10 -5 g / ml; Pyridoxine-HCl 6.0 × 10 -4 g / ml; Riboflavin 5.0 × 10 -5 g / ml; Thiamine-HCl 1.3 × 10 -3 g / ml) and 2 ml of trace element stock solution (FeC6H5O7•3H2O 5.4 × 10 g / ml) -4 g / ml; ZnSO4•7H2O 3.8 × 10 -4 g / ml; CuSO4•5H2O 7.5 ×10 -4 g / ml; MgSO4•H2O 3.8 × 10 -5 g / ml; H3BO3 2.5 × 10 -5 g / ml; Na2MoO4•H2O 3.0 × 10 -5 g / ml).
[0072] Pea Mannitol (PM) medium: 91.1 g mannitol, 1 g CaCl2, 2 g CaCO3, add to about 900 ml pea nutrient solution, stir and mix for about 30 min, centrifuge at 3000 rpm for 10 min or let stand for 30 min, take the supernatant, and make up to 1 L with pea nutrient solution. Add 15 g agar powder to solid medium (PMA), and sterilize by moist heat for 20 min.
[0073] Mycelial enzymatic hydrolysate (20 ml): 10 ml 0.8 M mannitol, 0.8 ml 0.5 M KCl, 0.8 ml 0.5 M 4-morpholinoethanesulfonic acid, 0.4 ml 0.5 M CaCl2, 0.12 g cellulase (Calbiochem, cat. No. 219466), 0.12 g lyase (Sigma, cat. No. L1412), bring to a final volume of 20 ml with sterile ultrapure water, mix well to dissolve, filter through a 0.22 μm filter membrane for sterilization, prepare fresh before use.
[0074] MMG solution (250 ml): 18.22 g mannitol, 0.76 g MgCl2•6H2O, 2.0 ml 0.5 M 4-morpholinoethanesulfonic acid (pH=5.7), diluted to 250 ml with ultrapure water, and sterilized by filtration through a 0.22 μm filter membrane.
[0075] W5 solution: 0.1 g KCl, 4.6 g CaCl2•2H2O, 2.25 g NaCl, 7.8 g glucose, dissolved in ultrapure water and brought to a final volume of 250 ml, then filtered through a 0.22 μm membrane for sterilization.
[0076] PEG-CaCl2 solution (40% w / v): 12 g PEG 4000, 3.75 ml 0.5 M CaCl2, 3 ml sterile ultrapure water, sterilized by filtration through a 0.22 μm filter membrane.
[0077] The pBluescript II SK+ homologous arm vector plasmid (Donor vector), sgRNA expression vector pYF2.3G-Ribo-sgRNA, and Cas9 expression plasmid pYF2-Cas9 used in this embodiment were all donated by Professor Brett M. Tyler of Oregon State University, USA.
[0078] Example 1: Obtaining the PcSTT3B protein and its encoding gene from Phytophthora capsici.
[0079] In this embodiment, the PcSTT3B protein and its encoding gene (or cDNA) of *Phytophthora capsici* can be obtained by amplification using the DNA (or cDNA) of the *Phytophthora capsici* standard strain BYA5 as a template, through the primers listed in Table 1. The material from which DNA or RNA is extracted can be the mycelium of the *Phytophthora capsici* standard strain BYA5. The encoding gene of PcSTT3B... PcSTT3BAs shown in Sequence 1 of the sequence listing, Sequence 1 consists of 2389 nucleotides; the coding sequence is located at positions 1-90, 150-861, 922-1616, and 1679-2389 from the 5' end of Sequence 1, encoding the protein PcSTT3B shown in Sequence 2 of the sequence listing. The above protein or gene can also be synthesized artificially.
[0080] Table 1. PcSTT3B Primers for amplifying full-length coding genes
[0081]
[0082] Example 2, Phytophthora capsici PcSTT3B Construction of gene knockout vector
[0083] This embodiment describes the CRISPR / Cas9-based gene knockout vector construction method and the sequence of the relevant vector. NPT II The gene sequence is found in the literature "Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae usingCRISPR / Cas9. Molecular plant pathology, 17(1), 127-139." and "Fang, Y., Cui,L., Gu, B., Arredondo, F., and Tyler, BM (2017). Efficient genome editing in the oomycete Phytophthora sojae The pBluescript II SK+ homologous arm vector plasmid (Donor vector), sgRNA expression vector pYF2.3G-Ribo-sgRNA, and Cas9 expression plasmid pYF2-Cas9 used in this embodiment were all donated by Professor Brett M. Tyler of Oregon State University.
[0084] The Donor vector pBS-NPTII-PcSTT3B and sgRNA expression plasmid pYF2.3G-PcSTT3B used in this embodiment are constructed as follows:
[0085] Construction of the homologous arm vector pBS-NPTII-PcSTT3B: Using DNA from *Phytophthora capsici* strain BYA5 as a template, primers were designed using the TaKaRa-In-Fusion Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to amplify the target gene. PcSTT3B The upstream 1000 bp sequence (as shown in sequence 3 in the sequence listing, obtained by amplification using primers pBS-NPTII-STT3B-F1 and pBS-NPTII-STT3B-R1 as shown in Table 2) NPTII Gene sequence ( NPTII The gene was amplified using the pYF2-Cas9 backbone plasmid as a template and primer sequences shown in Table 2 (pBS-NPTII-STT3B-F2 and pBS-NPTII-STT3B-R2). PcSTT3B The downstream 1000 bp sequence (shown as Sequence 4 in the sequence listing, obtained by amplification using primers pBS-NPTII-STT3B-F3 and pBS-NPTII-STT3B-R3 as shown in Table 2) was used to sequentially fuse the three amplified fragments into the cloning vector pBluescript II SK+ (digested with EcoR V) using the In-Fusion® HD Cloning Kit. The ligation product was transformed into E. coli DH5α competent cells and cultured overnight at 37°C. The clones were then amplified and sequenced using universal primers M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') / M13R (sequence: 5'-CAGGAAACAGCTATGACC-3') to verify the clones. The clones containing the sequentially ligated fragments were then... PcSTT3B Upstream 1000 bp sequence, Gene sequence and NPTII The recombinant expression vector containing the downstream 1000 bp sequence was named pBS-NPTII-PcSTT3B.
[0086] Table 2. PcSTT3B Gene knockout homologous arm vector construction amplification primers
[0087]
[0088] 2) Construction of pYF2.3G-STT3B: Using the sgRNA design website EuPaGDT (http: / / grna.ctegd.uga.edu / ) and the online RNA structure analysis tool (http: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / Predict1 / Predict1.html), specific targets were selected. PcSTT3B The gene and the sgRNA sequence with a weak secondary structure (sgSTT3B: GTAGGCACTACAGTGTATCC, targeting) PcSTT3B The sequence of the gene (SEQ ID No. 1, positions 270-289) was sent to the company for synthesis of forward and reverse sgRNA primers containing NheI and BsaI restriction sites and HH ribozyme (as shown in Table 3). The primers were dissolved in sterile water to prepare a 100 μM solution. The double-stranded sgRNA sequence was synthesized by annealing. The reaction system consisted of: 3 μl forward strand solution, 3 μl reverse strand solution, 3 μl 10 × T4 DNA Ligase Buffer (NEB), 4 μl 0.5 M NaCl, and 21 μl ultrapure sterile water. The mixture was pipetted and stirred, reacted at 100℃ for 2 min, and then allowed to cool naturally at room temperature for 4 h. The reaction solution was then diluted 500-fold. Take 2 μl of 10 × T4 DNA Ligase Buffer (NEB), 50 ng of pYF2.3G-Ribo-sgRNA vector (double digested with Nhe I / Bsa I), 4 μl of diluted double-stranded sgRNA solution, 1 μl of T4 DNA Ligase, and sterile ultrapure water to bring the total volume to 20 μl. Incubate at room temperature for 30 min. Transform 5 μl of the ligation product into E. coli DH5α competent cells. After overnight culture at 37°C, colony PCR is performed using primer pair RPL41_Pseq_F (sequence: 5'-CAAGCCTCACTTTCTGCTGACTG-3') / M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') to verify the colony PCR and sequence positive clones. The recombinant vector that is verified to express the above sgRNA is named pYF2.3G-STT3B.
[0089] Table 3. Synthesis PcSTT3B nucleotide sequence of gene knockout sgRNA
[0090]
[0091] Example 3, Phytophthora capsici PcSTT3B Obtaining gene knockout transformants
[0092] Prepared using CaCl2-PEG mediated protoplast transformation method PcSTT3B The gene knockout transformant, the method of oomycete genetic transformation, is described in the literature "Fang, Y., and Tyler, BM (2016). Efficient disruption and replacement of an effector gene in the oomycete PcSTT3B It was published in “using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139.”
[0093] Specifically, the knockout transformant was obtained by taking the knockout gene obtained in Example 1. Phytophthora sojae The Donor vector, sgRNA vector, and Cas9 expression plasmids (pBS-NPTII-PcSTT3B, pYF2.3G-STT3B, and pYF-Cas9) were co-transformed into protoplasts of *Phytophthora capsici* BYA5. Transformants were screened by incubation on G418 resistant V8 solid medium plates at 25°C. Mycelia of suspected transformants were collected, and DNA was extracted for PCR sequencing verification. RNA was extracted from positive transformants for Q-PCR verification. PcSTT3B Gene knockout transformant strains (B8, B146, B175). Meanwhile, transformants transformed with the same vector plasmid and undergoing the same transformation steps without homologous substitution were used as control transformants (CK).
[0094] Example 4, Phytophthora capsici PcSTT3B Biological morphology analysis of gene knockout transformants
[0095] I. Detection of mycelial growth rate
[0096] The wild-type Phytophthora capsici strain BYA5 (WT), the control transformant CK, and the strain obtained in Example 3 were used. PcSTT3B Gene knockout transformant strains (B8, B146, B175) were inoculated in the center of sterile petri dishes (9 cm in diameter) containing 15 ml of V8 solid medium and cultured at 25 ℃ in the dark for 3 days. The colony diameter of each strain was measured using the cross-cross method, with each strain being replicated three times.
[0097] The results showed that, compared with the wild-type Phytophthora capsici strain BYA5 (WT) and the control transformant CK, PcSTT3B The mycelial growth rate of the gene knockout transformant strains (B8, B146, B175) was significantly reduced. PcSTT3B The experimental results indicate that the PcSTT3B protein is involved in regulating the mycelial growth of Phytophthora capsici.
[0098] II. Detection of sporangium and zoospore counts
[0099] Prepare 10% V8 solid medium and mix wild-type Phytophthora capsici strain BYA5 (WT), control transformant CK, and the strain obtained in Example 3. Figure 1 Gene knockout transformant strains (B8, B146, B175) were inoculated onto V8 solid medium (9 cm in diameter) and cultured in the dark at 25 ℃ for 3 days. Then, the culture dishes were placed face up in a 25 ℃ (RH=60%-80%) light incubator for another 5 days. 10 ml of sterile water was added, and the dishes were placed in a 4 ℃ refrigerator for 30 min. The dishes were then removed and placed at room temperature (25 ℃) for 40 min. The released zoospore suspension was collected, vortexed for 1 min, and 10 µl of the released zoospore suspension was added to a hemocytometer. The number of zoospores produced was observed and counted under a microscope. The number and morphology of sporangia on the culture medium were observed under a 20x objective lens. Each strain was replicated in triplicate.
[0100] The results showed that, compared with the wild-type Phytophthora capsici strain BYA5 (WT) and the control transformant CK, the strain obtained in Example 3... PcSTT3B The number of sporangia in the gene knockout transformant strains (B8, B146, B175) did not change significantly, but the number of released zoospores decreased significantly. However, the morphology of sporangia and zoospores was normal, indicating that the PcSTT3B protein mainly affected the number of zoospores of Phytophthora capsici (Table 4).
[0101] III. Morphological Detection and Germination Rate Statistics of Resting Species
[0102] The above method was used to obtain the wild-type Phytophthora capsici strain BYA5 (WT), the control transformant CK, and the strain obtained in Example 3. PcSTT3B Gene knockout transformant strains (B8, B146, B175) were used. The zoospore suspensions of each strain were vortexed for 1 min to obtain rest spore suspensions. These suspensions were then incubated in the dark at 25 ℃ for 4 h. The morphology of the rest spores in each treatment was observed under an optical microscope, and the number of germinating rest spores per 100 rest spores was randomly determined. Three replicates were set up for each strain.
[0103] The results showed that, compared with the wild-type Phytophthora capsici strain BYA5 (WT) and the control transformant CK, the strain obtained in Example 3... PcSTT3B There was no significant difference in the germination rate of dormant spores among the gene knockout transformant strains (B8, B146, B175) (Table 4).
[0104] Statistical analysis and observation of pathogenicity
[0105] Zoospores of various treated strains of *Phytophthora capsici* were collected using the method described above, and the zoospore concentration of each strain was adjusted to 10⁻⁶ using a microscope. 5 Species / ml. Inoculate healthy, equally sized, and uniformly aged pepper leaves with a spore suspension. Add 10 µl of zoospore suspension to each pepper leaf, and inoculate 6 leaves per treatment. Place the inoculated leaves on a glass rack in a 15 cm glass dish lined with three layers of absorbent paper and an appropriate amount of water. Incubate the inoculated pepper leaves in a 25℃ (RH=60%-80%) light incubator in the dark for 3 days. Measure the diameter of lesions using the cross-hatching method and photograph them. The entire experiment was repeated 3 times.
[0106] The results showed that, compared with the wild-type Phytophthora capsici strain BYA5 (WT) and the control transformant CK, the strain obtained in Example 3... PcSTT3B The pathogenicity of gene knockout transformant strains (B8, B146, B175) was significantly reduced. PcSTT3B ).
[0107] Table 4. Figure 2 Sporulation rate and germination rate of gene knockout transformants
[0108]
[0109] Note: a BYA5 represents the parental strain; CK represents the control transformant; B8, B146, and B175 represent three strains. PcSTT3B PcSTT3B Homozygous knockout transformants;
[0110] b The values in the table represent the mean ± standard deviation. In the DPS software, the Turkey method in univariate ANOVA analysis is used to calculate the differences in biological traits between wild-type strains and different transformants. The same letter in the same column indicates no significant difference. P <0.01).
Claims
1. Use of a sequence as shown in SEQ ID No. 1 for knocking out a gene in Phytophthora capsici PcSTT3B characterized in that The application is any one or several of the following 1)-3): 1) application in reducing the number of zoospores of P. capsici; 2) application in reducing the mycelial growth rate of P. capsici; 3) application in reducing the pathogenicity of P. capsici to host.
2. A method for reducing the activity of *Phytophthora capsici*, comprising the following steps: targeting *Phytophthora capsici* with a sequence as shown in SEQ ID No.
1. PcSTT3B Gene knockout was performed; the gene knockout method was based on CRISPR / Cas9 gene knockout; the sgRNA sequence targeting the PcSTT3B gene was 5'-GTAGGCACTACAGTGTATCC3'; among which, The activity of reducing P. capsici is reducing the pathogenicity of P. capsici to host, and / or reducing the mycelial growth rate of P. capsici, and / or reducing the number of zoospores.