A method for engineering bacteria against bacteriophages and engineered bacterial strains

By integrating the DNA phosphorylation restriction-modification system into host bacteria and knocking out phage receptor sites and life cycle genes, phage-resistant engineered strains were constructed, solving the problem of phage contamination in industrial fermentation and achieving strong resistance to broad-spectrum phages and stability of the fermentation process.

CN115927421BActive Publication Date: 2025-11-25WUHAN UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210804925.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-08
Publication Date
2025-11-25
Estimated Expiration
2042-07-08

AI Technical Summary

Technical Problem

During industrial fermentation, phage contamination leads to productivity paralysis and economic losses, and existing prevention and control strategies are insufficient to effectively resist broad-spectrum phage infection.

Method used

By transforming or integrating restriction-modification system genes into host bacteria, particularly DNA phosphorothioylation restriction-modification systems, and knocking out phage receptor sites and key life cycle genes, anti-phage engineered strains can be constructed.

Benefits of technology

It achieves strong resistance to broad-spectrum bacteriophages, ensuring that fermentation production efficiency and product production rate are not reduced, and provides an effective solution for the prevention and control of bacteriophage contamination.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115927421B_ABST
    Figure CN115927421B_ABST
Patent Text Reader

Abstract

The application discloses a method for modifying bacteriophage-resistant bacteria and an engineering strain, and belongs to the technical field of biotechnology.The method for modifying the bacteriophage-resistant bacteria is to integrate a bacteriophage defense system from bacteria into the genomes of multiple engineering strains to provide resistance to multiple bacteriophages for the host.Combined with modification of a bacteriophage receptor site gene and a key gene in a bacteriophage life cycle, systematic modification can obtain an engineering strain with strong resistance to multiple bacteriophages.Through the method for modifying the bacteriophage-resistant bacteria, the engineering bacteria have the characteristics of resisting bacteriophages and have the effect of resisting bacteriophage pollution in a fermentation process.The application can be applied to development of biotechnology and application of resisting bacteriophage pollution in an industrial fermentation process.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a method for modifying bacterial anti-phage and an engineered bacterial strain. BACKGROUND

[0002] Bacteriophage is a kind of virus that specifically infects bacteria and relies on the life material in the bacterial cell to complete self-replication and reproduction. It is also the most abundant and ancient biological entity on earth (Summers 2011). In nature, there is a constant and intense arms race between bacteriophages and bacteria, which drives the rapid evolution of both species and injects vitality into the evolution and development of life. However, in industrial fermentation processes, the presence of bacteriophages is the most common factor leading to the failure of microbial fermentation. Large-scale bacteriophage contamination outbreaks can directly lead to the paralysis of equipment productivity and heavy economic losses. The essence of traditional bacteriophage contamination prevention strategies is to cut off all pathways for bacteriophage contact with the host, determine the source of bacteriophage and take appropriate measures to prevent the introduction of bacteriophage, monitor bacteriophage contamination in the fermentation process at any time, and implement regular strain rotation strategies (Los, Czyz et al. 2004). However, in natural environments, there are still a large number of bacterial microorganisms, and they have not become extinct due to the presence of bacteriophages. The reason is that, in the face of the survival pressure of bacteriophage infection, bacteria can evolve various powerful defense systems to resist bacteriophage infection. These naturally occurring defense systems can precisely attack one or several stages of the bacteriophage life cycle, gaining a survival advantage by disrupting the bacteriophage reproduction process. Adsorption inhibition (Forde, Fitzgerald et al. 2003), DNA injection blocking (Sie) (Mahony, McGrath et al. 2008) are representative defense systems that mainly act on the process of bacteriophage genetic material injection into bacterial cells, which is the first step of bacteriophage invasion. After the bacteriophage genetic material is injected into the cell, bacteria can also use restriction-modification systems (Tock and Dryden 2005, Oliveira, Touchon et al. 2014), CRISPR-Cas systems (Barrangou, Fremaux et al. 2007, Jackson, McKenzie et al. 2017), and abortive infection mechanisms (Molineux 1991) to prevent the replication, transcription, translation, and progeny bacteriophage assembly process of bacteriophage genetic material in the cell, and to prevent the formation and release of progeny bacteriophage as much as possible. These defense systems that act on the bacteriophage reproduction process in the cell often have mechanisms to distinguish between "self" and "non-self" material components (including nucleic acids and proteins). However, the restriction-modification system and the CRISPR-Cas system do not threaten the survival of the host cell, while the abortive infection mechanism sacrifices the infected host to maximize the continuation of the entire population.

[0003] The restriction modification system is widely distributed in bacteria and archaea genomes, and is a kind of innate immune system that can provide defense function to the host against foreign nucleic acids (including plasmids and bacteriophages). The effector element of the restriction modification system that plays a defense function against bacteriophages is divided into two parts, restriction element and modification element. The modification element will modify the host genome on a specific sequence band, thus being marked as "self" and being protected. At the same time, the restriction element will recognize the foreign DNA without modification as "non-self" and carry out restriction cutting, thus destroying the reproduction process of bacteriophage in the host cell through the mechanism of destroying the integrity of foreign DNA or degrading nucleic acid, thereby playing a role in restricting bacteriophage. Among all the defense mechanisms, the restriction modification system can often play a restriction effect on a wide spectrum of bacteriophages. The recognition core sequence of the restriction modification system only needs 4-8 bp of base length, so these recognized core sequences are widely present in the genomes of all bacteriophages. The bacteriophages without antagonistic restriction modification system mechanism will be prevented and cut by the restriction modification system. The natural defense system of the restriction modification found in bacteriophage-resistant strains can be transferred horizontally or by conjugation, and can endow bacteriophage-sensitive strains with restriction effect on a wide spectrum of bacteriophages, and thus can be applied to engineering strains. Through modification, an engineering strain that can be applied to fermentation production and can resist bacteriophage pollution is obtained, thus providing a feasible solution for resisting bacteriophage pollution in industrial fermentation. SUMMARY

[0004] The purpose of the present application is to provide a systematic anti-bacteriophage modification method and an anti-bacteriophage engineering strain for solving the problem of bacteriophage pollution in industrial fermentation. The present application can be widely applied to the anti-bacteriophage modification of bacteria or industrial strains, and can convert bacteriophage-sensitive strains into bacteriophage-resistant strains, and can endow the engineering strain with strong resistance effect against a wide spectrum of bacteriophages. The engineering strain with anti-bacteriophage ability after modification can be applied to industrial fermentation, and can provide a feasible solution for preventing and treating bacteriophage pollution in industrial fermentation.

[0005] The purpose of the present application is achieved by the following technical solutions:

[0006] A bacteriophage-resistant modification method, which is to transform a set of restriction-modification system genes into a host by a vector to enable the host to express the genes, or to integrate a set of restriction-modification system genes into the genome of the host to enable the host to express the genes, and to knockout and modify the bacteriophage receptor site gene and the bacteriophage life cycle gene of the host.

[0007] The restriction-modification system is preferably a DNA phosphorothioate restriction-modification system.

[0008] In some embodiments, the phage receptor site gene is fhuA gene, and the phage life cycle gene is trxA gene.

[0009] In some embodiments, the host is Escherichia coli, including Escherichia coli MG1655, W3110, BW25113, JM109, MG1655(DE3), OP50, W, etc.

[0010] In some embodiments, the integration site of the gene in the host genome is the intergenic region between aslA and glmZ genes in the genome of the Escherichia coli host strain.

[0011] The application of the above-mentioned bacterial anti-phage modification method in constructing an anti-phage engineering strain.

[0012] An anti-phage engineering strain obtained by the above-mentioned bacterial anti-phage modification method, and the anti-phage engineering strain obtained by modification has a strong resistance effect on a broad-spectrum of phages.

[0013] The application of the above-mentioned bacterial anti-phage modification method or anti-phage engineering strain, including the application of the engineering strain in resisting phage contamination in the fermentation process.

[0014] The application provides a systematic anti-phage modification method based on a restriction modification system genome integration, and application of the genome modification method can modify a bacterial engineering strain widely used in the fermentation industry but sensitive to phage contamination into a phage-resistant strain having a strong restriction effect on multiple phages, and the anti-phage engineering strain obtained by application of the modification method can be widely applied to fermentation processes of different products, and has a strong restriction and defense effect on a broad-spectrum of phage mixtures while keeping the normal growth physiological phenotype of the host strain and the production rate of the fermentation product consistent with the original strain, thereby providing an important solution for construction of a phage-resistant strain and management of phage contamination in the fermentation process.

[0015] Advantages and beneficial effects of the application:

[0016] The anti-phage systematic modification method provided by the application can be used for anti-phage functional modification of an engineering strain, and the modified engineering strain can be applied to a fermentation production process to resist phage infection.

[0017] The anti-phage systematic modification method provided by the application can be used for development of biotechnology and applied to, but not limited to, resisting phage contamination in an industrial fermentation process.

[0018] The engineering strain obtained by modification of the application exhibits a strong resistance effect on phages, and exhibits a strong resistance effect on phages while ensuring the fermentation production efficiency.BRIEF DESCRIPTION OF DRAWINGS BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 is a schematic diagram of plasmid pWHU3640, on which the sspBCD-sspE restriction modification gene cluster from E. coli 3234 / A is contained.

[0020] Figure 2 is a diagram of the resistance of E. coli (empty vector) and E. coli (pWHU3640) to phages T1, JMPW2, T4, T5, T7, EEP and lambda, respectively. JMPW2 is a mutant of T1 phage. Seven strains of E. coli, MG1655, W3110, BW25113, JM109, MG1655(DE3), OP50 and W, were introduced with the relevant plasmids (empty vector and pWHU3640) and the effect of the plasmid introduction on phage resistance was evaluated.

[0021] Figure 3 is a schematic diagram of plasmid pWHU6401, on which the sspBCD gene cluster from E. coli 3234 / A and the left and right homologous arm sequences upstream and downstream of the integration site are contained, respectively, for genomic integration of the sspBCD gene cluster in E. coli host strains.

[0022] Figure 4 is a schematic diagram of plasmid pWHU6402, on which the homologous recombination template sequence for precise deletion of loop 8 of fhuA is contained, for site modification of the fhuA gene in E. coli MG1655 int(aslA-glmZ)::sspBCDE, W3110 int(aslA-glmZ)::sspBCDE and MG1655(DE3) int(aslA-glmZ)::sspBCDE.

[0023] Figure 5 is a schematic diagram of plasmid pWHU6403, on which the homologous recombination template sequence for in-frame deletion of the phage life cycle key protein trxA is contained, respectively, for knock-out modification of the trxA gene in E. coli MG1655 int(aslA-glmZ)::sspBCDE fhuA(Δ552-558NSEG), W3110 int(aslA-glmZ)::sspBCDE fhuA(Δ552-558NSEG) and MG1655(DE3) int(aslA-glmZ)::sspBCDE fhuA(Δ552-558NSEG).

[0024] Figure 6Figure 1 is a chart of the resistance of E. coli, E. coli-PT, E. coli-EPR to bacteriophages T1, JMPW2, T4, T5, T7, EEP and lambda phage. Here, the effect of phage resistance of three groups of nine E. coli strains, MG1655, W3110 and MG1655(DE3), was evaluated. Chart a, chart b and chart c correspond to the results of E. coli strains MG1655, W3110 and MG1655(DE3), respectively. Here, E. coli was used as the wild type, E. coli int(aslA-glmZ)::sspBCDE was named E. coli-PT, and E. coli int(aslA-glmZ)::sspBCDE fhuA(A552-558NSEG) AtrxA was named E. coli-EPR.

[0025] Figure 7 Figure 2 is an evaluation of the growth trend of E. coli, E. coli-EPR under the condition of adding phage and no phage mixture. Here, the growth curves of three groups of six E. coli strains, MG1655, W3110 and MG1655(DE3), were detected. Chart a is the growth curve of the strains when no phage mixture was added, and chart b is the growth curve of the strains when phage mixture was added. The composition of the phage mixture was T1 MOI=10, JMPW2 MOI=10, T5 MOI=10, EEP MOI=10, T4 MOI=0.1, T7 MOI=0.1, and lambda MOI=0.5.

[0026] Figure 8 Figure 3 is a schematic diagram of plasmid pET28a-nsp8, which contains the nsp8 gene from the non-structural protein of the novel coronavirus.

[0027] Figure 9 Figure 4 is the result of shake flask fermentation of E. coli, E. coli-EPR under the condition of adding phage and no phage mixture. Shake flask fermentation was performed on three groups of six E. coli strains, MG1655, W3110 and MG1655(DE3). Chart a, chart b and chart c correspond to the results of E. coli strains MG1655, W3110 and MG1655(DE3), respectively. The fermentation product of the experimental group of MG1655 and W3110 was D-amino acid oxidase, and the fermentation product of MG1655(DE3) was the structural protein nsp8 of the novel coronavirus. The composition of the phage mixture was T1 MOI=10, JMPW2 MOI=10, T5 MOI=10, EEP MOI=10, T4 MOI=0.1, T7 MOI=0.1, and lambda MOI=0.5.

[0028] Figure 10 are the results of fermenter fermentation of E. coli, E. coli-EPR under the condition of adding bacteriophage and bacteriophage mixture, six strains of E. coli of three groups of MG1655, W3110 and MG1655(DE3) were fermented in fermenter. The fermentation products of MG1655 and W3110 experimental groups are D-amino acid oxidase, and the fermentation product of MG1655(DE3) is a novel coronavirus structural protein nsp8, the composition of the bacteriophage mixture is T1 MOI = 10, JMPW2 MOI = 10, T5 MOI = 10, EEP MOI = 10, T4 MOI = 0.1, T7 MOI = 0.1, lambda MOI = 0.5. DETAILED DESCRIPTION

[0029] The following examples are used to further illustrate the present application, but should not be construed as limiting the present application, any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application shall be equivalent replacement methods, and are included in the protection scope of the present application.

[0030] If not specifically indicated, the technical means used in the examples are the conventional means familiar to those skilled in the art.

[0031] Example 1: Construction of plasmid pWHU3640 containing anti-bacteriophage gene cluster

[0032] The DNA phosphosulfoylation restriction-modification system derived from E. coli 3234 / A is composed of sspBCD-sspE gene cluster, wherein the sspBCD gene cluster has the function of phosphosulfoylation modification to DNA, and the sspE gene downstream of sspBCD separately exercises the restriction cutting function of nuclease.

[0033] A fragment of about 8.0 kb is obtained by PCR amplification using the genomic DNA of E. coli 3234 / A as a template and 5'-CGAGGTCGACGGTATCGATAAGCTTCGTTACTGATATGCGTAAATCCTTC-3' and 5'-CGGCCGCTCTAGAACTAGTGGATCCTTTCCTCATACGAAGCTCTATTAA-3' as primers, and the fragment is connected with the linearized vector fragment of pBluescript II SK(+) digested by BamH I and Hind III by Gibson assembly, to obtain a recombinant plasmid pWHU3640( Figure 1 ) containing the sspBCD-sspE gene cluster derived from E. coli 3234 / A.

[0034] Example 2: Plasmid pWHU3640 containing phage resistance gene cluster confers broad-spectrum phage resistance to multiple bacterial hosts

[0035] The plasmid pWHU3640 was introduced into E. coli MG1655, W3110, BW25113, JM109, MG1655(DE3), OP50 and W host bacteria, respectively, and E. coli(pWHU3640) strains were obtained by ampicillin resistance screening. The blank control plasmid pBlueScript II SK(+) was introduced into MG1655, W3110, BW25113, JM109, MG1655(DE3), OP50 and W host bacteria, respectively, and E. coli(empty vector) control strains were obtained by ampicillin resistance screening. The correct E. coli(pWHU3640) and E. coli(empty vector) clones were picked and placed in 10 mL centrifuge tubes containing 1 mL of LB medium containing ampicillin, and incubated overnight in a 28°C shaker. The next day, the volume was expanded to 50 mL centrifuge tubes containing 5 mL of LB medium at a volume ratio of 1:100, and incubated in a 28°C shaker until the OD600 value was 0.8. 400 μL of bacterial solution was mixed with 10 mL of pre-heated and melted 1 / 2 LA solid medium, and plated on a double-layer plate to prepare a double-layer plate. Both the lower LA base plate and the upper 1 / 2 LA top plate required the addition of a certain proportion of ampicillin antibiotic. At the same time, all the phages required for enrichment culture were pre-enriched, and the freshly purified phage stock was gradient diluted in 10-fold increments. A total of 8 gradients were diluted. Then the uniformly diluted phage diluent was added to the double-layer plate in order of concentration from low to high, and each phage diluent was added to the same row. After all the phages were added, the plate was blown dry in a clean bench, and then placed upside down in a 37°C incubator overnight. The next day, the phage infection in the E. coli(pWHU3640) and E. coli(empty vector) double-layer plates was observed. The results are shown in Figure 2 Figure 2. Compared with the E. coli recombinant bacteria containing the blank control plasmid (E. coli(empty vector), all E. coli recombinant bacteria containing the complete sspBCDE phosphorothioacyl modification system (E. coli(pWHU3640)), had moderate resistance to phages T1, JMPW2, T4, EEP and lambda.

[0036] Example 3: Genomic integration of phage resistance gene cluster in bacterial engineering bacteria

[0037] The 5.4 kb sspBCD gene cluster fragment was amplified by PCR using the genomic DNA of E. coli 3234 / A as the template and 5'-CTGGCGCAGTTGATATGTCAAACAGGTGTCGACGGTATCGATAAGCT-3' and 5'- AACAGCATCAATAATCAACGCGATATAATAAGGATCCCCATGCTTGGTTGA-3' as primers; then the left homologous arm sequence of the genomic integration site with a length of 640 bp was amplified using the genomic DNA of E. coli MG1655 as the template and 5'-TGCTTTCGCACCTGGGATCCGCTTGGTTGAGAATACGCCGAAGTT-3' and 5'- AGCTTATCGATACCGTCGACACCTGTTTGACATATCAACTGCGCCAGAGGTAGGATTGAAAACG-3' as primers; the right homologous arm sequence of the genomic integration site with a length of 565 bp was amplified using 5'-CAACCAAGCATGGGGATCCTTATTATATCGCGTTGATTATTGATGCTGTT-3' and 5'- CGCGCCATTCTCCGGTCGACCGACGGTTTGATGTTAACGTTGC-3' as primers, then the left and right homologous arm fragments and the sspBCD gene cluster fragment and the pKOV linearized vector fragment digested with BamH I and Sal I were connected by Gibson assembly, and the successfully recombined plasmid was named pWHU6401 Figure 3 ), which is a plasmid for integrating the sspBCD gene cluster into the intergenic region between aslA and glmZ in the genome of the E. coli host strain. Subsequently, the plasmid pWHU6401 was transformed into the E. coli MG1655, W3110 and MG1655(DE3) engineering strains, respectively, and the mutant strains with successful integration of the sspBCD gene cluster into the genome were finally obtained by two-step homologous recombination double exchange, i.e., MG1655 int(aslA-glmZ)::sspBCD, W3110 int(aslA-glmZ)::sspBCD and MG1655(DE3) int(aslA-glmZ)::sspBCD. After the mutant strains were subjected to genome sequencing verification, the correct sspBCD gene cluster integration mutant strains were preserved.

[0038] Then, the sspE restriction gene was knocked in based on the sspBCD genomic integration strain. A 3.4 kb fragment containing the left homologous arm and sspE restriction gene was amplified by PCR using plasmid pWHU3640 as the template and primers 5'-GGTGGCAAAGATAGCGCAGCCTTAG-3' and 5'-GGTCGACGGATCCCCGGAATGAAGAAGCAGCATAGCGTTTCGTAG-3'. A 810 bp right homologous arm fragment was amplified by PCR using the genomic DNA of E. coli MG1655 as the template and primers 5'-CGAAGCAGCTCCAGCCTACATTATTATATCGCGTTGATTATTGATGC-3' and 5'-CCTACTGCTGCCGATTCCTC-3'. A 1.4 kb kanamycin resistance gene sequence with a FRT site at each end was amplified by PCR using plasmid pKD13 as the template and primers 5'-CTACGAAACGCTATGCTGCTTCTTCATTCCGGGGATCCGTCGACCT-3' and 5'-GCATCAATAATCAACGCGATATAATAATGTAGGCTGGAGCTGCTTCG-3'. The three PCR fragments were fused into one complete fragment by overlap PCR, and the PCR product was sequenced. Then, the pKD46 plasmid was transformed into the sspBCD genomic integration strain, and electrocompetent cells were prepared. The homologous recombination template of the three PCR fragments fused together was introduced into the electrocompetent cells by electroporation, and after one-step homologous recombination, the mutant strain with successful integration of the sspE restriction gene was screened by colony PCR. Finally, the plasmid pCP20 was introduced into the mutant strain with successful integration of the sspE restriction gene, and the expression of the FLP recombinase was induced to cut the FRT site and lose the kanamycin resistance gene, and finally the homozygous mutant strain with successful integration of the sspBCDE gene cluster and without the kanamycin resistance gene was obtained, i.e., MG1655 int(aslA-glmZ)::sspBCDE, W3110 int(aslA-glmZ)::sspBCDE, and MG1655(DE3) int(aslA-glmZ)::sspBCDE.After further genome sequencing verification of the mutant strains, the correct sspBCDE gene cluster integration mutant strains were named as MG1655-PT (i.e. MG1655 int(aslA-glmZ)::sspBCDE), W3110-PT (i.e. W3110 int(aslA-glmZ)::sspBCDE) and MG1655(DE3)-PT (i.e. MG1655(DE3) int(aslA-glmZ)::sspBCDE).

[0039] Example 4: Modification of phage receptor site genes and key genes of phage life cycle on the basis of genome integration of anti-phage gene cluster

[0040] On the basis of genome integration of sspBCDE gene cluster, the eighth loop structure of the fhuA protein domain of the T5 phage receptor binding site was precisely deleted, and the T7 phage DNA polymerase key gene trxA was deleted in frame.

[0041] First, the fhuA gene was precisely deleted and modified. The left homologous arm fragment with a length of 761 bp was amplified by PCR using the genomic DNA of E. coli MG1655 as the template and 5'-CACTATGACCTGCTTTCGCACCTGGGATCCGAAAACAAAACCTCGCAAAACAG-3' and 5'-ACGCCGCCTTCAGAGTTATACACGGCACCAGTAACTACAAT-3' as primers. At the same time, the right homologous arm fragment with a length of 762 bp was amplified by PCR using 5'-TGTATAACTCTGAAGGCGGCGTAGAAATCGAAGCGAAAGC-3' and 5'-TACAGGGCGCGCGCCATTCTCCGGTCGACCAGCGGTTGGGCATCAAGAAGAA-3' as primers. Through Gibson assembly, the linearized vector fragment digested by BamH I and Sal I was connected to construct the successful recombinant plasmid, which was named pWHU6402 Figure 4). This recombinant plasmid is the knock-out plasmid for the eighth circular site precise deletion of the fhuA gene of the E. coli-PT strain. Then the plasmid pWHU6402 is transformed into the MG1655-PT, W3110-PT, and MG1655(DE3)-PT strains, respectively, and the final mutant strain with fhuA site precise deletion is screened by two-step homologous recombination double exchange, i.e., MG1655 int(aslA-glmZ)::sspBCDE fhuA(Δ552-558NSEG), W3110 int(aslA-glmZ)::sspBCDE fhuA(Δ552-558NSEG), and MG1655(DE3) int(aslA-glmZ)::sspBCDE fhuA(Δ552-558NSEG). After the mutant strain is verified by genome sequencing, the correct modified mutant strain is preserved.

[0042] Then the trxA gene is modified by in-frame deletion. The left homologous arm fragment with a length of 786 bp is obtained by PCR amplification using the genomic DNA of E. coli MG1655 as a template and 5'-CACTATGACCTGCTTTCGCACCTGGGATCCTGGCGGAGAACAGCATGTTGAGG-3' and 5'-CGAACATGAAATTCCCTTACGCCAGCATATATAACTCCACAGGAATAAGCCTGGCGTGT-3' as primers; at the same time, the right homologous arm fragment with a length of 616 bp is obtained by PCR amplification using 5'-ACACGCCAGGCTTATTCCTGTGGAGTTATATATGCTGGCGTAAGGGAATTTCATGTTCG-3' and 5'-TACAGGGCGCGCGCCATTCTCCGGTCGACAGGTAGGAGCTGTCTGCGGAACG-3' as primers, and then the left and right homologous arm fragments are connected with the BamH I and Sal I double-digested pKOV linearized vector fragment by Gibson assembly. After the successfully constructed recombinant plasmid is verified by enzyme digestion and sequencing, it is named as pWHU6403 Figure 5). This recombinant plasmid is the knock-out plasmid for trxA site in-frame deletion of the genome of E. coli int(aslA-glmZ)::sspBCDE fhuA(A552-558NSEG) strain. Then this plasmid pWHU6403 was transformed into MG1655 int(aslA-glmZ)::sspBCDE fhuA(A552-558NSEG), W3110 int(aslA-glmZ)::sspBCDE fhuA(A552-558NSEG) and MG1655(DE3) int(aslA-glmZ)::sspBCDE fhuA(A552-558NSEG) strains, respectively, and selected by two-step homologous recombination double exchange. Finally, the mutant strains MG1655 int(aslA-glmZ)::sspBCDE fhuA(A552-558NSEG) AtrxA, W3110 int(aslA-glmZ)::sspBCDE fhuA(A552-558NSEG) AtrxA and MG1655(DE3) int(aslA-glmZ)::sspBCDE fhuA(A552-558NSEG) AtrxA with trxA site in-frame deletion were obtained. After further genome sequencing verification of the mutant strains, the correct modified mutant strains were named as MG1655-EPR (i.e. MG1655 int(aslA-glmZ)::sspBCDE fhuA(A552-558NSEG) AtrxA), W3110-EPR (i.e. W3110 int(aslA-glmZ)::sspBCDE fhuA(A552-558NSEG) AtrxA) and MG1655(DE3)-EPR (i.e. MG1655(DE3) int(aslA-glmZ)::sspBCDE fhuA(A552-558NSEG) AtrxA).

[0043] Example 5: Systematic genome modification confers strong phage resistance effect to engineered bacterial strains

[0044] Nine strains of E. coli MG1655 (wild type, WT), MG1655-PT, MG1655-EPR; E. coli W3110 (wild type, WT), W3110-PT, W3110-EPR; E. coli MG1655(DE3) (wild type, WT), MG1655(DE3)-PT, MG1655(DE3)-EPR were inoculated into 10 mL centrifuge tubes with 1 mL LB medium, and incubated in a 28°C shaker overnight. Next day, the culture was expanded into 50 mL centrifuge tubes with 5 mL LB medium at a ratio of 1:100, and incubated in a 28°C shaker until the OD600 value reached 0.8. 400 μL of the culture was mixed with 10 mL of 1 / 2 LA solid medium pre-heated and melted, and quickly spread on the lower LA bottom plate to prepare a double-layer plate. The lower LA bottom plate and the upper 1 / 2 LA top plate did not need to add any antibiotics at this time. Meanwhile, all the phages needed for the test were pre-enriched, and the freshly purified phage stock was gradient diluted in turn according to a 10-fold gradient, a total of 8 gradients. Then the uniformly diluted phage diluent was added in turn on the double-layer plate according to the order of concentration from low to high, and the diluent of each phage was added in the same row. After all the phages were added, the plate was blown dry in a clean bench, and then placed upside down in a 37°C incubator overnight.

[0045] The next day, the phage infection in the nine strains was observed. The results are shown in Table 1. Figure 6 As compared with the wild type parent strain, the integration of the restriction modification system conferred on the three strains of E. coli MG1655-PT, W3110-PT, and MG1655(DE3)-PT a resistance effect of about 10 4 -10 6 to the five strains of phages T1, JMPW2, T4, EEP, and lambda, and a resistance effect of about 10 1 -10 2 to the T7 phage, and almost no resistance effect to the T5 phage. On the basis of the integration of the restriction modification system, the modification of the genes at the fhuA and trxA sites was continued, and the three strains of E. coli MG1655-EPR, W3110-EPR, and MG1655(DE3)-EPR finally obtained showed strong resistance effect to all the phages tested.

[0046] Example 6: Detection of the growth phenotype of the three strains of phage-resistant strains after systematic genome modification under the condition of shake flask culture

[0047] The E. coli MG1655 (wild type, WT), MG1655-EPR; E. coli W3110 (wild type, WT), W3110-EPR; E. coli MG1655(DE3) (wild type, WT), MG1655(DE3)-EPR were inoculated into 10 mL centrifuge tubes with 2 mL LB medium, and incubated at 28°C overnight. The next day, the culture was expanded into 250 mL conical flasks with 50 mL LB medium at a ratio of 1:100, and incubated at 37°C until the OD600 value reached 0.6. Then the culture was continuously shaken at 37°C, and the OD600 value of the culture was measured every 2 hours. The growth curve was plotted with time as the horizontal axis and the OD600 value of the culture as the vertical axis. Meanwhile, another set of shake flask culture experiments was designed, in which the E. coli MG1655, MG1655-EPR; E. coli W3110, W3110-EPR; E. coli MG1655(DE3), MG1655(DE3)-EPR were expanded twice in 250 mL conical flasks with 50 mL LB medium, and when the OD600 value reached 0.6, the phage mixture (the composition of the phage mixture: T1, JMPW2, T5 and EEP with MOI = 10; T4 and T7 phages with MOI = 0.1 and lambda phage with MOI = 0.5) was added, and the culture was continuously shaken at 37°C, and the OD600 value of the culture was measured every 2 hours. The growth curve was plotted with time as the horizontal axis and the OD600 value of the culture as the vertical axis. As shown in Figure 7 the modified strains have the same growth phenotype as the wild type parent strains, which indicates that this systematic modification strategy does not affect the growth and normal physiological function phenotype of the host strain; on this basis, the addition of phage mixture does not affect the growth phenotype of the modified phage-resistant strains, which indicates that the modified phage-resistant strains have very strong resistance to phage and can resist all the tested phages under the conditions of shake flask fermentation.

[0048] Example 7: Shake flask fermentation of genome-modified phage-resistant strains under phage contamination

[0049] Subsequently, we applied the three engineered bacteriophage-resistant strains to the shake flask process of fermentation products to identify whether the three resistant strains could resist bacteriophage contamination while maintaining the yield of fermentation products. First, we selected D-amino acid oxidase (DAAO) as the shake flask production product of the two strains of E. coli MG1655 and W3110. Therefore, the plasmid pGEMKT-DAAO (the construction of pGEMKT-DAAO is described in the literature Liu et al. High soluble expression of D-amino acid oxidase in Escherichia coli regulated by a native promoter. Appl Biochem Biotechnol 158, 313-322 (2009)) capable of expressing D-amino acid oxidase was introduced into the wild-type E. coli MG1655, W3110 and the engineered MG1655-EPR, W3110-EPR strains, respectively. At the same time, the non-structural protein nsp8 of the novel coronavirus was used as a heterologous expression product of the host strain MG1655(DE3), and therefore the heterologous expression plasmid pET28a-nsp8 of nsp8 was introduced into the wild-type E. coli MG1655(DE3) and the engineered MG1655(DE3)-EPR strain to perform the corresponding shake flask culture. For the wild-type parent strain experimental group and the engineered bacteriophage-resistant mutant strain experimental group, we designed two experimental conditions of adding bacteriophage mixture and not adding bacteriophage mixture, and three parallel repeats were designed for each experimental group. During the shake flask culture process, all experimental operations and experimental conditions were kept consistent.

[0050] In this example, the construction of the heterologous expression plasmid pET28a-nsp8 of nsp8 is as follows: according to the gene sequence information of the non-structural protein nsp8 of the novel coronavirus (SARS-CoV-2 / WHU02 (MN988669.1)) in the NCBI database, a 609 bp long gene fragment of the non-structural protein nsp8 of the novel coronavirus was synthesized, and the synthesized fragment was ligated with the Nde I and Xho I double-digested pET28a linearized vector fragment by enzyme ligation method to obtain the recombinant plasmid pET28a-nsp8 Figure 8 ), which is a heterologous expression plasmid of the non-structural protein nsp8 of the novel coronavirus.

[0051] For the shake flask experiment of D-amino acid oxidase, the following steps were taken: fresh E. coli MG1655 (pGEMKT-DAAO), MG1655-EPR (pGEMKT-DAAO), E. coli W3110 (pGEMKT-DAAO), and W3110-EPR (pGEMKT-DAAO) transformants were inoculated in 2L shake flasks containing 1L LB medium at a volume ratio of 1:100, and then cultured at 37°C for about 1-2 hours. When the OD value of the bacterial solution reached 0.6, phage mixture (the composition of the phage mixture was: T1, JMPW2, T5, and EEP with MOI = 10; T4 and T7 phages with MOI = 0.1, and lambda phage with MOI = 0.5) was added, or the same volume of SM buffer was added as a blank control. Then the experimental group and the control group were cultured in the presence and absence of phage mixture, respectively. The entire culture process lasted for 12 hours, and the OD value of the bacterial solution and the enzyme activity of the product DAAO were measured at 12 hours.

[0052] For the process of heterologous expression and production of novel coronavirus nsp8 protein in MG1655 (DE3) and modified MG1655 (DE3)-EPR, the following steps were taken: fresh E. coli MG1655 (DE3) (pET28a-nsp8), MG1655 (DE3)-EPR (pET28a-nsp8) transformants were inoculated in 2L shake flasks containing 1L LB medium at a volume ratio of 1:100, and then cultured at 37°C for about 1-2 hours. When the OD value of the bacterial solution reached 0.6, phage mixture (the composition of the phage mixture was: T1, JMPW2, T5, and EEP with MOI = 10; T4 and T7 phages with MOI = 0.1, and lambda phage with MOI = 0.5) was added, or the same volume of SM buffer was added as a blank control. The culture temperature was adjusted to 28°C, and IPTG was added to a final concentration of 1mM to induce the expression of heterologously expressed protein nsp8. The entire fermentation process lasted for 16 hours, and the OD value of the bacterial solution and the protein expression amount of heterologously expressed protein nsp8 were measured at 16 hours.

[0053] The results are as follows: Figure 9As shown, three groups of wild type parent strains were lysed directly by the addition of phage mixture due to no resistance effect, thus the OD values were far lower than the modified resistant strains, and the production level of product was also far lower than the experimental group without the addition of phage mixture. On the contrary, three groups of modified anti-phage mutant strains maintained the same growth phenotype and the same production level of product as the wild type parent strains (without the addition of phage mixture) whether or not the phage mixture was added, which indicated that the three modified anti-phage engineering bacteria could resist the invasion of phage mixture, and at the same time maintained the normal production performance of metabolic product.

[0054] Example 8: Application of systemically modified phage-resistant strains in fermentation tank fermentation process

[0055] On the basis of 2L shake flask culture, we further expanded the scale of fermentation production, and carried out corresponding fermentation production in a 5L fermentation tank, and further detected the fermentation production performance of the modified mutant strains under the condition of high-density culture. Consistent with the experimental group of shake flask culture design, we designed three experimental groups of engineering bacteria wild type parent strains and modified mutant strains to carry out fermentation production with or without the addition of phage mixture, and the products fermented and produced by the three groups of engineering bacteria were consistent with the previous ones.

[0056] For the fermentation tank production experiment of D-amino acid oxidase, the specific operation was as follows: fresh E. coli MG1655 (pGEMKT-DAAO), MG1655-EPR (pGEMKT-DAAO); E. coli W3110 (pGEMKT-DAAO), W3110-EPR (pGEMKT-DAAO) transformants were cultured overnight at 37°C, and the next day the culture scale was expanded to 100 mL total bacteria, then inoculated into a 5L fermentation tank containing 1.9L LB medium. For DAAO fermentation (host bacteria were MG1655 experimental group and W3110 experimental group), the temperature was controlled at 37°C during the whole fermentation process, and phage mixture or the same volume of SM buffer as a blank control was added at the beginning of the fermentation stage, and the whole fermentation culture process lasted for 48 hours. During this period, the OD value, dissolved oxygen value and enzyme activity of the fermentation product in the fermentation broth were measured and analyzed every two hours, and according to the time distribution, the kinetic curves of cell growth trend, dissolved oxygen curve and enzyme activity of fermentation product were drawn.

[0057] For fermentation of nsp8 (host strain is MG1655(DE3) experimental group), the initial fermentation temperature was controlled at 37°C, and an appropriate amount of phage mixture or the same volume of SM buffer as a blank control was added at the beginning of fermentation. When the OD value reached 20, the culture temperature was adjusted to 28°C and 1 mM IPTG inducer was added to induce the expression of nsp8 protein. The whole fermentation process lasted for 48 hours, during which the OD value, dissolved oxygen value and the expression amount of heterologous protein in the fermentation broth were measured every two hours. According to the time distribution, the growth trend of cells, the dissolved oxygen curve and the expression amount of heterologous protein were plotted.

[0058] During the whole fermentation process, the initial culture medium was 1.9 L of LB medium (40 g of tryptone, 28 g of yeast extract and 20 g of sodium chloride), and then according to the change of pH during the culture process, nitrogen source feeding (40 g of tryptone and 20 g of yeast extract were dissolved in 500 mL of water) or carbon source feeding (200 g of glycerol was dissolved in 500 mL of water) was carried out, and the pH value of the fermentation broth was automatically adjusted and controlled at about 7.5 by the fermentation system using 1 M hydrochloric acid and 5 M sodium hydroxide. The air inlet amount during fermentation was 4 L / min, and the stirring speed was 400-600 rpm. As shown in Figure 10 The results of fermentation in the fermenter and the results of shake flask fermentation were consistent, and the three strains of modified mutant strains could maintain consistent growth phenotype and fermentation production performance with the wild type parent strain whether the phage mixture was added or not. The wild type parent strain had no resistance to phage infection and immediately showed a collapsed growth trend and almost no fermentation product output after being contaminated by phage. This shows that under the conditions of fermentation production in the fermenter, the genome modified anti-phage engineering strain can resist phage contamination while maintaining consistent growth and fermentation production performance with the wild type parent strain.

Claims

1. A method for modifying bacteria to resist bacteriophages, characterized in that: The method involves transforming a set of restriction-modification system genes into a host through a vector to enable the host to express the genes, or integrating a set of restriction-modification system genes into the host's genome to enable the host to express the genes; simultaneously, knocking out and modifying the host's phage receptor site genes and phage life cycle genes; The restriction-modification system is a DNA phosphorus thioylation restriction-modification system, which is composed of... sspBCD-sspE Gene cluster composition; The phage receptor site gene is fhuA The phage life cycle gene is... trxA Gene.

2. The method for modifying bacteria to resist bacteriophages according to claim 1, characterized in that: The host mentioned is Escherichia coli.

3. The bacterial phage-resistant modification method according to claim 2, characterized in that: The Escherichia coli strains mentioned include MG1655, W3110, BW25113, JM109, MG1655(DE3), OP50, and W.

4. The method for modifying bacteria to resist bacteriophages according to claim 1, characterized in that: The location where the gene integrates into the host genome is on the genome of the Escherichia coli host bacterium. aslA and glmZ The intergenic region between two genes.

5. The application of the bacterial antiphage modification method according to any one of claims 1-4 in the construction of antiphage engineered strains.

6. A phage-resistant engineered strain, characterized in that: It is obtained by the bacterial antiphage modification method according to any one of claims 1-4.

7. The bacterial phage-resistant modification method according to any one of claims 1-4 or the application of the phage-resistant engineered strain according to claim 6, characterized in that: Application of engineered bacteria in resisting bacteriophage contamination during fermentation.