Laccase from the strain of Versicolor versicolor

By developing a high-activity polypeptide enzyme preparation derived from the Versicolor versicolor strain, the problem of insufficient polycyclic aromatic hydrocarbon removal rate of existing enzymatic remediation technology has been solved, efficient soil, sewage and sludge bioremediation has been achieved, and the application of enzyme preparations in site soil remediation has been expanded.

CN115927223BActive Publication Date: 2025-09-26BEIJING UNIV OF CIVIL ENG & ARCHITECTURE
View PDF 12 Cites 0 Cited by

Patent Information

Application Number
CN202310036579.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-10
Publication Date
2025-09-26
Estimated Expiration
2043-01-10

AI Technical Summary

Technical Problem

Existing enzymatic remediation technology has insufficient removal rate in degrading polycyclic aromatic hydrocarbons, is rarely used in site soil bioremediation, has high cost, and has a narrow target substrate range.

Method used

A polypeptide derived from the versicolor versicolor strain has been developed, which has high-efficiency laccase activity and can efficiently degrade polycyclic aromatic hydrocarbons. The polypeptide is expressed in host cells through a gene expression system to form an enzyme preparation with high activity and high degradation ability.

Benefits of technology

It achieves efficient removal of polycyclic aromatic hydrocarbons, improves the removal rate of enzymatic remediation, is suitable for bioremediation of soil, sewage and sludge, and expands the application scope of enzyme preparations in site soil remediation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004048927070000071
    Figure BDA0004048927070000071
  • Figure BDA0004048927070000081
    Figure BDA0004048927070000081
  • Figure BDA0004048927070000091
    Figure BDA0004048927070000091
Patent Text Reader

Abstract

Provided is a laccase derived from a strain of Versicolor versicolor. The present invention relates to a polypeptide comprising the mature polypeptide of the amino acid sequence of SEQ ID NO: 2. Compared to existing laccases, the polypeptide of the present invention exhibits a higher benzo[a]pyrene removal effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of enzymes, and in particular to a laccase derived from a strain of Trametes versicolor. Background Art

[0002] Methods for remediating oil-contaminated land include physical remediation, chemical remediation, and bioremediation. Bioremediation has been a rapidly developing technology in recent years, with a rapid increase in related research reports since 2000.

[0003] Bioremediation uses the metabolic activities of organisms (including plants, animals, and microorganisms) to absorb, transform, and degrade organic pollutants in the soil. Microorganisms are considered to be the main route for removing organic pollutants in the natural environment. Further studies have found that oxidoreductases in microorganisms (including bacteria and fungi), such as laccase, lignin peroxidase, manganese peroxidase, cytochrome P450 monooxygenase, etc., have the potential to degrade organic pollutants such as polycyclic aromatic hydrocarbons. Compared with remediation based on biological metabolic activities, enzymatic remediation has better tolerance to pH / temperature / toxic substances. Of course, it also has disadvantages such as high application cost and narrow target substrate range.

[0004] At present, research in this field is basically in the laboratory development and verification stage, mainly focusing on the screening of new enzymes related to the degradation of polycyclic aromatic hydrocarbons (especially laccase), the development of enzyme efficiency-enhancing and cost-reducing technologies (enzyme immobilization to improve long-term effectiveness, using municipal sludge to produce laccase, screening mediators to improve the application effect of enzymes, etc.) and the study of related mechanisms. There is little research on enzymes in the field of halogenated hydrocarbon pollutant removal.

[0005] Domestic universities and research institutes have conducted extensive research in this field. For example, Lin, XG cloned a laccase molecule from Bacillus subtilis with a higher redox potential and lower demand for exogenous copper ions (Zeng, J., et al., Oxidation of polycyclic aromatic hydrocarbons using Bacillus subtilis CotA with high laccase activity and copper independence. CHEMOPHERE, 2016.148: p.1-7); Luo, YM confirmed that fungal laccase can rapidly convert certain polycyclic aromatic hydrocarbons, showing potential for detoxification and soil remediation (Wu, Y., et al., Potential role of polycyclic aromatic hydrocarbons (PAHs) oxidation by fungal laccase in the remediation of an aged contaminated soil. SOIL BIOLOGY&BIOCHEMISTRY,2008.40(3):p.789-796); In addition, domestic and foreign research teams have also conducted in-depth research on the immobilization of microorganisms or enzymes, such as the use of electrospun fiber membranes carrying laccase for the removal of polycyclic aromatic hydrocarbons from wastewater (Dai, Y., et al., Laccase-carrying electrospun fibrous membrane for the removal of polycyclic aromatic hydrocarbons from contaminated water. SEPARATION AND PURIFICATION TECHNOLOGY,2013.104:p.1-8), and the immobilization of manganese peroxidase (Acevedo, F., et al., Degradation of polycyclic aromatic hydrocarbons by free and nanoclay-immobilized manganese peroxidase from Anthracophyllum discolor. CHEMOSPHERE,2010.80(3):p.271-278).Various microorganisms and their composite preparations, such as yeast and bacteria co-culture, bacteria and white rot fungi co-culture, etc., have also been widely studied in the remediation of soil contaminated by organic pollutants and the corresponding enzymatic studies (Liu, B., et al., Bacteria-white-rot fungi joint remediation of petroleum-contaminated soil based on sustained-release of laccase. RSCADVANCES, 2017. 7(62): p. 39075-39081; Wang, C., et al., Enzyme activities during degradation of polycyclic aromatic hydrocarbons by white rot fungus Phanerochaete chrysosporium in soils. CHEMOSPHERE, 2009. 77(6): p. 733-738).

[0006] There are already some commercial enzyme preparations for sewage or sludge treatment. For example, Pharem of Sweden uses compound enzymes to efficiently treat pharmaceutical wastewater. Novozymes has been deeply involved in the field of wastewater and sludge treatment for many years and has successfully developed and launched a series of enzyme preparation products, such as catalase for wastewater treatment in the electronics industry. Used for municipal sludge dewatering and upgrading, etc. However, enzyme preparations are still rarely used in site soil bioremediation and need further research.

[0007] The present application obtains a gene sequence for degrading organic pollutants, and selects a fungal expression system to express the gene, thereby obtaining a laccase with high activity and high degradation ability for polycyclic aromatic hydrocarbons. Summary of the Invention

[0008] The present invention is based in part on the discovery of a polypeptide with high PAH degradation capabilities. The inventors found that existing laccases, while having a PAH removal rate of less than 40%, demonstrated that the polypeptide of the present invention achieves a higher PAH removal rate (e.g., benzo[a]pyrene) than existing laccases from Coriolus versicolor.

[0009] In one aspect, the invention provides a polypeptide comprising:

[0010] (1) the mature polypeptide of the amino acid sequence of SEQ ID NO: 2;

[0011] (2) a variant amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, or at least 100% sequence identity to the mature polypeptide in the amino acid sequence of SEQ ID NO: 2; or

[0012] (3) a variant amino acid sequence of the mature polypeptide in the amino acid sequence of SEQ ID NO: 2, which comprises a substitution, deletion and / or insertion at one or more (or several, e.g., 1, 2, 3, 4, 5, 6, 7, 8 or 9) positions of the mature polypeptide;

[0013] The polypeptide has laccase activity or the polypeptide is a laccase.

[0014] In one embodiment, the polypeptide comprises the amino acid sequence of SEQ ID NO:2, the mature polypeptide of the amino acid sequence of SEQ ID NO:2, or the amino acid sequence of SEQ ID NO:4.

[0015] In one embodiment, it consists of the amino acid sequence of SEQ ID NO: 2, the mature polypeptide of the amino acid sequence of SEQ ID NO: 2, or the amino acid sequence of SEQ ID NO: 4.

[0016] In one embodiment, the mature polypeptide is amino acids 24 to 527 of SEQ ID NO:2.

[0017] In one embodiment, the polypeptide is isolated from Versicolor versicolor and is capable of degrading polycyclic aromatic hydrocarbons.

[0018] In one embodiment, the ability of the polypeptide to degrade polycyclic aromatic hydrocarbons is greater than 50%, e.g., 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200% of the ability of the mature polypeptide to degrade polycyclic aromatic hydrocarbons.

[0019] In one embodiment, the polycyclic aromatic hydrocarbons include non-condensed-ring polycyclic aromatic hydrocarbons and / or condensed-ring polycyclic aromatic hydrocarbons.

[0020] In one embodiment, the polycyclic aromatic hydrocarbons include benzo(a)pyrene, naphthalene, acenaphthylene, acenaphthene, fluorene, phenanthrene, anthracene, fluoranthene, pyrene, benzo(a)anthracene, Benzo(b)fluoranthene, benzo(k)fluoranthene, indenyl(1,2,3-cd)pyrene, dibenzo(a,n)anthracene and / or benzo(g,h,i)perylene.

[0021] In another aspect, the present invention provides a polynucleotide encoding a polypeptide according to the present invention. In one embodiment, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3.

[0022] In another aspect, the present invention provides a nucleic acid construct comprising a polynucleotide as described herein, wherein the polynucleotide is operably linked to one or more control sequences that direct the production of the polypeptide in a recombinant host cell.

[0023] In another aspect, the present invention provides an expression vector comprising a polynucleotide described herein or a nucleic acid construct described herein.

[0024] In another aspect, the present invention provides a host cell comprising a polynucleotide described herein, a nucleic acid construct described herein, or an expression vector described herein.

[0025] In another aspect, the present invention provides a method for producing a polypeptide, the method comprising:

[0026] a) cultivating a host cell as described herein under conditions suitable for expression of the polypeptide; and

[0027] b) recovering the polypeptide.

[0028] In another aspect, the present invention provides a composition comprising a polypeptide as described herein, a polynucleotide as described herein, a nucleic acid construct as described herein, an expression vector as described herein, and / or a host cell as described herein. In one embodiment, the composition may comprise a lignin peroxidase, a manganese peroxidase, and / or a cytochrome P450 monooxygenase.

[0029] In another aspect, the present invention provides use of the polypeptides described herein, the polynucleotides described herein, the nucleic acid constructs described herein, the expression vectors described herein and / or the host cells described herein and / or the compositions described herein for degrading polycyclic aromatic hydrocarbons.

[0030] In one embodiment, the polycyclic aromatic hydrocarbons are in soil or wastewater.

[0031] In one embodiment, the polycyclic aromatic hydrocarbons include non-condensed-ring polycyclic aromatic hydrocarbons and / or condensed-ring polycyclic aromatic hydrocarbons.

[0032] In one embodiment, the polycyclic aromatic hydrocarbons include benzo(a)pyrene, naphthalene, acenaphthylene, acenaphthene, fluorene, phenanthrene, anthracene, fluoranthene, pyrene, benzo(a)anthracene, Benzo(b)fluoranthene, benzo(k)fluoranthene, indenyl(1,2,3-cd)pyrene, dibenzo(a,n)anthracene and / or benzo(g,h,i)perylene.

[0033] In another aspect, the present invention provides a method for remediating soil, sludge, or sewage containing polycyclic aromatic hydrocarbons, which comprises applying the polypeptide described herein, the polynucleotide described herein, the nucleic acid construct described herein, the expression vector described herein and / or the host cell described herein and / or the composition described herein to the soil or sewage.

[0034] In one embodiment, the method further comprises the steps of bioremediation, physical remediation and / or chemical remediation.

[0035] In one embodiment, the polycyclic aromatic hydrocarbons include non-condensed-ring polycyclic aromatic hydrocarbons and / or condensed-ring polycyclic aromatic hydrocarbons.

[0036] In one embodiment, the polycyclic aromatic hydrocarbons include benzo(a)pyrene, naphthalene, acenaphthylene, acenaphthene, fluorene, phenanthrene, anthracene, fluoranthene, pyrene, benzo(a)anthracene, Benzo(b)fluoranthene, benzo(k)fluoranthene, indenyl(1,2,3-cd)pyrene, dibenzo(a,n)anthracene and / or benzo(g,h,i)perylene.

[0037] The beneficial effects of the present invention include that the polypeptide of the present invention removes polycyclic aromatic hydrocarbons (such as benzo[a]pyrene) with a higher removal rate, which is beneficial to the bioremediation method in human living environments such as soil, sewage or sludge. DETAILED DESCRIPTION

[0038] definition

[0039] The term "laccase" refers to an enzyme in class EC 1.10.3.2 as defined in Enzyme Nomenclature.

[0040] The term "polycyclic aromatic hydrocarbons" refers to aromatic hydrocarbons containing two or more benzene rings. Polycyclic aromatic hydrocarbons can include non-condensed ring polycyclic aromatic hydrocarbons, including biphenyl and biphenyl and polyphenylated aliphatic hydrocarbons, as well as condensed ring polycyclic aromatic hydrocarbons. In this article, polycyclic aromatic hydrocarbons include benzo(a)pyrene, naphthalene, acenaphthylene, acenaphthene, fluorene, phenanthrene, anthracene, fluoranthene, pyrene, benzo(a)anthracene, Benzo(b)fluoranthene, benzo(k)fluoranthene, indenyl(1,2,3-cd)pyrene, dibenzo(a,n)anthracene and / or benzo(g,h,i)perylene.

[0041] The term "coding sequence" means a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of a coding sequence are generally determined by an open reading frame, which begins with a start codon (e.g., ATG, GTG, or TTG) and ends with a stop codon (e.g., TAA, TAG, or TGA). The coding sequence can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0042] The term "control sequence" means the nucleic acid sequence necessary for expressing the polynucleotide encoding the mature polypeptide of the present invention. Each control sequence can be natural (i.e., from the same gene) or exogenous (i.e., from different genes) for the polynucleotide encoding the polypeptide, or natural or exogenous relative to each other. Such control sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. At a minimum, these control sequences include promoters, and transcription and translation termination signals. For the purpose of introducing specific restriction sites that are conducive to connecting the control sequences to the coding region of the polynucleotide encoding the polypeptide, these control sequences can be provided with multiple linkers.

[0043] The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0044] The term "expression vector" means a linear or circular DNA molecule that contains a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.

[0045] The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

[0046] The term "isolated" means a substance in a form or environment that does not exist in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance, including but not limited to any enzyme, variant, nucleic acid, protein, peptide or cofactor, which is at least partially removed from one or more or all naturally occurring components associated with its properties; (3) any substance that has been artificially modified relative to the substance found in nature; or (4) any substance that has been modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance). The isolated substance can be present in a fermentation broth sample; for example, a host cell can be genetically modified to express a polypeptide of the present invention. The fermentation broth from the host cell will contain the isolated polypeptide. It will be apparent to those skilled in the art that the polypeptides disclosed herein are preferably in isolated form.

[0047] The term "mature polypeptide" means a polypeptide in its mature form after N-terminal processing (eg, removal of the signal peptide).

[0048] It is known in the art that a host cell can produce a mixture of two or more different mature polypeptides (i.e., having different C-terminal and / or N-terminal amino acids) expressed from the same polynucleotide. It is also known in the art that different host cells process polypeptides differently, and thus a host cell expressing a polynucleotide can produce different mature polypeptides (e.g., having different C-terminal and / or N-terminal amino acids) when compared to another host cell expressing the same polynucleotide.

[0049] The term "mature polypeptide coding sequence" means a polynucleotide encoding a mature polypeptide having laccase activity.

[0050] The term "nucleic acid construct" means a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene, or modified in a manner not originally found in nature to contain a nucleic acid segment, or is synthetic, and contains one or more control sequences.

[0051] The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.

[0052] Parent or parent laccase: The term "parent" or "parent laccase" means the laccase that is altered to produce the laccase variant of the present invention. The parent laccase can be a naturally occurring (wild-type) polypeptide or a variant or fragment thereof.

[0053] The degree of association between two amino acid sequences or between two nucleotide sequences is described by parameter " sequence identity ".For purposes of the present invention, use as in the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, people such as Rice, 2000, Trends Genet. [genetics trend] 16:276-277) (preferred 5.0.0 version or updated version) Ni Deer program implemented Ni Deerman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol. [J.Molecular Biology] 48:443-453) determine the sequence identity between two amino acid sequences.The parameter used is gap opening penalty 10, gap extension penalty 0.5 and EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.The output (using non-simplified option to obtain) of Ni Deer, who is labeled as " longest identity ", is used as identity percentage and is calculated as follows:

[0054] (number of identical residues × 100) / (length of alignment - total number of gaps in the alignment)

[0055] For purposes of the present invention, the sequence identity between two deoxynucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented by the Needleman program of the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, supra) (preferred 5.0.0 version or later). The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needleman, labeled "longest identity," (obtained using the non-simplified option), which is labeled "longest identity," is used as percent identity and is calculated as follows:

[0056] (number of identical deoxyribonucleotides x 100) / (length of alignment - total number of gaps in the alignment)

[0057] The term "variant" means a polypeptide having laccase activity that includes an alteration (i.e., a substitution, insertion, and / or deletion) at one or more positions. A substitution means replacing the amino acid occupying a position with a different amino acid; a deletion means removing the amino acid occupying a position; and an insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.

[0058] peptides

[0059] The present invention provides polypeptides having laccase activity or being laccases. The polypeptides described herein may have the ability to degrade polycyclic aromatic hydrocarbons. The ability of the polypeptides described herein to degrade polycyclic aromatic hydrocarbons may be greater than 50%, e.g., 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, or 200%, of the ability of the mature polypeptide of SEQ ID NO: 2 to degrade polycyclic aromatic hydrocarbons.

[0060] SEQ ID NO:2

[0061]

[0062] The polypeptides described herein may comprise the mature polypeptide of the amino acid sequence of SEQ ID NO: 2. The polypeptides described herein may also comprise variant sequences of the mature polypeptide. For example, the variant sequence may comprise a variant amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.3%, or at least 99.5% sequence identity to the mature polypeptide of the amino acid sequence of SEQ ID NO: 2 or the amino acid sequence of SEQ ID NO: 2; or a variant amino acid sequence of the mature polypeptide of the amino acid sequence of SEQ ID NO: 2 or the amino acid sequence of SEQ ID NO: 2, comprising changes, such as substitutions, deletions, and / or insertions, at one or more positions of the mature polypeptide. These variant sequences have laccase activity, or the ability to degrade polycyclic aromatic hydrocarbons. 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105

[0063] The polypeptide may comprise the amino acid sequence of SEQ ID NO: 2, the mature polypeptide of the amino acid sequence of SEQ ID NO: 2, or the amino acid sequence of SEQ ID NO: 4. The polypeptide may consist of the amino acid sequence of SEQ ID NO: 2, the mature polypeptide of the amino acid sequence of SEQ ID NO: 2, or the amino acid sequence of SEQ ID NO: 4. Herein, the mature polypeptide is amino acids 24 to 527 of SEQ ID NO: 2.

[0064] The polypeptides described herein may be isolated from Versicolor versicolor.

[0065] The polypeptides described herein may be isolated, ie, the polypeptides are in an "isolated" form or in an "isolated" environment as defined above.

[0066] polynucleotides

[0067] Also provided herein are polynucleotides encoding the polypeptides described herein, preferably the polynucleotides comprise the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3.

[0068] SEQ ID NO: 1:

[0069]

[0070]

[0071] Nucleic acid constructs

[0072] The present invention also relates to nucleic acid constructs comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

[0073] Polynucleotides can be manipulated in a variety of ways to provide expression of a polypeptide. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide prior to its insertion into the vector. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

[0074] The control sequence may be a promoter, i.e., a polynucleotide that is recognized by the host cell for expression of a polynucleotide encoding a polypeptide of the present invention. A promoter comprises transcriptional control sequences that mediate expression of a polypeptide. The promoter may be any polynucleotide that exhibits transcriptional activity in the host cell, including variants, truncated forms, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides that are homologous or heterologous to the host cell.

[0075] Examples of suitable promoters for directing transcription of the nucleic acid constructs of the present invention in bacterial host cells are those obtained from the Bacillus amyloliquefaciens alpha-amylase gene (amyQ), the Bacillus licheniformis alpha-amylase gene (amyL), the Bacillus licheniformis penicillinase gene (penP), the Bacillus stearothermophilus maltoamylase gene (amyM), the Bacillus subtilis levansucrase gene (sacB), the Bacillus subtilis xylA and xylB genes, the Bacillus thuringiensis cryIIIA gene (Agaisse and Lereclus, 1994, Molecular [Microbiology] 13:97-107), the E. coli lac operon, the E. coli trc promoter (Egon et al., 1988, Gene 69:301-315), the Streptomyces coelicolor agarase gene (dagA), and the prokaryotic β-lactamase gene (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA 75:3727-3731), as well as the tac promoter (DeBoer et al., 1983, Proc. Natl. Acad. Sci. USA 80:21-25). Additional promoters are described in "Useful proteins from recombinant bacteria," Gilbert et al., 1980, Scientific American 242:74-94; and Sambrook et al., 1989, supra. Examples of tandem promoters are disclosed in WO 99 / 43835.

[0076] Examples of suitable promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid-stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96 / 00787), Fusarium venenatum amyloglucosidase (WO 00 / 56900), Fusarium venenatum Daria (WO 00 / 56900), Fusarium venenatum Quinn (WO 00 / 56900), Rhizomucor miehei alpha-amylase (WO 00 / 56900), Aspergillus oryzae ... miehei) lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei β-xylosidase, and Trichoderma reesei translation elongation factor , and the NA2-tpi promoter (a modified promoter from the Aspergillus neutral α-amylase gene in which the untranslated leader sequence has been replaced with an untranslated leader sequence from the Aspergillus triose phosphate isomerase gene; non-limiting examples include a modified promoter from the Aspergillus niger neutral α-amylase gene in which the untranslated leader sequence has been replaced with an untranslated leader sequence from the Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and variants, truncations, and hybrid promoters thereof. Other promoters are described in U.S. Patent No. 6,011,147.

[0077] In yeast hosts, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2 / GAP), Saccharomyces cerevisiae triosephosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8:423-488.

[0078] The control sequence may also be a transcription terminator that is recognized by the host cell to terminate transcription. The terminator is operably linked to the 3' end of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell can be used in the present invention.

[0079] Preferred terminators for bacterial host cells are obtained from the genes for Bacillus clausii alkaline protease (aprH), Bacillus licheniformis alpha-amylase (amyL), and Escherichia coli ribosomal RNA (rrnB).

[0080] Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor.

[0081] Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al. (1992, supra).

[0082] The control sequence may also be an mRNA stabilizer region downstream of the promoter and upstream of the coding sequence of a gene, which increases the expression of the gene.

[0083] Examples of suitable mRNA stabilizer regions are obtained from the Bacillus thuringiensis cryIIIA gene (WO 94 / 25612) and the Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of Bacteriology 177: 3465-3471).

[0084] The control sequence can also be a leader sequence, which is a non-translated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5' end of the polynucleotide encoding the polypeptide. Any leader sequence that is functional in the host cell can be used.

[0085] Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

[0086] Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP).

[0087] The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the polynucleotide and, when transcribed, recognized by the host cell as a signal to add polyadenylic acid residues to transcribed mRNA. Any polyadenylation sequence functional in the host cell may be used.

[0088] Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

[0089] Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.

[0090] The control sequence can also be a signal peptide coding region that encodes a signal peptide connected to the N-terminus of the polypeptide and directs the polypeptide to enter the secretory pathway of the cell. The 5'-end of the coding sequence of the polynucleotide itself can contain a signal peptide coding sequence that is naturally connected to the coding sequence segment of the coded polypeptide in the translation reading frame. Alternatively, the 5'-end of the coding sequence can contain a signal peptide coding sequence that is exogenous to the coding sequence. In the case where the coding sequence does not naturally contain a signal peptide coding sequence, an exogenous signal peptide coding sequence may be required. Alternatively, an exogenous signal peptide coding sequence can simply replace the natural signal peptide coding sequence to enhance the secretion of the polypeptide. However, any signal peptide coding sequence that directs the expressed polypeptide to enter the secretory pathway of the host cell can be used.

[0091] Effective signal peptide coding sequences for bacterial host cells are those obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis β-lactamase, Bacillus stearothermophilus α-amylase, Bacillus stearothermophilus neutral protease (nprT, nprS, nprM), and Bacillus subtilis prs A. Additional signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.

[0092] Effective signal peptide coding sequences for filamentous fungal host cells are those obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.

[0093] Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al. (1992, supra).

[0094] The control sequence can also be a propeptide coding sequence encoding a propeptide at the N-terminal end of a polypeptide. The resulting polypeptide is referred to as a precursor enzyme or propolypeptide (or in some cases, as a zymogen). Propolypeptide is generally inactive and can be converted into an active polypeptide by catalytic cleavage or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence can be obtained from the following genes: subtilis alkaline protease (aprE), subtilis neutral protease (nprT), Myceliophthora thermophila laccase (WO 95 / 33836), Rhizomucor miehei aspartic protease, and Saccharomyces cerevisiae α-factor.

[0095] Where both a signal peptide sequence and a propeptide sequence are present, the propeptide sequence is located immediately N-terminus of the polypeptide and the signal peptide sequence is located immediately N-terminus of the propeptide sequence.

[0096] It may also be desirable to add regulatory sequences that regulate the expression of polypeptides associated with host cell growth. Examples of regulatory sequences are those that cause gene expression to be turned on or off in response to chemical or physical stimuli (including the presence of regulatory compounds). Regulatory sequences in prokaryotic systems include the lac, tac, and trp operon systems. In yeast, the ADH2 system or the GAL1 system can be used. In filamentous fungi, the Aspergillus niger glucoamylase promoter, the Aspergillus oryzae TAKA α-amylase promoter and the Aspergillus oryzae glucoamylase promoter, the Trichoderma reesei cellobiohydrolase I promoter and the Trichoderma reesei cellobiohydrolase II promoter can be used. Other examples of regulatory sequences are those that enable gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene amplified in the presence of methotrexate and the metallothionein gene amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide will be operably linked to the regulatory sequence.

[0097] expression vector

[0098] The present invention further relates to the recombinant expression vector that comprises polynucleotide of the present invention, promoter and transcription and translation termination signal.A plurality of Nucleotide and control sequence can be linked together to produce recombinant expression vector, and this recombinant expression vector can comprise one or more restriction sites conveniently so that the polynucleotide of encoding this polypeptide inserts or replaces at this type of site.Alternately, can express this polynucleotide by polynucleotide or the nucleic acid construct that comprises this polynucleotide being inserted in the suitable vector for expression.When producing expression vector, coding sequence is so positioned in carrier, makes coding sequence operably connected with the suitable control sequence for expression.

[0099] The recombinant expression vector can be any vector (e.g., a plasmid or virus) that can be readily subjected to recombinant DNA procedures and can cause expression of the polynucleotide. The choice of vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[0100] The carrier can be an autonomous replicating vector, i.e. a carrier existing as an extrachromosomal entity, which replicates independently of chromosomal replication, such as a plasmid, an extrachromosomal element, a minichromosome or an artificial chromosome. The carrier can contain any means for ensuring self-replication. Alternatively, the carrier can be a carrier that is integrated into the genome and replicates with one or more chromosomes into which it has been integrated when it is introduced into the host cell. Moreover, a single carrier or plasmid or two or more carriers or plasmids can be used that contain the total DNA to be introduced into the host cell genome together, or a transposon can be used.

[0101] The vector preferably contains one or more selectable markers that allow for easy selection of transformed, transfected, transduced, etc. cells. A selectable marker is a gene whose product confers biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, etc.

[0102] Examples of bacterial selectable markers are the dal genes of Bacillus licheniformis or Bacillus subtilis, or markers that confer antibiotic resistance, such as ampicillin, chloramphenicol, kanamycin, neomycin, spectinomycin, or tetracycline resistance. Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in filamentous fungal host cells include, but are not limited to, adeA (phosphoribosylamidoimidazole-succinylcarboxamide synthase), adeB (phosphoribosylamidoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), niaA (nitrite reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenosyltransferase), and trpC (anthranilate synthase), and equivalents thereof. Preferred for use in Aspergillus cells are the Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and the Streptomyces hygroscopicus bar gene. Preferred for use in Trichoderma cells are the adeA, adeB, amdS, hph and pyrG genes.

[0103] The selectable marker may be a dual selectable marker system as described in WO 2010 / 039889. In one aspect, the dual selectable marker is the hph-tk dual selectable marker system.

[0104] The vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.

[0105] For being integrated into the host cell genome, the vector can rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector for being integrated into the genome by homologous or non-homologous recombination. Alternatively, the vector can contain other polynucleotides at the precise position for guiding the integration of the chromosome in the host cell genome by homologous recombination. In order to improve the possibility of integration at the precise position, the integration element should contain a sufficient number of nucleic acids, for example 100 to 10,000 base pairs, 400 to 10,000 base pairs and 800 to 10,000 base pairs, and these nucleic acids have a high degree of sequence identity with the corresponding target sequence to enhance the probability of homologous recombination. The integration element can be any sequence homologous to the target sequence in the host cell genome. Moreover, the integration element can be a non-coding or coded polynucleotide. On the other hand, the vector can be integrated into the genome of the host cell by non-homologous recombination.

[0106] For autonomous replication, the vector may further comprise an origin of replication that enables autonomous replication of the vector in the host cell in question. The origin of replication may be any plasmid replicator that mediates autonomous replication and functions in the cell. The term "origin of replication" or "plasmid replicator" refers to a polynucleotide that enables a plasmid or vector to replicate in vivo.

[0107] Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli and pUB110, pE194, pTA1060, and pAMβ1 permitting replication in Bacillus.

[0108] Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.

[0109] Examples of useful origins of replication in filamentous fungal cells are AMA1 and ANS1 (Gems et al., 1991, Gene 98:61-67; Cullen et al., 1987, Nucleic Acids Res. 15:9163-9175; WO 00 / 24883). Isolation of the AMA1 gene and construction of a plasmid or vector containing the gene can be accomplished according to the methods disclosed in WO 00 / 24883.

[0110] More than one copy of a polynucleotide of the present invention can be inserted into a host cell to increase production of a polypeptide. Increased copy numbers of a polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide, wherein cells containing amplified copies of the selectable marker gene and thus additional copies of the polynucleotide can be selected by culturing the cells in the presence of an appropriate selective agent.

[0111] The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to those skilled in the art (see, for example, Sambrook et al., 1989).

[0112] host cells

[0113] The present invention also relates to recombinant host cells comprising polynucleotides of the present invention operably linked to one or more control sequences that direct the production of the polypeptides of the present invention. Constructs or vectors comprising the polynucleotides are introduced into host cells so that the constructs or vectors are maintained as chromosomal integrants or as autonomously replicating extrachromosomal vectors, as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of host cell will depend largely on the gene encoding the polypeptide and its source.

[0114] The host cell can be any cell useful in the recombinant production of the polypeptides of the present invention, eg, a prokaryotic or eukaryotic cell.

[0115] Prokaryotic host cells can be any Gram-positive or Gram-negative bacteria. Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces. Gram-negative bacteria include, but are not limited to, Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Silene Bacillus, Neisseria, Pseudomonas, Salmonella, and Ureaplasma.

[0116] The bacterial host cell can be any Bacillus cell, including, but not limited to, Bacillus alkalophilus, Bacillus altitudinis, Bacillus amyloliquefaciens, B. amyloliquefaciens subsp. plantarum, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus methylotrophicus, Bacillus pumilus, Bacillus sabdariffa, Bacillus truncatus, Bacillus thunbergii ... safensis), Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis cells.

[0117] The bacterial host cell may also be any Streptococcus cell, including but not limited to Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, and Streptococcus equisubsp. Zooepidemicus cells.

[0118] The bacterial host cell can also be any Streptomyces cell, including, but not limited to, Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.

[0119] Introduction of DNA into Bacillus cells can be achieved by protoplast transformation (see, e.g., Chang and Cohen, 1979, Mol. Gen. Genet. 168: 111-115), transformation of competent cells (see, e.g., Young and Spizizen, 1961, J. Bacteriol. 81: 823-829; or Dubnau and Davidoff-Abelson, 1971, J. Mol. Biol. 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, J. Bacteriol. 169: 5271-5278). Introduction of DNA into E. coli cells can be achieved by protoplast transformation (see, e.g., Hanahan, 1983, J. Mol. Biol. 166:557-580) or electroporation (see, e.g., Dower et al., 1988, Nucleic Acids Res. 16:6127-6145). Introduction of DNA into Streptomyces cells can be achieved by protoplast transformation, electroporation (see, e.g., Gong et al., 2004, Folia Microbiol. (Praha) 49:399-405), conjugation (see, e.g., Mazodier et al., 1989, J. Bacteriol. 171:3583-3585), or transduction (see, e.g., Burke et al., 2001, Proc. Natl. Acad. Sci. USA 98:6289-6294). Introduction of DNA into Pseudomonas cells can be achieved by electroporation (see, eg, Choi et al., 2006, J. Microbiol. Methods 64:391-397) or conjugation (see, eg, Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71:51-57).Introduction of DNA into Streptococcus cells can be achieved by natural competence (see, e.g., Perry and Kuramitsu, 1981, Infect. Immun. 32: 1295-1297), protoplast transformation (see, e.g., Catt and Jollick, 1991, Microbios 68: 189-207), electroporation (see, e.g., Buckley et al., 1999, Appl. Environ. Microbiol. 65: 3800-3804), or conjugation (see, e.g., Clewell, 1981, Microbiol. Rev. 45: 409-436). However, any method known in the art for introducing DNA into host cells can be used.

[0120] Host cells can also be eukaryotic, such as mammalian, insect, plant or fungal cells. Plant cells herein do not include plant cells that can be regenerated into plants. Animal cells also do not include cells that can produce animal bodies.

[0121] The host cell may be a fungal cell. "Fungi," as used herein, include Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota, as well as Oomycota and all mitospore fungi (as defined by Hawksworth et al. in Ainsworth and Bisby's Dictionary of The Fungi, 8th ed., 1995, CAB International, University Press, Cambridge, UK).

[0122] The fungal host cell can be a yeast cell. As used herein, "yeast" includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Because the classification of yeast may change in the future, for the purposes of the present invention, yeast should be defined as described in Biology and Activities of Yeast (Skinner, Passmore and Davenport, eds., Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[0123] The yeast host cell can be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell, such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell.

[0124] The fungal host cell can be a filamentous fungal cell. "Filamentous fungi" includes all filamentous forms of the subphyla Eumycota and Oomycota (as defined by Hawksworth et al., 1995 (supra)). Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan and other complex polysaccharides. Vegetative growth is carried out by hyphal extension, and carbon catabolism is obligately aerobic. In contrast, vegetative growth of yeast (such as Saccharomyces cerevisiae) is carried out by budding of a unicellular thallus, and carbon catabolism can be fermentative.

[0125] The filamentous fungal host cell can be a genus of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, or the like. or Trichoderma cells.

[0126] For example, the filamentous fungal host cell can be Aspergillus awamori, Aspergillus foetida, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium coprosporium, merdarium), Chrysosporium pannicola, Chrysosporium queenslandicum, tropical chrysosporium, Chrysosporium zonatum, Coprinus cinereus, Coriolushirsutus, rod-shaped fusarium, graminearum fusarium, Kuwei fusarium, broadsword fusarium, gramineous fusarium, graminearum fusarium, heterosporous fusarium, albizia fusarium, oxysporous fusarium, multi-branched fusarium, pink fusarium, elder fusarium, color fusarium, pseudo-branched fusarium, sulfur-colored fusarium, round fusarium, pseudo-sporic fusarium, embellished fusarium, Humicola insolens, sparse cotton-like fusarium, rice black mold, thermophilic myceliophthora, crassa neurospora, purple-producing penicillium, Phanerochaete chrysosporium), Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cells.

[0127] Fungal cells can be transformed by processes involving protoplast formation, protoplast transformation, and cell wall regeneration in a manner known per se. Suitable procedures for transforming Aspergillus and Trichoderma host cells are described in EP 238023 and Yelton et al., 1984, Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States] 81: 1470-1474 and Christensen et al., 1988, Bio / Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156 and WO 96 / 00787. Yeast can be transformed using the procedures described by Becker and Guarente, in Abelson, JN and Simon, MI, eds., Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, vol. 194, pp. 182-187, Academic Press, Inc., New York; Ito et al., 1983, J. Bacteriol. 153:163; and Hinnen et al., 1978, Proc. Natl. Acad. Sci. USA 75:1920.

[0128] Production method

[0129] The present invention also relates to methods of producing a polypeptide of the present invention, comprising (a) cultivating a cell under conditions conducive for production of the polypeptide, the cell producing the polypeptide in its wild-type form; and optionally (b) recovering the polypeptide.

[0130] The present invention also relates to recombinant methods for producing a polypeptide of the present invention, comprising (a) cultivating a recombinant host cell of the present invention capable of expressing the polypeptide under conditions conducive for production of the polypeptide; and optionally (b) recovering the polypeptide.

[0131] One embodiment of the present invention relates to a method for producing a polypeptide, wherein the polypeptide is a mature polypeptide described herein (the mature polypeptide of SEQ ID NO: 2), the method comprising (a) cultivating a recombinant host cell capable of expressing the polypeptide under conditions conducive for production of the polypeptide; and optionally (b) recovering the polypeptide.

[0132] Host cell is cultivated in the nutrient medium of suitable method known in the art production polypeptide.For example, can be by shake flask culture or in laboratory or industrial fermenter small-scale or large-scale fermentation (comprising continuous, batch, fed-batch or solid-state fermentation) culture cell, this is cultivated in suitable medium and under the condition that polypeptide expression and / or separation are carried out.Use program as known in the art, cultivate and occur in the suitable nutrient medium that comprises carbon and nitrogen source and inorganic salt.Suitable substratum can obtain from commercial supplier or can be prepared according to disclosed composition (for example, in the catalogue of American Type Culture Collection).If polypeptide is secreted in this nutrient medium, then can directly reclaim this polypeptide from this substratum.If polypeptide is not secreted, then it can be reclaimed from cell lysate.

[0133] The polypeptide can be detected using methods known in the art that are specific for the polypeptide. These detection methods include, but are not limited to, the use of specific antibodies, the formation of an enzyme product, or the disappearance of an enzyme substrate. For example, an enzyme assay can be used to determine the activity of the polypeptide.

[0134] The polypeptide can be recovered using methods known in the art. For example, the polypeptide can be recovered from the nutrient medium by conventional procedures, including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation. In one aspect, the fermentation broth containing the polypeptide is recovered.

[0135] Polypeptides can be purified by a variety of procedures known in the art, including, but not limited to, chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic chromatography, focusing chromatography, and size exclusion chromatography), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubilization (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, eds., VCH Publishers, New York, 1989), to obtain substantially pure polypeptides.

[0136] In alternative aspects, the polypeptide is not recovered, but rather a host cell of the invention expressing the polypeptide is used as a source of the polypeptide.Another option is to use the supernatant from which the polypeptide is expressed as a source of the polypeptide.

[0137] Composition

[0138] The present invention also relates to compositions comprising the polypeptides of the present invention, in particular compositions for bioremediation (eg for soil or sewage).

[0139] These compositions may comprise a polypeptide of the invention as the major enzyme component, e.g., a monocomponent composition. Alternatively, these compositions may comprise multiple enzyme activities, such as one or more enzymes selected from the group consisting of lignin peroxidase, manganese peroxidase, and / or cytochrome P450 monooxygenase.

[0140] Uses and methods

[0141] The present invention provides a composition for use in degrading polycyclic aromatic hydrocarbons. The polycyclic aromatic hydrocarbons can be polycyclic aromatic hydrocarbons in soil, sewage or sludge. The polycyclic aromatic hydrocarbons include non-condensed ring polycyclic aromatic hydrocarbons and / or condensed ring polycyclic aromatic hydrocarbons. For example, polycyclic aromatic hydrocarbons include but are not limited to benzo(a)pyrene, naphthalene, acenaphthylene, acenaphthene, fluorene, phenanthrene, anthracene, fluoranthene, pyrene, benzo(a)anthracene, Benzo(b)fluoranthene, benzo(k)fluoranthene, indenyl(1,2,3-cd)pyrene, dibenzo(a,n)anthracene and / or benzo(g,h,i)perylene.

[0142] Provided herein is a method for repairing soil or sewage or sludge containing polycyclic aromatic hydrocarbons, comprising applying the polypeptides described herein, the polynucleotides described herein, the nucleic acid constructs described herein, the expression vectors described herein, the host cells described herein and / or the compositions described herein to the soil or sewage or sludge. The method may also include the steps of bioremediation, physical remediation and / or chemical remediation. The method may also include other bioremediation steps, such as bioremediation steps using plants. Polycyclic aromatic hydrocarbons include non-condensed ring polycyclic aromatic hydrocarbons and / or condensed ring polycyclic aromatic hydrocarbons. For example, polycyclic aromatic hydrocarbons include but are not limited to benzo(a)pyrene, naphthalene, acenaphthylene, acenaphthene, fluorene, phenanthrene, anthracene, fluoranthene, pyrene, benzo(a)anthracene, Benzo(b)fluoranthene, benzo(k)fluoranthene, indenyl(1,2,3-cd)pyrene, dibenzo(a,n)anthracene and / or benzo(g,h,i)perylene.

[0143] Example

[0144] The present invention is further described by the following examples, which should not be construed as limiting the scope of the invention.

[0145] Example 1: Screening of candidate genes for laccase

[0146] Identification of white rot fungi

[0147] The white rot fungus tested in this example (collected and isolated in Changbai Mountain) was first cultured on PDA medium for 5 days, and then the mycelium was collected. DNA was extracted using a fungal genomic DNA extraction kit (BioFlux). Subsequently, fungal universal primers (ITS4 / 5, ITS4: TCCTCCGCTTATTGATATGC; ITS5: GGAAGTAAAAGTCGTAACAAGG) were used to amplify its ITS region by PCR (PCR amplification conditions: 95°C for 5 min, 95°C for 45 s, 55°C for 45 s, 72°C for 1 min, 35 cycles, and extension at 72°C for 7 min). The strain was Versicolor versicolor.

[0148] ITS region amplified sequence:

[0149]

[0150] Genomic analysis of white-rot fungi

[0151] Cultured mycelia of Coriolus versicolor were collected and sent to Anshengda (formerly Jinweizhi) for next-generation genome sequencing (Illumina). Sequencing data were quality-assessed and then analyzed for genome assembly: Velvet (v1.2.10), SSPACE (v3.0), and GapFiller (v1-10) were used for genome assembly. Coding genes were predicted using Prodigal (v3.02). Gene function annotation was performed using BLAST (v2.2.31) against the NCBI NR database and Pfam database. Signal peptides and secreted proteins were predicted using SingalP. The resulting full-length genome was 44,785,457 bp (approximately 40 Mb), containing 17,234 coding genes and seven candidate genes encoding laccases. Laccase SRP33 was selected based on the expression trends of candidate genes in the proteome under benzopyrene-induced conditions. Its DNA and protein information are shown in Table 1.

[0152] Table 1: Protein and DNA information of laccase SRP33

[0153] full length signal peptide Mature peptide DNA 1..1584 1..69 70..1581 protein 1..527 1..23 24..527

[0154] SRP33 full-length DNA coding sequence: SEQ ID NO: 1

[0155]

[0156] SRP33 full-length protein sequence: SEQ ID NO: 2

[0157]

[0158]

[0159] DNA coding sequence of SRP33 mature protein: SEQ ID NO: 3

[0160]

[0161] Amino acid sequence of SRP33 mature protein: SEQ ID NO: 4

[0162]

[0163] Example 2: Cloning, purification and activity determination of SRP33 laccase

[0164] SRP33 laccase was recombinantly expressed in Aspergillus oryzae strain Cols1300 (Cols1300 is a Novozymes strain; its construction and genotype are described in US2019225988 A1). SEQ ID NO:1 is the DNA sequence encoding SRP33. The DNA was codon-optimized for the expression host, A. oryzae. The DNA was synthesized by Azenta Life Sciences (Suzhou, China). The DNA encoding SRP33 was integrated into the Cols1300 genome via protoplast transformation (US2019 / 0225988A1), where expression is controlled by the NA2-TPI promoter and the AMG terminator. Transformants were amplified by PCR and Sanger sequencing to confirm correct insertion of the coding sequence. Transformants were screened for expression in 3 ml of liquid culture medium. Transformants were inoculated into Dap4C medium with 0.2 mM CuSO₄ and cultured at 30°C, 150 rpm, for 4 days. The ABTS method (100ul supernatant + 60ul 3mM ABTS, pH 5.5, 30°C, 15min, reading at 405nm) showed obvious laccase activity. SDS-PAGE gel electrophoresis showed a recombinant protein band of approximately 90kDa in the supernatant, confirming that SRP33 was successfully expressed in Cols1300.

[0165] Transformants with confirmed expression were inoculated onto slants and cultured at 37°C for 4-5 days. Once the slants were fully spore-grown, the spores were suspended in 10 ml of culture medium and inoculated into 1600 ml of Dap4C + 0.2 mM CuSO₄ (four 2 L shake flasks, 400 ml per flask) at 30°C, 80 rpm, and cultured for 4 days. The culture supernatant was then filtered through a Rapid-Flow Bottle Top Filter (0.2 μm aPES membrane) (ThermoFisher Scientific, Cat# 597-4520) to remove spores. The supernatant was then used to purify the SRP33 recombinant protein.

[0166] Protein purification

[0167] First, prepare the buffer system, using 20 mM Tis-HCl, pH 7.0, as the eluent. Add 2 M ammonium sulfate to the eluent as the equilibration solution. After centrifugation, the culture supernatant is then supplemented with ammonium sulfate to a final system conductivity of 200 mS / cm. After filtration, the supernatant is injected into a chromatography column (HiTrap Butyl HP, Cytiva) that has been treated with the equilibration solution. Three column volumes of equilibration solution are then flushed, followed by a 40 column volume gradient using the eluent, followed by another 4 column volumes of elution. The collected permeate and elution fractions are subjected to SDS-PAGE and activity analysis.

[0168] Fractions containing laccase activity were pooled and desalted using a Sephadex G25 (Cytiva) column, using 20mM Tris-HCl (pH 7) as the buffer. The collected enzyme solution after desalting proceeded to the second purification step. This chromatography step used a Capto HiRes Q column with a 20 column volume gradient and 20mM Tris-HCl (pH 8.0) containing 1M NaCl as the eluent. The permeate and eluted fractions were subjected to SDS-PAGE and activity analysis. The eluted fractions containing enzyme activity were pooled, concentrated, and the buffer exchanged to 20mM Tris-HCl (pH 7.0) by dialysis. The enzyme concentration was then determined.

[0169] The protein concentration was determined using the Quant-iT Protein Assay Kit (Invitrogen).

[0170] Enzyme activity test

[0171] Laccase activity (LAMU) units are defined as the amount of enzyme required to convert 1 μM syringaldazine (a typical substrate for laccase) per minute under defined conditions. Specific tests are as follows:

[0172] Sigma's Aspergillus laccase (SAE0050) was used as a standard and diluted to various concentrations for testing. In a 96-well plate, the reaction system contained 145 μL of 25 mM Tris-HCl, pH 7.5, 0.05% Triton X-100, 18 μL of 0.22 mM syringaldazine, and 15 μL of enzyme solution. The plate was placed in a microplate reader, shaken for 20 seconds, and the absorbance at 540 nm was read every 30 seconds for 5 minutes. The reaction temperature was controlled at 30°C. Vmax values ​​(milli-units / min) were calculated for five points, and a standard curve of enzyme activity was constructed by plotting Vmax against protein content. All samples were tested under the same conditions, and the activity values ​​corresponding to the calculated Vmax values ​​were read on the standard curve.

[0173] The specific activities of this enzyme relative to SAE0050 at pH 5.0 and pH 7.0 were 42711 and 3277 LAMU per gram protein, respectively. Syringaldazine is a typical substrate of laccases, and sequence alignment confirmed that SRP33 is a laccase.

[0174] Example 3: Degradation of polycyclic aromatic hydrocarbons by laccase SRP33.

[0175] To evaluate the performance of enzymes in soil remediation, the inventors selected benzo[a]pyrene as a representative substrate for PAHs to determine the enzymatic reaction. The enzymatic reaction conditions were as follows: In a 10-ml glass tube, a total volume of 2 ml contained 20 μg of laccase (laccase SRP33, or Coriolus versicolor laccase (Cat. No. 38429) from Sigma-Aldrich as control 1, or commercial laccase sample NS29056 from Novozymes as control 2), 50 μM benzo[a]pyrene, 1 μM 1-hydroxybenzotriazole (HBT), 1% Tween 80, 10% acetonitrile, and 50 mM Tris-HCl buffer, pH 5. A blank control group with the same setup but without enzyme was also included. After incubation in sealed tubes at 37°C for 24 hours, 0.5 ml of the reaction solution was collected from each reaction tube and mixed with 0.5 ml of acetonitrile, filtered through 0.45-μm filter paper, and analyzed by UPLC.

[0176] UPLC separation of the reaction solution at 50°C was performed on a Waters ACQUITY UPLC BEH C18 column (2.1 x 100 mm, 1.7 μm particle size). The mobile phase consisted of 0.1% formic acid (A) / 0.1% formic acid + acetonitrile (B) at a constant flow rate of 0.4 mL / min (linear gradient elution over 10 minutes: 0 minute, 60% A + 40% B; 1.5 minutes, 60% A + 40% B; 8.5 minutes, 100% B; 10 minutes, 60% A + 40% B). Benzo[a]pyrene quantification was performed at a wavelength of 254 nm. The retention time of benzo[a]pyrene was determined to be approximately 7.0 minutes. The concentration of benzo[a]pyrene was calculated using a standard curve, and the relative removal efficiency was estimated using the following formula: ([BaP_test sample] - [BaP_blank control sample]) / [BaP_blank control sample]. The number of replicates is shown in Table 2. The experimental results are shown in Table 2. The removal efficiency of benzo[a]pyrene by currently commercially available laccases is between 20% and 40%. Unexpectedly, the present inventors found that SRP33 exhibited a higher removal efficiency of benzo[a]pyrene (up to 80%).

[0177] Table 2: Benzo[a]pyrene removal rate

[0178]

[0179]

[0180] The invention described and claimed herein is not limited in scope to the specific aspects disclosed herein, as these aspects are intended to be illustrative of several aspects of the invention. Any equivalent aspects are intended to be within the scope of the invention. Indeed, various modifications of the invention in addition to those shown and described herein will become clear to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the event of a conflict, the present disclosure, including definitions, will control.

Claims

1. A polypeptide, the amino acid sequence of which is shown in SEQ ID NO:

2.

2. A polynucleotide encoding the polypeptide according to claim 1, wherein the polynucleotide sequence is shown in SEQ ID NO:

1.

3. A nucleic acid construct comprising a polynucleotide according to claim 2, wherein the polynucleotide is operably linked to one or more control sequences that direct the production of the polypeptide in a recombinant host cell.

4. An expression vector comprising the polynucleotide according to claim 2 or the nucleic acid construct according to claim 3.

5. A host cell comprising the polynucleotide according to claim 2, the nucleic acid construct according to claim 3 or the expression vector according to claim 4.

6. A method for producing a polypeptide, the method comprising: a) cultivating the host cell according to claim 5 under conditions suitable for expressing the polypeptide; and b) recovering the polypeptide.

7. A composition comprising the polypeptide of claim 1, the polynucleotide of claim 2, the nucleic acid construct of claim 3, the expression vector of claim 4 and / or the host cell of claim 5, and optionally comprising a lignin peroxidase, a manganese peroxidase and / or a cytochrome P450 monooxygenase.

8. Use of the polypeptide according to claim 1, the polynucleotide according to claim 2, the nucleic acid construct according to claim 3, the expression vector according to claim 4, the host cell according to claim 5 and / or the composition according to claim 7 for degrading benzo[a]pyrene.

9. A method for remediating soil, sludge or sewage containing benzo[a]pyrene, comprising applying the polypeptide according to claim 1, the polynucleotide according to claim 2, the nucleic acid construct according to claim 3, the expression vector according to claim 4, the host cell according to claim 5 and / or the composition according to claim 7 to the soil, sludge or sewage; The method may also include steps of bioremediation, physical remediation and / or chemical remediation.

Citation Information

Patent Citations

  • Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus

    EP0238023A2

  • Genomic integration of DNA fragments in fungal host cells

    US20190225988A1

  • Fungal promoters active in the presence of glucose

    US6011147A

  • Nucleotide sequences for the control of the expression of DNA sequences in a cellular host

    WO1994025612A2

  • Phosphonyldipeptides useful in the treatment of cardiovascular diseases

    WO1995033836A1