Use of miR408 in enhancing plant disease resistance
By transiently silencing miR408 in cucumbers, and utilizing recombinant vectors and microbial technology, the resistance of cucumbers to cucumber green mottle mosaic virus was enhanced, solving the problem of cucumber viral diseases and improving the disease resistance and yield of cucumbers.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-15
- Publication Date
- 2026-04-07
AI Technical Summary
The cucumber green mottle mosaic virus disease is severe, and the lack of effective antiviral agents and resistant varieties under current technology has severely restricted cucumber yield and quality.
By transiently silencing miR408 in cucumbers, plant disease resistance was regulated and the plant's resistance to cucumber green mottle mosaic virus was enhanced using the recombinant vector pTRV2:STTM-miR408 and the recombinant microorganism Agrobacterium GV3101.
It significantly reduced the accumulation of viral RNA in cucumbers, decreased chlorosis and yellowing spots on leaves, and improved the plant's disease resistance.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the use of miR408 in enhancing plant disease resistance. Background Technology
[0002] MicroRNAs (miRNAs) are a class of endogenous, small non-coding RNAs, 21–25 nucleotides in length. They primarily regulate plant gene expression through either directed splicing or translational repression, participating in the regulation of various aspects of plant growth and development, signal transduction, and abiotic stress. Endogenous plant miRNAs play crucial roles in the regulation of gene expression by pathogen-associated molecular patterns (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI). When pathogens invade, miRNAs directly resist pathogen attack by enhancing physical and mechanical resistance such as the plant cell wall, or act as initial signaling sources, participating in the regulation of resistance-related signaling pathways and activating key transcription factors in these pathways to rationally regulate various plant resistance mechanisms to defend against pathogens. miRNAs can also directly regulate plant resistance genes and their proteins, inducing the expression of disease-resistant defense genes, whose expression products inhibit pathogen growth. These miRNAs are upregulated or downregulated during pathogen infection, and function by inhibiting negative regulators in the defense response and promoting positive regulators in the defense response.
[0003] Cucumber green mottle mosaic virus (CGMMV) is causing increasingly widespread and severe viral diseases in cucurbitaceous crops in my country, gradually becoming one of the major diseases affecting cucumber and other cucurbitaceous crops, significantly hindering the improvement of cucumber yield and quality traits. Given the current lack of effective antiviral agents, breeding resistant varieties remains the preferred method for controlling viral diseases in production. Therefore, identifying and screening key genes for CGMMV resistance in cucumbers and exploring their antiviral molecular mechanisms can provide a theoretical basis for the breeding of resistant varieties. Summary of the Invention
[0004] The purpose of this invention is to provide a miRNA related to plant disease resistance and its application.
[0005] The cucumber endogenous miRNA provided by this invention is named miR408, and its nucleotide sequence is SEQ ID No.1, which consists of 21 nucleotides.
[0006] Biomaterials related to miR408 are also within the scope of protection of this invention.
[0007] The biological material associated with miR408 is a short tandem target mimic (STTM) sequence that encodes a nucleic acid molecule that represses the miRNA molecule.
[0008] The biological material associated with miR408 is an expression cassette containing a nucleic acid molecule encoding a repression of the miRNA molecule.
[0009] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0010] In one embodiment of the present invention, the nucleic acid molecule encoding the miRNA molecule is SEQ ID No. 2.
[0011] The biological material associated with miR408 is a recombinant vector containing a nucleic acid molecule encoding a repressor of the miRNA molecule, or the expression cassette.
[0012] The biological material associated with miR408 is a recombinant microorganism, which contains a nucleic acid molecule encoding a repressor of the miRNA molecule, or the expression cassette, or the recombinant vector.
[0013] The biological material associated with miR408 is a transgenic plant cell line containing a nucleic acid molecule encoding a repressor of the miRNA, or the expression cassette, or the recombinant vector.
[0014] The miRNA molecule, the short tandem target mimic sequence, the expression cassette, the recombinant vector, the recombinant microorganism, or the transgenic plant cell line can be used to regulate plant disease resistance.
[0015] In embodiments of the present invention, the vector may be a plasmid, a bacteriophage, or a viral vector.
[0016] In a specific embodiment of the present invention, the recombinant vector may be an expression vector for expressing a nucleic acid molecule that inhibits miR408 expression. Specifically, it may be a recombinant vector containing SEQ ID No. 2. The recombinant vector containing SEQ ID No. 2 refers to the vector pTRV2:STTM-miR408 obtained by homologously integrating a 126bp short tandem target mimic (STTM) sequence of miR408 (the DNA fragment shown in SEQ ID No. 2) into the pTRV2 vector. Here, STTM is a specific sequence of 48 bases (GTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAA T), which connects two TMs (Target mimics). At the miRNA cleavage site on both TMs, there is a protrusion structure composed of 3 bases (cta). Due to the presence of this protrusion, the miRNA can bind to it but cannot actually cleave it, thereby inhibiting miRNA function. Therefore, this vector can be used to express target miRNA miRNA sequences to silence endogenous miRNAs in plants.
[0017] miR408 can be transiently silenced in cucumber using virus-based microRNA silencing (VbMS) technology based on Tobacco rattle virus (TRV). The recombinant vector is pTRV2:STTM-miR408, which is a recombinant vector obtained by introducing the fragment shown in SEQ ID No. 2 into the pTRV2 vector.
[0018] The present invention provides a method for cultivating transgenic plants with enhanced disease resistance, comprising silencing the miRNA molecule in the recipient plant to obtain transgenic plants with higher disease resistance than the recipient plant.
[0019] Specifically, VbMS technology can be used to transiently silence miR408 in cucumbers. In an embodiment of the present invention, this is achieved by co-transfecting the recipient plant with recombinant microorganisms containing pTRV1 and recombinant microorganisms containing the pTRV2:STTM-miR408 vector.
[0020] In the method for cultivating transgenic plants with enhanced disease resistance, the miRNA molecule, the expression cassette, or the recombinant vector is introduced into the recipient plant using the recombinant microorganism.
[0021] In embodiments of the present invention, the recombinant microorganism may be yeast, bacteria, algae, or fungi. The bacteria may be Agrobacterium; specifically, Agrobacterium GV3101.
[0022] In a specific embodiment of the present invention, in the method for cultivating transgenic plants with enhanced disease resistance, the recombinant microorganism is Agrobacterium GV3101 containing pTRV1 or pTRV2:STTM-miR408.
[0023] In the above method, the disease resistance of the transgenic plant is higher than that of the recipient plant, as reflected in all or part of the following A1)-A2):
[0024] A1) The accumulation of CGMMV RNA in the transgenic plant is lower than that in the recipient plant;
[0025] A2) The transgenic plant leaves have fewer chlorotic and yellow spots than the recipient plant.
[0026] In embodiments of the present invention, the transgenic plant cell line does not include plant propagation material.
[0027] In embodiments of the present invention, the regulation of plant disease resistance is to improve plant disease resistance, specifically embodied in all or part of the following B1)-B2):
[0028] B1) When the expression level of miR408 in a plant decreases, the accumulation of CGMMV RNA in the plant decreases;
[0029] B2) When the expression level of miR408 in plants decreases, the chlorotic and yellow spots on the leaves of the plants decrease.
[0030] In the above method, the plant is a dicotyledonous plant; the dicotyledonous plant can be a cucumber; specifically, the cucumber can be a Xintai dense-thorned cucumber.
[0031] In the above method, the transgenic plant is understood to include not only the first-generation transgenic plant obtained by transforming the target plant with the gene, but also its progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The transgenic plant includes seeds, whole plants, and cells.
[0032] This invention employs multiple biological techniques, including bioinformatics prediction, molecular cloning, Agrobacterium-mediated transformation, virus-based microRNA silencing (VbMS), and real-time quantitative PCR. Using cucumbers with silenced miR408 as the research object and cucumbers transformed with the empty vector pTRV1+pTRV2 as a control, miR408 was silenced for the first time. The impact of miR408 on the degree of damage to infected plants was investigated from a molecular biological perspective by measuring the accumulation of viral RNA after CGMMV inoculation and observing chlorosis and yellowing spots on leaves after disease occurrence. The results demonstrate that transgenic plants with silenced miR408 exhibited higher disease resistance than the control group, indicating that miR408 is a microRNA related to plant disease resistance and can be used to regulate the disease resistance of target plants. Attached Figure Description
[0033] Figure 1 A schematic diagram of a short tandem target simulation sequence for cucumber miR408.
[0034] Figure 2 Quantitative analysis of miR408 in cucumber for silencing miR408
[0035] Figure 3 Analysis of CGMMV RNA accumulation in cucumber with silenced miR408
[0036] Figures 2-3 TRV:00 represents the blank control group (cucumber seedlings were soaked in a 1:1 mixture of pTRV1 and pTRV2 bacterial solutions).
[0037] Figures 2-3 TS stands for Transient silencing. Detailed Implementation
[0038] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention.
[0039] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.
[0040] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0041] The Agrobacterium competent cells GV3101 used in the following examples can be purchased from Shanghai Weidi Biotechnology Co., Ltd.
[0042] The cucumber inbred line “Xintai Mici” used in the following examples was purchased from Xintai Mici Cucumber Seed Farm in Xintai City, Shandong Province.
[0043] The vectors pTRV1 and pTRV2 used in the following examples can be purchased from Hunan Fenghui Biotechnology Co., Ltd.
[0044] The mature miR408 sequence in this invention is the RNA molecule shown in SEQ ID No. 1 of the sequence listing.
[0045] The nucleic acid sequence for silencing miR408 in this invention is the DNA molecule shown in SEQ ID No. 2 in the sequence listing.
[0046] This invention uses miR408-transformed cucumbers as the research object and wild-type Xintai dense-spined cucumbers as a control. By detecting the accumulation of viral RNA in recipient plants challenged with cucumber green mottle mosaic virus, the influence of miR408 on the degree of damage to infected plants was studied from a molecular biology perspective, demonstrating the regulation of plant disease resistance pathways by miR408. This invention is of great significance for revealing the disease resistance function of miR408 and the breeding of disease-resistant cucumber varieties, and contributes to enriching vegetable breeding resources.
[0047] Example 1: Application of miR408 in regulating disease resistance in cucumber
[0048] I. Effects of silencing miR408 on disease resistance in cucumber
[0049] Design and synthesize short tandem target mimic (STTM) sequences for miR408. Figure 1 Using virus-based microRNA silencing (VbMS) technology based on Tobacco rattle virus (TRV), miR408 was silenced in cucumber seedlings.
[0050] 1. Construction of the silent miR408 vector and cucumber acquisition
[0051] (1) Construction and transformation of Agrobacterium silencing vector pTRV2:STTM-miR408
[0052] The STTM fragment of miR408 (SEQ ID No. 2) was artificially synthesized. Using the InFusion HD Cloning Kit (purchased from Takara), the target fragment was cloned into the pTRV2 vector (purchased from Hunan Fenghui Biotechnology Co., Ltd.) to obtain the pTRV2:STTM-miR408 vector. 2.5 μL of In-Fusion reaction solution was used to transform the pTRV2:STTM-miR408 vector into E. coli competent cells Stellar (purchased from Beijing TransGen Biotech Co., Ltd.). The plasmid DNA of pTRV1 (purchased from Hunan Fenghui Biotechnology Co., Ltd.) and pTRV2:STTM-miR408, which were identified as positive by sequencing analysis, were transformed into Agrobacterium GV3101 competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.). Single colonies were picked for colony PCR verification, and plasmid DNA was extracted for sequencing.
[0053] (2) Obtaining the Silent miR408 Cucumber
[0054] miR408 was transiently silenced in cucumber using virus-based microRNA silencing (VbMS) technology. The specific steps are as follows:
[0055] ① After germination, the seeds of Xintai dense-thorned cucumber are sown in plastic flower pots and placed in plant growth incubators.
[0056] ② When the first true leaf growth point of the cucumber seedling emerges (about 5-7 days), under dark conditions, a small wound is gently made with a blade. Cotton is moistened with Agrobacterium containing pTRV1 and pTRV2:STTM-miR408 vectors (mixed in a 1:1 ratio) revived with the infusion solution and placed on the small wound. A blank control is used as a treatment with a mixed bacterial solution of pTRV1 and pTRV2 (mixed in a 1:1 ratio). Agrobacterium transformed with pTRV1 and pTRV2:PDS (mixed in a 1:1 ratio) is used as a silencing indicator control. Specifically, pTRV2:PDS (PDS is phytoene desaturase, accession number ABE99707) is obtained by inserting a fragment of PDS between CP and Rz of the pTRV2 vector, replacing the original MCS. Every 2 hours, the cotton balls are moistened again with the corresponding bacterial solution, and this process is repeated 3 times. After the cotton balls with bacterial solution are moistened, they are removed. The cucumber seedlings are then placed in a plant growth incubator and grown under 16 hours of light and 8 hours of darkness. Watering is done as needed during the growth period.
[0057] 2. The effect of silencing miR408 on disease resistance in cucumber
[0058] (1) About 10 days after treatment, when the first true leaf unfolds, cucumber seedlings are inoculated with CGMMV by friction. On days 15-20 of growth, samples are taken from the second and third leaves of the cucumber plants to extract total RNA. The expression level of miR408 and the accumulation of CGMMV virus RNA are detected by real-time quantitative PCR.
[0059] (2) qRT-PCR was performed using specific primers for miR408 and CGMMV, respectively, and 2 -△△Ct The relative expression levels of miR408 and CGMMV coat protein genes were calculated and analyzed. The upstream primer sequence for miR408 is 5'-TGCACTGCCTCTTCCCTGG-3', and the downstream universal primer was provided by the miRcute Enhanced miRNA Quantitative Detection Kit (SYBR) (FP411, purchased from Tiangen Biotech (Beijing) Co., Ltd.); the upstream primer sequence for the internal reference gene EF-1a is 5'-ACTGGTGGTTTTGAGGCTGGT-3', and the downstream primer sequence is 5'-CTTGGAGTATTTGGGTGTGGT-3'; the upstream primer sequence for the internal reference gene Ubiquitin is 5'-CTAATGGGGAGTGGGGAAGTA-3', and the downstream primer sequence is 5'-GTCTGGATGGACAATGTTGAT-3'; the qPCR primer sequences for the CGMMV capsid protein gene are upstream 5'-ACAGCCGCTAGGGCTGAGATA-3', and downstream 5'-CCAATGAGCAAACCGTTCGAT-3'.
[0060] The results showed that in cucumbers transfected with Agrobacterium containing pTRV1 and Agrobacterium containing pTRV2:STTM-miR408, miR408 was silenced ( Figure 2 , Figure 3 TS-miR408 in the sample, compared to the control (pTRV1+pTRV2) Figure 2 , Figure 3 In TRV:00), the expression level of miR408 decreased to 0.01 ( Figure 2 The accumulation of CGMMV RNA decreased to 0.05 ( ), Figure 3 The cucumber leaves of the silent miR408 vector showed fewer chlorotic and yellow spots than the control group with the empty vector.
[0061] In conclusion, compared with the control group, transgenic plants with silenced miR408 showed higher disease resistance. miR408 is a microRNA associated with plant disease resistance and can be used to regulate the disease resistance of target plants.
Claims
1. The application of a miRNA molecule in enhancing the resistance of cucumber to cucumber green mottle mosaic virus; the mature sequence of the miRNA molecule is SEQ ID No.
1.
2. The application of a short tandem target mimic sequence in improving the resistance of cucumber to cucumber green mottle mosaic virus; wherein the short tandem target mimic sequence encodes a nucleic acid molecule that inhibits the mature miRNA molecule with the sequence SEQ ID No. 1, and the nucleotide sequence of the miRNA molecule is SEQ ID No.
2.
3. The application of expression cassettes, recombinant vectors, or transgenic plant cell lines containing the short tandem target mimic sequence shown in SEQ ID No. 2 in enhancing the resistance of cucumber to cucumber green mottle mosaic virus.
4. A method for cultivating transgenic cucumbers with enhanced disease resistance, characterized in that, Transgenic cucumbers with higher resistance to cucumber green mottle mosaic virus than the recipient cucumber were obtained by silencing the miRNA molecule with the mature sequence SEQ ID No. 1 in the recipient cucumber.
5. The method according to claim 4, characterized in that, The mature miRNA molecule with the sequence SEQ ID No. 1 was transiently silenced in cucumber using a tobacco brittle virus-based miRNA silencing technology based on the short tandem target simulated sequence shown in SEQ ID No. 2.
Citation Information
Patent Citations
Autofluorescence relevant micromolecule RNA of chloroplast and application of autofluorescence relevant micromolecule RNA
CN105969797A