A detection system of miRNA or piRNA, and a kit comprising the same and application thereof

Abstract

The application discloses a miRNA or piRNA detection system, a kit comprising the same and application thereof, and relates to the technical field of biology. The miRNA or piRNA detection system comprises a nucleic acid probe A, a nucleic acid probe B, a hairpin probe A, and a connecting hairpin, wherein the connecting hairpin comprises a hairpin probe B for miRNA or a hairpin probe C for piRNA. The system does not need chemical modification and can be directly applied to nucleic acid detection in biological samples containing high-activity nucleic acid enzymes, including quantitative determination of trace nucleic acids in blood sample exosomes. By combining the detection system and a n-butanol dehydration reaction program, the detection limit of miRNA and piRNA is 10 ‑18 M in 30 minutes.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a miRNA or piRNA detection system, a kit comprising the same and application thereof. BACKGROUND

[0002] DNAzyme is a catalytically active artificially synthesized single-stranded DNA molecule, which can catalyze a wide range of chemical reactions, including RNA or DNA cleavage and ligation, protein modification, and deglycosylation cleavage, etc. At present, many studies are devoted to the application of DNAzyme in the development of biosensors, nanotechnology, diagnosis and treatment.

[0003] Split DNAzyme is a single-stranded DNA enzyme that is split into two oligonucleotide chains at a suitable position, and a segment of oligonucleotide sequence is added to each of the two split enzyme chains as a helper sequence, which can assemble into a complete active DNAzyme core in the presence of a linking molecule to produce catalytic activity. The selection of the split site has a great influence on the detection sensitivity of the split DNAzyme. Due to the unique structure of the split DNAzyme, it is often designed as a multifunctional biosensor, but its detection sensitivity is low, the detection limit of nucleic acid is in the μM-nM level, the reaction time is long, usually several hours, and it is easily degraded by nucleases. Most of the split DNAzyme sensors are designed based on 10-23 DNAzyme or 8-17 DNAzyme which depends on divalent metal ions Mn 2+ , Zn 2+ , etc. co-factor, when detecting biological samples containing high-activity nucleases (such as blood samples), the DNA substrate chain is easily degraded by DNA hydrolase, producing false positive signals, or the split enzyme chain of DNAzyme is degraded by nucleases and loses catalytic activity. In related technologies, some chemical modifications are often selected to enhance the resistance of DNAzyme to nuclease degradation, but these modifications may reduce the catalytic activity of the enzyme, or increase the toxicity, also complicate the synthesis of DNAzyme, and increase the cost.

[0004] Therefore, it is very important to design a simple, economical, efficient, high-sensitivity, nuclease-resistant split DNAzyme system to realize the analysis of trace amounts of nucleic acids in biological samples. SUMMARY

[0005] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application provides a miRNA or piRNA detection system with high sensitivity and low detection limit.

[0006] The present application also provides a kit.

[0007] The application also provides a method for qualitatively and / or quantitatively detecting miRNA or piRNA for non-disease diagnosis.

[0008] The application also provides application of the detection system or kit.

[0009] The detection system of miRNA according to the first aspect of the embodiments of the application comprises: a nucleic acid probe A, a nucleic acid probe B, a hairpin probe A, and a hairpin probe B.

[0010] The nucleic acid probe A comprises, in sequence from 5' to 3', a first enzyme sequence and a 3* sequence.

[0011] The nucleic acid probe B comprises, in sequence from 5' to 3', a 4* sequence and a second enzyme sequence.

[0012] The nucleotide sequences of the first enzyme sequence and the second enzyme sequence are respectively shown in SEQ ID NO. 1, positions 1-16; SEQ ID NO. 2, positions 13-56; or respectively shown in SEQ ID NO. 3, positions 1-13; SEQ ID NO. 4, positions 13-59; or respectively shown in SEQ ID NO. 5, positions 1-45; SEQ ID NO. 6, positions 13-27; or respectively shown in SEQ ID NO. 7, positions 1-22; SEQ ID NO. 8, positions 13-50.

[0013] The nucleotide sequence of the hairpin probe A comprises, in sequence from 5' to 3', a 0 sequence, a 1 sequence, a cleavage site rA, a 2 sequence, and a 0* sequence.

[0014] The 1 sequence is complementary to the 3' overhang of the nucleic acid probe B, and the 2 sequence is complementary to the 5' overhang of the nucleic acid probe A; the 0 sequence is complementary to the 0* sequence.

[0015] The hairpin probe A is modified with a fluorescent group and a quencher group at two ends thereof.

[0016] The hairpin probe B comprises, in sequence from 5' to 3', a 3 sequence, a 4 sequence, a 5 sequence, and a 6 sequence.

[0017] The 3 sequence is complementary to the 3* sequence of the nucleic acid probe A; the 4 sequence is complementary to the 4* sequence of the nucleic acid probe B; the 5 sequence is complementary to the target miRNA; and the 6 sequence is complementary to the 3' end of the 4 sequence.

[0018] In the presence of the target miRNA, the nucleic acid probe A, the nucleic acid probe B, and the hairpin probe B can self-assemble to form a complex having enzyme activity, which binds and cuts the hairpin probe A under the action of Na + .

[0019] According to some embodiments of the present invention, the nucleotide sequence of the nucleic acid probe A is shown as SEQ ID NO.9.

[0020] According to some embodiments of the present invention, the nucleotide sequence of the nucleic acid probe B is shown as SEQ ID NO.10.

[0021] According to some embodiments of the present invention, the nucleotide sequence of the hairpin probe A is shown as SEQ ID NO.11.

[0022] According to some embodiments of the present invention, the target miRNA is miR-21, and the nucleotide sequence of the hairpin probe B is shown as SEQ ID NO.12.

[0023] According to some embodiments of the present invention, the target miRNA is cel-miR-39, and the nucleotide sequence of the hairpin probe B is shown as SEQ ID NO.14.

[0024] According to some embodiments of the present invention, the length of the 3* sequence is 9 to 13 nt.

[0025] According to some embodiments of the present invention, the length of the 4* sequence is 10 to 14 nt.

[0026] According to some embodiments of the present invention, the length of the 0 sequence is 2 to 4 nt. The 3' overhang of the 0 sequence can also be complementary to the 3' overhang of the 2 sequence, preferably with the number of complementary bases being 1 to 3 nt.

[0027] According to some embodiments of the present invention, the length of the O* sequence is 2 to 4 nt. The 5' overhang of the O* sequence can also be complementary to the 5' overhang of the 1 sequence, preferably with a complementary base length of 1 to 3 nt.

[0028] Thus, the hairpin probe A can form a hairpin structure, reducing background effects.

[0029] According to some embodiments of the present invention, the length of the 1 sequence is 8 to 12 nt.

[0030] According to some embodiments of the present invention, the length of the 2 sequences is 8 to 10 nt.

[0031] According to some embodiments of the present invention, the length of the 3 sequence is 10 to 14 nt.

[0032] According to some embodiments of the present invention, the length of the 4 sequence is 9 to 13 nt.

[0033] According to some embodiments of the present invention, the length of the 6 sequence is 9 to 12 nt.

[0034] The detection system of the piRNA according to the second aspect of the embodiments of the present application comprises: a nucleic acid probe A, a nucleic acid probe B, a hairpin probe A, and a hairpin probe C.

[0035] The nucleic acid probe A comprises, in sequence from 5' to 3', a first enzyme sequence and a 3* sequence.

[0036] The nucleic acid probe B comprises, in sequence from 5' to 3', a 4* sequence and a second enzyme sequence.

[0037] The nucleotide sequences of the first enzyme sequence and the second enzyme sequence are respectively shown in SEQ ID NO. 1, positions 1-16; SEQ ID NO. 2, positions 13-56; or respectively shown in SEQ ID NO. 3, positions 1-13; SEQ ID NO. 4, positions 13-59; or respectively shown in SEQ ID NO. 5, positions 1-45; SEQ ID NO. 6, positions 13-27; or respectively shown in SEQ ID NO. 7, positions 1-22; SEQ ID NO. 8, positions 13-50.

[0038] The nucleotide sequence of the hairpin probe A comprises, in sequence from 5' to 3', a 0 sequence, a 1 sequence, a cleavage site rA, a 2 sequence, and a 0* sequence; the 0 sequence is complementary to the 0* sequence.

[0039] The 1 sequence is complementary to the 3' overhang end of the nucleic acid probe B, and the 2 sequence is complementary to the 5' overhang end of the nucleic acid probe A.

[0040] The hairpin probe A is modified with a fluorescent group and a quencher group at two ends thereof.

[0041] The hairpin probe C comprises, in sequence from 5' to 3', a 7 sequence, an 8 sequence, a 9 sequence, and a 10 sequence.

[0042] The 7 sequence is complementary to the 3* sequence of the nucleic acid probe A; the 8 sequence is complementary to the 4* sequence of the nucleic acid probe B; the 9 sequence is complementary to the target piRNA; and the 10 sequence is complementary to a sequence formed by the 3' end sequence of the 8 sequence and the 5' end sequence of the 9 sequence.

[0043] In the presence of the target piRNA, the nucleic acid probe A, the nucleic acid probe B, and the hairpin probe B can self-assemble to form a complex having enzyme activity, which binds and cuts the hairpin probe A under the action of Na + .

[0044] According to some embodiments of the present application, the length of the 3* sequence is 9-13 nt.

[0045] According to some embodiments of the present application, the length of the 4* sequence is 10-14 nt.

[0046] According to some embodiments of the present application, the length of the 0 sequence is 2-4 nt. The 3' overhang of the 0 sequence can also be complementary to the 3' overhang of the 2 sequence, preferably with 1-3 complementary bases.

[0047] According to some embodiments of the present application, the length of the 0* sequence is 2-4 nt. The 5' overhang of the 0* sequence can also be complementary to the 5' overhang of the 1 sequence, preferably with 1-3 complementary bases.

[0048] Thus, the hairpin probe A can form a hairpin structure, reducing background effects.

[0049] According to some embodiments of the present application, the length of the 7 sequence is 10-14 nt.

[0050] According to some embodiments of the present application, the length of the 8 sequence is 9-13 nt.

[0051] According to some embodiments of the present application, the length of the 9 sequence complementary to the 10 sequence at the 5' end is 1-3 nt.

[0052] According to some embodiments of the present application, the length of the 10 sequence is 9-12 nt.

[0053] According to some embodiments of the present application, the 3' overhang of the 6 sequence can further comprise 1-3 nucleotide sequences complementary to the 3' overhang of the 3 sequence.

[0054] According to some embodiments of the present application, the nucleotide sequence of the nucleic acid probe A is as shown in SEQ ID NO. 9.

[0055] According to some embodiments of the present application, the nucleotide sequence of the nucleic acid probe B is as shown in SEQ ID NO. 10.

[0056] According to some embodiments of the present application, the nucleotide sequence of the hairpin probe A is as shown in SEQ ID NO. 11.

[0057] According to some embodiments of the present application, the target piRNA is piR-20365, and the nucleotide sequence of the hairpin probe C is as shown in SEQ ID NO. 13.

[0058] The kit according to the third aspect of the embodiments of the present application comprises the detection system according to the first aspect or the second aspect of the embodiments of the present application.

[0059] According to some embodiments of the present invention, the kit is used for disease screening, auxiliary diagnosis, therapeutic efficacy assessment, and recurrence and metastasis monitoring. The disease uses at least one of miRNA and piRNA as a biomarker, including but not limited to breast cancer.

[0060] According to some embodiments of the present invention, the kit further comprises at least one of n-butanol, a reaction reagent, and a divalent metal chelating agent;

[0061] The reaction reagent includes Na + .

[0062] According to some embodiments of the present invention, the Na + The source is a non-alkaline, water-soluble compound containing monovalent sodium ions. The sodium ion source includes at least one of sodium chloride, sodium nitrate, sodium sulfate, sodium acetate and sodium lactate.

[0063] According to some embodiments of the present invention, the divalent metal chelator includes at least one of ethylenediaminetetraacetic acid (EDTA), 1,2-cyclohexanediaminetetraacetic acid (CDTA), [ethylenebis(oxyethylenenitrilo)]tetraacetic acid (EGTA) and 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (BAPT).

[0064] According to some embodiments of the present invention, the method for using the kit comprises the following steps:

[0065] The detection system is mixed with a sample to be detected and a reaction reagent to obtain a reaction system; the reaction system is mixed with 9 to 12 times the volume of n-butanol, and after the reaction, the miRNA or piRNA is qualitatively and / or quantitatively detected according to the fluorescence intensity.

[0066] According to some embodiments of the present invention, the nucleic acid probe A, nucleic acid probe B, and hairpin probe A in the detection system require denaturation pretreatment, wherein the denaturation pretreatment comprises treatment at 90° C. to 95° C. for 5 minutes.

[0067] According to some embodiments of the present invention, the amount of n-butanol added is 10 to 12 times the volume of the reaction system, for example, 10, 11 or 12 times the volume.

[0068] According to some embodiments of the present invention, the reaction temperature is 16° C. to 30° C., preferably 16° C. to 26° C., for example, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26° C.

[0069] According to some embodiments of the present invention, in the reaction system, Na +The concentration of the MgCl2 is 180 mM to 220 mM. For example, it can be 180, 185, 190, 195, 200, 205, 210, 215 or 220 mM. In this way, the enzyme cleavage activity can be ensured, the influence on the partition ratio of the two phases (aqueous phase and alcohol phase) can be reduced, and thus better sensitivity, linear range and detection limit can be obtained.

[0070] According to some embodiments of the application, the reaction time is 20 min to 60 min. For example, it can be 25, 30, 35, 40, 45, 50, 55 or 60 min.

[0071] According to some embodiments of the application, the reaction system further comprises the divalent metal chelator, and the concentration is 10 mM to 15 mM. For example, it can be 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5 or 15 mM.

[0072] According to some embodiments of the application, in the reaction system, the concentration of the nucleic acid probe A is 15 nM to 35 nM, and the concentration of the nucleic acid probe B is 15 nM to 35 nM. For example, it can be 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35 nM.

[0073] According to some embodiments of the application, in the reaction system, the content ratio of the nucleic acid probe A to the hairpin probe A is 1:1 to 2.5. For example, it can be 1:1, 1:1.5, 1:2 or 1:2.5.

[0074] According to some embodiments of the application, in the reaction system, the concentration of the hairpin probe B is 10 mM to 15 mM. For example, it can be 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5 or 15 mM.

[0075] According to some embodiments of the application, in the reaction system, the concentration of the hairpin probe C is 10 mM to 15 mM. For example, it can be 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5 or 15 mM.

[0076] According to some embodiments of the fourth aspect of the application, a method for qualitatively and / or quantitatively detecting miRNA or piRNA for non-disease diagnosis comprises the following steps: mixing the detection system with a sample to be detected, reaction reagents to obtain a reaction system; mixing the reaction system with 9 to 12 times the volume of n-butanol, and after reaction, qualitatively and / or quantitatively detecting miRNA or piRNA according to the fluorescence intensity.

[0077] The reaction reagents comprise Na+ .

[0078] According to some embodiments of the present application, the nucleic acid probe A, the nucleic acid probe B and the hairpin probe A in the detection system need to be denatured. The denaturation process includes treating at 85-95℃ for 3-5 min.

[0079] According to some embodiments of the present application, the amount of n-butanol added is 10-12 times the volume of the reaction system. For example, it can be 10, 11 or 12 times.

[0080] According to some embodiments of the present application, the temperature of the reaction is 16-30℃. Preferably, it is 16-26℃. For example, it can be 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26℃.

[0081] According to some embodiments of the present application, the concentration of Na + in the reaction system is 180-220 mM. For example, it can be 180, 185, 190, 195, 200, 205, 210, 215 or 220 mM.

[0082] According to some embodiments of the present application, the time of the reaction is 20-60 min. For example, it can be 25, 30, 35, 40, 45, 50, 55 or 60 min.

[0083] According to some embodiments of the present application, the reaction system further comprises a divalent metal chelator. Thus, when the sample to be detected is a blood sample, the divalent metal chelator can chelate the divalent metal ions, which are activators of DNase, to deactivate DNase, thereby avoiding degradation of the nucleic acid probe A, the nucleic acid probe B and the hairpin probe A. It can be understood that the blood sample includes at least one of blood, serum and plasma.

[0084] According to some embodiments of the present application, the divalent metal chelator comprises at least one of EDTA, CDTA, EGTA and BAPT.

[0085] According to some embodiments of the present application, the concentration of the divalent metal chelator in the reaction system is 10-15 mM. For example, it can be 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5 or 15 mM.

[0086] According to some embodiments of the present application, the concentration of the nucleic acid probe A in the reaction system is 15-35 nM, and the concentration of the nucleic acid probe B is 15-35 nM. For example, it can be 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35 nM.

[0087] According to some embodiments of the present application, the content ratio of the nucleic acid probe A to the hairpin probe A in the reaction system is 1:1-2.5. For example, it can be 1:1, 1:1.5, 1:2 or 1:2.5.

[0088] According to some embodiments of the present application, the concentration of the hairpin probe B in the reaction system is 15nM-35nM. For example, it can be 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35nM.

[0089] According to some embodiments of the present application, the concentration of the hairpin probe C in the reaction system is 15nM-35nM. For example, it can be 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 or 35nM.

[0090] The application of the above-mentioned detection system or kit according to the fifth aspect of the embodiments of the present application in the detection of nucleic acid for non-disease diagnosis.

[0091] The present application has at least the following beneficial effects:

[0092] 1. NaA43 enzyme is first selected as the basis for designing the split enzyme sensing system (named Na + BAS DNAzyme system), which can be directly applied to the detection of nucleic acid in biological samples containing high-activity nucleases, including the quantitative determination of trace nucleic acid in blood sample exosomes. The design of the initial hairpin probe H0 in the detection system makes the detection system universal, i.e. without changing the split enzyme DNA strand, substrate strand and reaction conditions, only the partial sequence of the initial hairpin probe needs to be changed to detect different miRNA and piRNA, which is conducive to the rapid and efficient design of sensing systems for detecting various biomarkers, and achieves the same level of amplification efficiency and detection sensitivity. Moreover, the system has low cost and simple use method.

[0093] The split enzyme-containing system has smaller background growth even under the acceleration of butanol; if it is a complete NaA43 enzyme, the background growth is large after acceleration by butanol, which will affect the detection sensitivity. Compared with the complete enzyme, the split enzyme combined with butanol for nucleic acid detection can not only improve the amplification efficiency and shorten the reaction time, but also further improve the sensitivity.

[0094] 2. The Na +The BAS DNAzyme system has high sensitivity for nucleic acid detection and short analysis time. The operation is simple, economical and practical. The butanol-water two-phase reaction system is first applied in the isothermal amplification reaction catalyzed by the split DNAzyme based on NaA43 enzyme. Through the simple but crucial butanol dehydration reaction program, the reaction time is greatly shortened, the amplification efficiency and reaction sensitivity are improved, and the detection of miRNA and piRNA 10 -18 The detection limit of M. In the related art, in order to achieve high sensitivity, the method for detecting nucleic acid by using DNAzyme usually needs to be cascaded with other isothermal amplification methods, such as rolling circle amplification, hybridization chain reaction, catalytic hairpin assembly, and the reaction time needs several hours. In the buffer system, the detection limits of miR-21 and piR-20365 are 12aM and 26aM respectively, and if the reaction time is extended to 1 hour, the detection limits of the two nucleic acids can be reduced to 2.8aM and 1.05aM respectively. When detecting the exosomes extracted from the supernatant of breast cancer cell MCF-7, miR-21 or piR-20365 is used as the detection target, the detection limit can reach 3.98 exosomes / μL or 2.69 exosomes / μL, and the detection limit of exosomes in the related art is more than 10 4 The Na + The BAS DNAzyme system can also measure the absolute content of miR-21 in MCF-10a or MCF-7 exosomes, which is 5.93x10 -3 copies / μL and 0.12 copies / μL. The Na + The BAS DNAzyme system can also be used for clinical diagnosis of breast cancer, with 100% diagnostic sensitivity and specificity. The Na + The method of the BAS DNAzyme system has the characteristics of high efficiency, universality, simple operation and ultra-high sensitivity, and has excellent potential for transformation into a liquid biopsy method for cancer diagnosis, and can be applied to cancer screening, auxiliary diagnosis, efficacy evaluation, recurrence and metastasis monitoring, etc.

[0095] Other features and advantages of the present application will be set forth in the following description, and in part will become apparent from the description, or can be learned by practice of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0096] Figure 1 is a split enzyme design schematic diagram of the system I, II, III and IV designed in an embodiment of the present application;

[0097] Figure 2The fluorescence spectrum results (A) and the signal to blank control group signal ratio results chart (B) of the system I, II, III, IV designed according to an embodiment of the present application for determining the target nucleic acid and detecting 10fM target nucleic acid;

[0098] Figure 3 The non-denaturing gel electrophoresis verification Na + The feasibility detection results of BAS DNAzyme for detecting miR-21 (A) and piR-20365 (B);

[0099] Figure 4 The principle diagram of the detection system of the present application;

[0100] Figure 5 The Na + The water phase-n-butanol volume ratio optimization results of the BAS DNAzyme detection system;

[0101] Figure 6 The Na + The Na + concentration optimization results of the BAS DNAzyme detection system;

[0102] Figure 7 The Na + The reaction temperature optimization results of the BAS DNAzyme detection system; wherein, A, B, C, D and E are the fluorescence spectra corresponding to each reaction temperature, and F is the relationship chart of the fluorescence spectrum peak signal to the logarithm of miR-21 concentration;

[0103] Figure 8 The Na + The enzyme and substrate reaction ratio optimization results of the BAS DNAzyme detection system;

[0104] Figure 9 The Na + The reaction time optimization results of the BAS DNAzyme detection system;

[0105] Figure 10 The Na + The specificity detection results of the BAS DNAzyme detection system;

[0106] Figure 11 The Na + The fluorescence spectrum and standard curve of the BAS DNAzyme detection system for miR-21;

[0107] Figure 12Na is an embodiment of the present application + Fluorescence spectrum and standard curve of BAS DNAzyme detection system for piR-20365

[0108] Figure 13 Na is an embodiment of the present application + Fluorescence spectrum and standard curve of BAS DNAzyme detection system for Cel-miR-39

[0109] Figure 14 Na is an embodiment of the present application + Results of BAS DNAzyme system for detecting miR-21 in MCF-7 and MCF-10a exosomes; wherein, A is a calibration curve for detecting MCF-7 exosomes and MCF-10a exosomes, B is Na + Results of BAS DNAzyme system for detecting absolute content of miR-21 in MCF-7 exosomes and MCF-10a exosomes and comparison chart of the results with equal content detection results of reverse transcription real-time fluorescence quantitative PCR (RT-qPCR);

[0110] Figure 15 Na is an embodiment of the present application + Results of BAS DNAzyme system for detecting piR-20365 in MCF-7 exosomes; wherein, A is a fluorescence spectrum, B is a calibration curve for detecting MCF-7 exosomes;

[0111] Figure 16 Na is an embodiment of the present application + Results of BAS DNAzyme system for detecting human plasma clinical samples for breast cancer diagnosis; wherein, A is a scatter plot of detection indexes being miR-21, piR-651 and Cel-miR-39; B is a receiver operating characteristic (ROC) curve of detection indexes being miR-21 and piR-20365; **** indicates P<0.0001, and NS indicates P>0.05. DETAILED DESCRIPTION

[0112] The concept and technical effects of the present application will be described below in combination with embodiments, so as to fully understand the purposes, features and effects of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0113] Unless otherwise noted, conventional conditions or manufacturer's recommendations were used in the examples. Unless otherwise noted, reagents or instruments used were conventional products available commercially.

[0114] In the description of the application, if there is described first, second, etc. is only for the purpose of distinguishing technical features, and can not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features or implicitly indicating the order of the indicated technical features.

[0115] In the description of the application, the terms "comprising" and "having" and any variations thereof are intended to cover non-exclusive inclusion, for example, a process, method, system, product or device comprising a series of steps or units does not have to be limited to those steps or units clearly listed, but can include other steps or units not clearly listed or inherent to these processes, methods, products or devices.

[0116] Unless otherwise specified, "about" in the present application means that the allowable error is within ± 2%.

[0117] Unless otherwise specified, "room temperature" in the present application refers to 25±5℃.

[0118] In the following examples, the formula of the buffer solution is: 90mM LiCl, 50mM Tris base, 1mM EDTA, pH=9.

[0119] The formula of 0.5×TBE is: 44.5mM Tris Base, 44.5mM boric acid, 1mM EDTA.

[0120] Na + Verification of the feasibility of the BAS DNAzyme system for detecting nucleic acids

[0121] (1) Selection of split site

[0122] The selection of the split site of the split enzyme affects the catalytic activity of the active center formed after the formation of the complete enzyme structure. The NaA43 enzyme was split at 4 split sites (positions are shown as Figure 1 The corresponding helper sequences (underlined) were added after the split, and four detection systems I, II, III, IV for detecting miR-373 as shown in Table 1 were constructed, and the feasibility of the four systems was verified.

[0123] Table 1

[0124]

[0125]

[0126] The test method is as follows:

[0127] After 83.5 μL of buffer solution containing 30 nM of split enzyme chain A, 30 nM of split enzyme chain B, and 60 nM of substrate chain of system I-system IV respectively were denatured at 90°C for 4 min, naturally cooled to room temperature and kept for 30 min, 200 mM NaCl was added to a final concentration, and the target nucleic acid to be detected (the concentration of miR-373 was 0, 10 fM, 100 fM, or 1 pM), and the buffer solution was supplemented with an appropriate amount to make the total volume of the solution 100 μL.

[0128] The nucleotide sequence of the substrate chain is FAM-CCAGGATCACGTAT / rA / GGAAGTACCGCCTGG-BHQ1 (SEQ ID NO. 11).

[0129] 1100 μL of n-butanol was added to each of the above reaction systems, and then quickly and uniformly vortexed for 10 s, followed by incubation at 18°C in the dark for 30 min. After the reaction was completed, the reaction was terminated in an ice water bath, 50 μL of ultrapure water was added, and the bottom aqueous phase was aspirated after uniform vortexing for 10 s. The ultrapure water was supplemented to 100 μL, and fluorescence determination was performed. The excitation wavelength was 480 nm, and the fluorescence spectrum in the range of 500 nm to 580 nm was determined. The group with a target nucleic acid concentration of 0 is referred to as the blank control group (Blank).

[0130] The detection performance of systems I, II, III, and IV on miR-21 is shown in Figure 2 .

[0131] The split enzyme systems designed by splitting at 4 split sites all produced quantitative responses to target nucleic acids after 30 min of reaction. And the fluorescence signals produced by 10 fM of target nucleic acids were all significantly higher than those of the blank control group.

[0132] The signal of the blank control group affects the detection limit. By comparing the signal-to-blank ratio of 10 fM of target nucleic acids in the four systems, the S / B value of system I is the highest (B figure of Figure 2 Therefore, after splitting the intact Na43A DNAzyme at the site of system I and adding a helper strand complementary to the starting hairpin and the starting hairpin H0, the oligonucleotide chains shown in Table 2 were designed to form the Na + -BAS DNAzyme system.

[0133] Table 2

[0134]

[0135] (2) The Na +The cleavage product after the BAS DNAzyme system reacts with the target nucleic acid (miR-21 or piR-20365). The detection method is as follows:

[0136] After 83.5 μL of the buffer solution containing 30 nM of the split enzyme chain A, 30 nM of the split enzyme chain B, and 60 nM of the substrate chain is denatured at 90°C for 4 min, naturally cooled to room temperature and kept for 30 min, 25 nM of H0, 200 mM of NaCl, and the target nucleic acid to be detected are added, and the buffer solution is appropriately supplemented to make the total volume of the solution 100 μL, thereby forming the detection system with the components and concentrations shown in Table 3.

[0137] To the miR-21 detection system (wherein the final concentration of miR-21 is 1 nM) or the piR-20365 detection system (wherein the final concentration of piR-20365 is 1 nM) as shown in Table 3, 1100 μL of n-butanol is added, and then quickly and uniformly vortexed for 10 s, and then incubated at 18°C in the dark for 30 min, and then placed in an ice water bath to terminate the reaction. 50 μL of ultrapure water is added, uniformly vortexed for 10 s, and then the bottom aqueous phase is aspirated, supplemented with ultrapure water to 10 μL, and then electrophoresis is performed. The electrophoresis liquid is 0.5×TBE, the electrophoresis voltage is 280 V, and the electrophoresis time is 30 min. The gel is stained with 10×4S GelRed and 1×SYBR Green II nucleic acid dye in 0.9% NaCl for 20 min, and then photographed with a multifunctional gel imaging instrument.

[0138] Table 3

[0139]

[0140] The detection results are shown in Table 4. Figure 3 Table 4 21 or H0 20365 , lane 5 is the blank control reaction system without the target nucleic acid, and lane 6 is the reaction system with the target nucleic acid.

[0141] A new band with the smallest molecular weight and very dark color appears in lane 6, and the color of the substrate chain band becomes very light compared with the substrate chain band of the blank control (lane 5), which indicates that a large amount of the substrate chain in the system containing the target nucleic acid has been cleaved to produce the short fragments of the cleaved substrate chain. As shown in Table 4. Figure 3 This proves that the Na + -BAS DNAzyme system can occur the expected DNAzyme assembly and substrate chain cleavage reaction in a short time of 30 min.

[0142] A Na +BAS DNAzyme system

[0143] The present application designs a nucleic acid detection system based on a split DNAzyme of NaA43 DNAzyme, comprising: a nucleic acid probe A, a nucleic acid probe B, a hairpin probe A, a hairpin probe B or C. Among them, the nucleic acid probe A and the nucleic acid probe B are respectively two split enzyme chains (split enzyme chain A and split enzyme chain B) based on NaA43 DNAzyme; the hairpin probe A is a substrate chain of NaA43 DNAzyme; the hairpin probe B or C is a connecting hairpin H0 (such as H0 21 (hairpin probe B) and H0 20365 (hairpin probe C)) for connecting with the nucleic acid probe A and the nucleic acid probe B to form an active complex with a complete NaA43 DNAzyme structure. The nucleotide sequences of each component are shown in Table 2.

[0144] Table 2

[0145]

[0146] Among them, the bold part of the split enzyme chain A is the 3* sequence, and the non-bold part is the first enzyme sequence;

[0147] The sequence of only the underlined part of the split enzyme chain B is the 4* sequence, and the non-only underlined part is the second enzyme sequence;

[0148] The bold and underlined part in the substrate chain is the 1 sequence, which is complementary to the bold and underlined part in the split enzyme chain B; the underlined and italic part in the substrate chain is the 2 sequence, which is complementary to the underlined and italic part in the split enzyme chain A; rA in the substrate chain is an adenine ribonucleotide, which is the cutting site of the substrate chain catalyzed by NaA43 DNAzyme; the gray background area at the 5' end of the substrate chain is the 0 sequence, and the gray background area at the 3' end is the 0* sequence, the 0 sequence and the 1 sequence at the 1st to 2nd bases of the 5' end form recombination sequence 1, and the 2 sequence at the 3' end and the 0* sequence form recombination sequence 2, the recombination sequence 1 and the recombination sequence 2 are complementary to each other, forming a hairpin stem part.

[0149] The only bold part in H0 21 is the 3 sequence, which is the complementary sequence of the 3* sequence of the split enzyme chain A; the underlined part in H0 21 is the 4 sequence, which is the complementary sequence of the 4* sequence in the split enzyme chain B; the bold and italic part in H0 21 is the 5 sequence, which is the complementary sequence of the miRNA to be detected; the gray background area at the 3' end of H0 21 is the 6 sequence, which is complementary to the 3' end sequence of the 4 sequence, forming a hairpin stem part;

[0150] H0 20365 The only bold part in H0 20365 is 7 sequence, which is the complement of 3* sequence of Split A; the underlined part in H0 20365 is 8 sequence, which is the complement of 4* sequence of Split B; the bold italic part in H0 20365 is 9 sequence, which is the complement of piRNA to be detected; the gray background area at the 3' end of H0

[0151] It should be noted that for detection of different miRNAs, only the 5 sequence in H0 21 is replaced by the complement of the miRNA to be detected, or after the replacement, 1-3 nucleotides (which can be A, AT or ATA) are added at the 3' end of the 6 sequence in H0 21 to form a hairpin stem containing 10-12 complementary nucleotides;

[0152] For detection of different piRNAs, only the 9 sequence in H0 20365 is replaced by the complement of the piRNA to be detected, and the 1st-3rd nucleotides at the 5' end of the 10 sequence in H0 20365 are adjusted to the sequence of the 3rd-1st nucleotides at the 3' end of the piRNA to be detected.

[0153] The detection principle of the detection system is shown in Figure 4 , wherein Split A refers to Split A, Split B refers to Split B, Target refers to target, and Substrate refers to substrate chain. Specifically:

[0154] To 100 μL of buffer solution containing appropriate concentration of NaCl, Split A, Split B, substrate chain and connecting hairpin H0, 11 volumes of n-butanol were added and vortexed for 10 s, then placed in an 18°C water bath for incubation in the dark for 30 min, then taken out, added with appropriate amount of high-purity water and vortexed for 10 s, centrifuged for a few seconds, the lower aqueous phase was aspirated, and ultrapure water was added to 100 μL for fluorescence determination.

[0155] The detection reaction occurs in the lower aqueous phase. When the initial aqueous phase reaction system is vortexed with a large amount of n-butanol, although n-butanol has a small mutual solubility with water, the volume of n-butanol is much larger than the volume of the aqueous phase, so after phase equilibrium, the two phases are separated, and the lower aqueous phase is highly concentrated (from the initial 100 μL to about 5 μL after phase equilibrium). In the highly concentrated aqueous phase, the concentrations of the reactants and the target analyte are greatly increased, which greatly increases the rate of the DNAzyme-catalyzed isothermal amplification reaction, i.e., greatly increases the amplification efficiency, shortens the reaction time, and greatly increases the fluorescence signal. Since the background signal increases less, the detection sensitivity is also greatly improved.

[0156] (1) When the target nucleic acid (miRNA or piRNA to be detected) exists in the system:

[0157] The target nucleic acid is completely complementary to the loop sequence of the connecting hairpin H0 (i.e., the 5 sequence of H0 21 or the 9 sequence of H0 20365 ), forms a double strand, and at the same time opens the hairpin structure of the connecting hairpin H0, which becomes a single strand. The connecting sequence (i.e., the 3 sequence and the 4 sequence of H0 21 , or the 7 sequence and the 8 sequence of H0 20365 ) can be complementary to the helper sequence (3* sequence) of the resolvase chain A and the helper sequence (4* sequence) of the resolvase chain B to form a double strand, and at the same time connects the two resolvase chains into an active complex with a complete NaA43 DNAzyme structure; the active complex can bind to the substrate chain and catalytically cleave the substrate chain under the action of Na + (such as NaCl), and the short fragments of the cleaved substrate chain are replaced by new complete substrate chains, and the fluorescence group FAM is away from the quenching group BHQ1, which emits a fluorescence signal under excitation light. The active complex can continue to cleave the complete substrate chain to enter a new reaction cycle, producing a fluorescence signal related to the content of the target nucleic acid, thereby realizing quantitative detection of miRNA and piRNA.

[0158] (2) When there is no detection target nucleic acid in the system:

[0159] The connecting hairpin H0 maintains the hairpin structure, in which the nucleic acid sequence complementary to the resolvase chain A and B is closed and cannot connect the resolvase chain A and B to form an active complex containing a complete NaA43 DNAzyme structure, so it cannot bind to the substrate chain and produce catalytic cleavage. The fluorescence group FAM on the substrate chain is close to the quenching group BHQ1, and fluorescence quenching occurs.

[0160] Optimization of the determination conditions of the Na + -BAS DNAzyme detection system in a solution system

[0161] (1) Optimization of the volume ratio of aqueous phase-n-butanol

[0162] The test method is as follows:

[0163] After 83.5 μL of buffer solution containing 30 nM split enzyme chain A, 30 nM split enzyme chain B, and 60 nM substrate chain was denatured at 90°C for 4 min, naturally cooled to room temperature and kept for 30 min, H0 with a final concentration of 25 nM, 200 mM NaCl, and the target nucleic acid to be detected were added, and the buffer solution was appropriately supplemented to make the total volume of the solution 100 μL, forming a detection system with components and concentrations as shown in Table 3.

[0164] To the miR-21 detection system as shown in Table 3 (wherein the final concentration of miR-21 was set to 0, 10 fM, 100 fM, and 1 pM), n-butanol was added, and the volume ratio of the miR-21 detection system (denoted as the aqueous phase) to n-butanol (denoted as the alcohol phase) was set to 1:0, 1:9, 1:11, and 1:13, followed by rapid and uniform vortexing for 10 s, then incubation at 24°C in the dark for 20 min, termination of the reaction in an ice water bath after the reaction was completed, addition of 50 μL of ultrapure water, uniform vortexing for 10 s, then aspiration of the bottom aqueous phase, supplementation of ultrapure water to 100 μL, and fluorescence determination. The excitation wavelength was 480 nm, and the fluorescence spectrum in the range of 500 nm to 580 nm was determined. The group with a target nucleic acid concentration of 0 is denoted as the blank control group (Blank).

[0165] The test results are shown in Table 4. Figure 5 w V b denotes the volume of the alcohol phase.

[0166] When the volume ratio of the aqueous phase to n-butanol is 1:11, the sensitivity is high, and the linear range is large. When the volume ratio of the aqueous phase to n-butanol is 1:0, the incubation time in the dark is extended to 2 h, and the fluorescence spectrum is detected. The fluorescence signal of the target nucleic acid with a concentration lower than 1 pM cannot be distinguished from the blank control group. Therefore, the biphasic system with a volume ratio of the aqueous phase to n-butanol of 1:11 is selected as the reaction system.

[0167] (2) Optimization of the Na + concentration

[0168] The test method is as follows:

[0169] After 83.5 μL of buffer solution containing 30 nM split enzyme chain A, 30 nM split enzyme chain B, and 60 nM substrate chain was denatured at 90°C for 4 min, naturally cooled to room temperature and kept for 30 min, H0 with a final concentration of 25 nM, 200 mM NaCl, and the target nucleic acid to be detected were added, and the buffer solution was appropriately supplemented to make the total volume of the solution 100 μL, forming a detection system with components and concentrations as shown in Table 3.​

[0170] To the miR-21 detection system as shown in Table 3 (wherein the final concentration of miR-21 is set to 0, 10 fM, 100 fM and 1 pM; the final concentration of NaCl is set to 100, 150, 200 and 250 mM), 11 times volume of n-butanol is added, and then after rapid and uniform vortex for 10 s, it is incubated at 24℃ for 20 min in the dark. After the reaction is completed, the reaction is terminated by placing it in an ice water bath, 50 μL of ultrapure water is added, and after uniform vortex for 10 s, the bottom aqueous phase is aspirated, ultrapure water is supplemented to 100 μL, and fluorescence determination is carried out. With 480 nm as the excitation wavelength, the fluorescence spectrum in the range of 500 nm to 580 nm is determined. The group with the target nucleic acid concentration of 0 is recorded as the blank control group (Blank).

[0171] The detection results are shown in Table 4. Figure 6

[0172] When the concentration of NaCl is 200 mM, the signal sensitivity is high and the blank value is small, so the final concentration of NaCl is selected as 200 mM as the optimal reaction condition.

[0173] (3) Optimization of reaction temperature

[0174] The test method is as follows:

[0175] After 83.5 μL of buffer solution containing 30 nM of cleavase chain A, 30 nM of cleavase chain B and 60 nM of substrate chain is denatured at 90℃ for 4 min, it is naturally cooled to room temperature and kept for 30 min, 25 nM of H0, 200 mM of NaCl and the target nucleic acid to be detected are added, and the buffer solution is supplemented as appropriate to make the total volume of the solution 100 μL, thereby forming the detection system with the components and concentrations as shown in Table 3.

[0176] To the miR-21 detection system as shown in Table 3 (wherein the final concentration of miR-21 is set to 0, 10 fM, 100 fM and 1 pM), 11 times volume of n-butanol is added, and then after rapid and uniform vortex for 10 s, it is incubated at 12℃, 18℃, 24℃, 30℃ and 37℃ for 20 min in the dark, respectively. After the reaction is completed, the reaction is terminated by placing it in an ice water bath, 50 μL of ultrapure water is added, and after uniform vortex for 10 s, the bottom aqueous phase is aspirated, ultrapure water is supplemented to 100 μL, and fluorescence determination is carried out. With 480 nm as the excitation wavelength, the fluorescence spectrum in the range of 500 nm to 580 nm is determined. The group with the target nucleic acid concentration of 0 is recorded as the blank control group (Blank).

[0177] The results are shown in Table 5. Figure 7

[0178] ​​When the reaction temperature was 18℃ and 24℃, the fluorescence spectrum peak signal and the logarithm of miR-21 concentration (LgC) showed good linear relationship (R 2 all were 0.999), which could be used to quantitatively indicate the relationship between the fluorescence spectrum peak signal and the logarithm of miR-21 concentration. Considering the background signal, sensitivity and linear range, 18℃ was the best reaction temperature.

[0179] (4) Optimization of enzyme (i.e. split enzyme chain A / B) and substrate (i.e. substrate chain) reaction ratio

[0180] The test method was as follows:

[0181] After 83.5 μL of buffer solution containing 30 nM split enzyme chain A, 30 nM split enzyme chain B and 60 nM substrate chain was denatured at 90℃ for 4 min, naturally cooled to room temperature and kept for 30 min, 25 nM H0, 200 mM NaCl and the target nucleic acid to be detected were added, and the buffer solution was supplemented to make the total volume of the solution 100 μL, forming a detection system with components and concentrations as shown in Table 3.

[0182] To the miR-21 detection system as shown in Table 3 (wherein the concentration of split enzyme chain A or split enzyme chain B: substrate concentration was 1:1, 1:1.5, 1:2, and the concentration of split enzyme chain A / B was 25 nM), 11 times the volume of n-butanol was added, and then quickly and uniformly vortexed for 10 s, followed by incubation at 18℃ in the dark for 20 min. After the reaction was completed, the reaction was terminated by placing it in an ice water bath, 50 μL of ultrapure water was added, and after uniform vortexing for 10 s, the bottom aqueous phase was aspirated, supplemented with ultrapure water to 100 μL, and fluorescence was measured. The excitation wavelength was 480 nm, and the fluorescence spectrum in the range of 500 nm to 580 nm was measured.

[0183] When the concentration of split enzyme: substrate was 1:1, 1:1.5, 1:2, the fluorescence spectrum peak signal and the logarithm of miR-21 concentration showed good linear relationship (R 2 all were 0.999). When the reaction ratio of enzyme to substrate was 1:2, the signal response sensitivity was the largest. As shown in Figure 8 A.

[0184] Under the condition of split enzyme concentration: substrate concentration of 1:2, the concentration of split enzyme was set to 15 nM, 25 nM and 30 nM, respectively, and the fluorescence signal was measured. The logarithmic relationship between the fluorescence intensity at 520 nm and the concentration of miR-21 was plotted, and the results are shown in Figure 8 B.

[0185] When the enzyme concentration is 25 nM, the response sensitivity is the highest and the background value is small, so the concentrations of split enzyme chains A and B are selected as 25 nM and the concentration of the substrate chain is selected as 50 nM as the optimal reaction conditions.

[0186] (5) Optimization of reaction time

[0187] The test method is as follows:

[0188] After 83.5 μL of a buffer solution containing 30 nM of split enzyme chain A, 30 nM of split enzyme chain B and 60 nM of a substrate chain is denatured at 90°C for 4 min, naturally cooled to room temperature and kept for 30 min, 25 nM of H0, 200 mM of NaCl and the target nucleic acid to be detected are added, and the buffer solution is supplemented to a total volume of 100 μL, thereby forming a detection system with components and concentrations as shown in Table 3.

[0189] To the miR-21 detection system as shown in Table 3 (in which the final concentration of miR-21 is set to 0 and 10 fM), 11 times the volume of n-butanol is added, and then vortexed quickly and uniformly for 10 s, and then incubated at 18°C in the dark for 5, 10, 20, 30, 60 and 120 min, respectively. After the reaction is completed, the reaction is terminated by placing it in an ice water bath, 50 μL of ultrapure water is added, vortexed uniformly for 10 s, and then the bottom aqueous phase is aspirated, supplemented with ultrapure water to 100 μL, and then subjected to fluorescence determination. The excitation wavelength is 480 nm, and the fluorescence intensity at 520 nm after different reaction times is determined, and the relationship between the fluorescence intensity at 520 nm and the reaction time is plotted. The group in which the final concentration of miR-21 is 0 is recorded as a blank.

[0190] The test results are shown in Table 4. Figure 9

[0191] From 20 min to 60 min, the target nucleic acid can be accurately detected. Considering the sensitivity and analysis time, 30 min is selected as the optimal reaction time.

[0192] Na + Performance of the BAS DNAzyme detection system in detecting target nucleic acids in a solution system

[0193] (1) Specific detection

[0194] The test method is as follows:

[0195] ​The 83.5 μL buffer solution containing 30 nM split enzyme chain A, 30 nM split enzyme chain B and 60 nM substrate chain was denatured at 90°C for 4 min, naturally cooled to room temperature and kept for 30 min, then H0 with a final concentration of 25 nM, 200 mM NaCl and the target nucleic acid to be detected were added, and the buffer solution was appropriately supplemented to make the total volume of the solution 100 μL, thereby forming a detection system with components and concentrations as shown in Table 3.

[0196] To the miR-21 detection system or piR-20365 detection system (the target nucleic acid concentration was 100 fM) as shown in Table 3, 11 times the volume of n-butanol was added, and then vortexed quickly and uniformly for 10 s, followed by incubation at 18°C in the dark for 20 min. After the reaction was completed, the reaction was terminated by placing in an ice water bath, 50 μL ultrapure water was added, vortexed uniformly for 10 s, and then the bottom aqueous phase was aspirated. The ultrapure water was supplemented to 100 μL, and fluorescence determination was performed. The excitation wavelength was 480 nm, and the fluorescence intensity at 518 nm was determined. The ratio of the fluorescence intensity to that of the blank control group was compared with the signal of miR-21 or piR-20365. The group without the target nucleic acid was taken as the blank control group (Blank).

[0197] Among them, the target nucleic acid is the DNA analog of other miRNA and piRNA in MCF-7 exosomes, which are miR-21, miR-373, miR-1246, piR-20365, piR-16926, piR-19824 and piR-651, respectively. The nucleotide sequences of each target nucleic acid are shown in Table 4.

[0198] Table 4

[0199] Sequence name Sequence (5'→ 3') miR-21 UAGCUUAUCAGACUGAUGUUGA miR-373 GAAGUGCUUCGAUUUUGGGGUGU miR-1246 AAUGGAUUUUUGGAGCAGG piR-20365 GGCCGUGAUCGUAUAGUGGUUAGUACUCUG piR-16926 CGGAAGCGUGCUGGGCCCAUAACCCAGA piR-19824 GCAUUGGUGGUAUAGUGGUGAGCAUAGC piR-651 AGAGAGGGGCCCGUGCCUUGGAAAGCGUC

[0200] The test results are shown in Table 5. Figure 10 Among them, A is the miR-21 detection system, and B is the piR-20365 detection system.

[0201] Na + The BAS DNAzyme detection system only produces specific response to the target nucleic acid, and has good selectivity.

[0202] (2) Sensitivity, detection limit and linear range detection

[0203] The test method is as follows:

[0204] The 83.5 μL buffer solution containing 30 nM split enzyme chain A, 30 nM split enzyme chain B and 60 nM substrate chain was denatured at 90°C for 4 min, naturally cooled to room temperature and kept for 30 min, then H0, 200 mM NaCl and the target nucleic acid to be detected were added at a final concentration of 25 nM, and the buffer solution was supplemented to make the total volume of the solution 100 μL, thereby forming a detection system with components and concentrations as shown in Table 3.

[0205] To the miR-21 detection system or piR-20365 detection system (wherein the target nucleic acid is miR-21 or piR-20365 or cel-miR-39 at a final concentration of 0-1 nM) as shown in Table 3, 11 times the volume of n-butanol was added, and then vortexed quickly and uniformly for 10 s, followed by incubation at 18°C in the dark for 30 min. After the reaction was completed, the reaction was terminated by placing in an ice water bath, 50 μL ultrapure water was added, vortexed uniformly for 10 s, and then the bottom aqueous phase was aspirated, supplemented with ultrapure water to 100 μL, and subjected to fluorescence determination. The fluorescence spectrum in the range of 500 nm to 580 nm was determined with 480 nm as the excitation wavelength, and the logarithmic relationship between the 518 nm fluorescence signal and the concentration of the corresponding target nucleic acid was plotted. The group without the target nucleic acid was taken as the blank control group (Blank).

[0206] The difference between the cel-miR-39 detection system and the miR-21 detection system is only that the connecting hairpin H0 is different, and the connecting hairpin H0 of the cel-miR-39 detection system is H0 39 : 5'-CAACTCCTTGCTATTTCCGGTCTCAAGCTGATTTACACCCGGTGAAGACCGGAAAT-3' (SEQ ID NO. 14).

[0207] The test results are shown in Tables Figure 11 , 12 and 13.

[0208] In the detection of miR-21, the linear fitting curve in the range of 0.1 fM to 10 fM is F=296889LgC+1592080, the correlation coefficient is 0.995, and the detection limit is 12 aM; the linear fitting curve in the range of 10 fM to 10 pM is F=788274LgC+1116740, and the correlation coefficient is 0.999. As shown in Figure 11 .

[0209] In the detection of piR-20365, the linear fitting curve in the range of 0.1 fM to 1 nM is F=562352LgC+1581030, the correlation coefficient is 0.988, and the detection limit is 26 aM. As shown in Figure 12 .

[0210] In the detection of Cel miR-39, the linear fitting curve at the range of 0.1 fM to 1 pM is F = 591880LgC + 2363440, the correlation coefficient is 0.996, and the detection limit is 13 fM. As shown in Figure 13

[0211] It can be seen that the Na + -BAS DNAzyme detection system has high sensitivity to different target nucleic acids, and can be used for quantitative detection of target nucleic acids within the linear range. The detection limit of the related technology using split DNAzyme to detect nucleic acids is mostly in the pM level, even if combined with rolling circle amplification (RCA) or hybridization chain reaction (HCR cascade), the detection limit is only in the fM level.

[0212] Na + -BAS DNAzyme system detects miR-21 and piR-20365 in exosomes

[0213] The test method is as follows:

[0214] To the miR-21 detection system or piR-20365 system as shown in Table 3, 11 volumes of n-butanol were added, and then quickly and uniformly vortexed for 10 s, and then incubated at 18℃ in the dark for 30 min. After the reaction was completed, the reaction was terminated in an ice water bath, 50 μL of ultrapure water was added, and the bottom aqueous phase was aspirated after uniform vortexing for 10 s. The ultrapure water was supplemented to 100 μL, and the fluorescence was determined. The excitation wavelength was 480 nm, and the fluorescence spectrum in the range of 500 nm to 580 nm was determined. The relationship between the 518 nm fluorescence signal and the logarithm of the exosome concentration was plotted.

[0215] The preparation method of the sample to be tested containing target nucleic acid is as follows: 200 μL of PCR tube was added with MCF-7 exosomes (MCF-7 EVs) or MCF-10a exosomes (MCF-10a EVs) with a final concentration of 1 / μL, 100 / μL, 1000 / μL, 1×10 4 / μL, 1×10 5 / μL, 1×10 6 / μL and 1×10 7 / μL, and then 0.5% of Triton X-100, 0.5% of SDS and 84.5 μg / mL of proteinase K were added and incubated at 37℃ for 1 h.

[0216] 40 μL of 10 8 ​After total RNA was extracted from MCF-7 and MCF-10a exosomes at a concentration of 100 μL / μL, miR-21 was detected according to the method in “(2) Sensitivity, detection limit and linear range detection”, and the absolute abundance of miR-21 was calculated based on the calibration curve.

[0217] The test results are as follows Figure 14 and 15 shown.

[0218] Using miR-21 in exosomes as the detection target, Na + The quantitative calibration curve of the BAS DNAzyme system for detecting MCF-7 exosomes is F = 364317LgC + 434047, and the linear range is 10-10 6 The quantitative calibration curve for MCF-10a exosome detection was F = 182329LgC-65219, and the linear range was 10 5 ~10 7 Exosomes / μL, the detection limit was 9120 exosomes / μL. Taking piR-20365 in exosomes as the detection target, the quantitative calibration curve of MCF-7 exosomes was F=476192LgC+530843, and the linear range was 10~10 6 exosomes / μL, and the detection limit was 2.69 exosomes / μL.

[0219] The calculated absolute abundance of miR-21 in MCF-7 and MCF-10a was 0.120±0.016 copies / MCF-7 exosomes and (5.93±0.005)×10 -3 The relative content of miR-21 in the two exosomes was 20:1, which was highly consistent with the relative content trend of miR-21 in the two exosomes measured by RT-qPCR.

[0220] Na + -BAS DNAzyme system for detection of miR-21 and piR-20365 in clinical plasma samples and its application in breast cancer diagnosis

[0221] Clinical plasma samples were obtained from the Department of Laboratory of Jinan University, including plasma samples from 19 breast cancer patients and 19 healthy controls.

[0222] ① To 50 μL of plasma sample, 100 μL of acetonitrile was added to remove protein, followed by centrifugation at 15000 rpm for 8 min, and the supernatant was taken; the precipitate was washed twice with 50 μL of buffer solution (centrifugation conditions: 15000 rpm, 5 min), and the supernatant was taken; the supernatants were combined, and 50 μL of the supernatant was taken, and Triton X-100 (final concentration: 0.5%), proteinase K (final concentration: 84.5 μg / mL), and SDS (final concentration: 0.5%) were added, and incubation was carried out at 37°C for 1 h to break the membrane, to obtain the sample to be detected. A sample without the addition of plasma was used as a blank control group.

[0223] ② In a 200 μL PCR tube, 31 μL of buffer solution, 25 nM of split enzyme chain A and split enzyme chain B, 50 nM of substrate chain, and 50 μL of the plasma treated in step ① were added, and denaturation was carried out at 90°C for 4 min, and then the reaction was allowed to stand at room temperature for 30 min, and then 25 nM of H0 21 or H0 20365 or H0 39 , 200 mM of NaCl, and 12.5 mM of EDTA were added, 11 volumes of n-butanol was added, and vortexing was carried out for 10 s, and the reaction was allowed to stand at 18°C for 30 min, and then the reaction was terminated in an ice water bath, 50 μL of ultrapure water was added, vortexing was carried out for 10 s, and then centrifugation was carried out, the water phase at the bottom was sucked out, and the volume was made up to 100 μL with ultrapure water, and the fluorescence spectrum was measured at 480 nm excitation and 500-580 nm emission. The ratio of the fluorescence intensity at 518 nm to the blank fluorescence intensity was used as the classifier to draw a scatter plot and a receiver operating characteristic curve.

[0224] The detection results are shown in Figure 16 .

[0225] When the content of miR-21 in plasma exosomes was used as the classifier, t-test showed that there was a significant difference in the average signal level between the breast cancer patient group and the normal control group (P < 0.0001). The ROC curve showed that at the optimal cutoff value of 3.292, the positive sensitivity was 97.4%, the specificity was 100%, and the area under the curve was 0.9972. When the content of piR-20365 in plasma exosomes was used as the classifier, t-test showed that there was a significant difference in the average signal level between the breast cancer patient group and the normal control group (P < 0.0001). The ROC curve showed that at the optimal cutoff value of 2.849, the positive sensitivity was 100%, the specificity was 100%, and the area under the curve was 1. The negative quality control Cel-miR-39 classifier showed that there was no significant difference between the normal person and the breast cancer patient. This shows that the Na + -BAS DNAzyme system has high accuracy in the diagnosis of breast cancer.

[0226] The embodiments of the present application are described in detail above with reference to the drawings, but the present application is not limited to the above-described embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the spirit of the present application.

Claims

1. A target miRNA detection system, characterized in that: include: Nucleic acid probe A, nucleic acid probe B, hairpin probe A, hairpin probe B; The two ends of the hairpin probe A are modified with a fluorescent group and a quenching group respectively; The nucleotide sequence of the nucleic acid probe A is shown in SEQ ID NO.9, the nucleotide sequence of the nucleic acid probe B is shown in SEQ ID NO.10, and the nucleotide sequence of the hairpin probe A is shown in SEQ ID NO.11; The target miRNA is miR-21, and the nucleotide sequence of the hairpin probe B is shown in SEQ ID NO.12; The target miRNA is cel -miR-39, the nucleotide sequence of the hairpin probe B is shown in SEQ ID NO.

14.

2. A target piRNA detection system, characterized in that: include: Nucleic acid probe A, nucleic acid probe B, hairpin probe A, hairpin probe C; The two ends of the hairpin probe A are modified with a fluorescent group and a quenching group respectively; The nucleotide sequence of the nucleic acid probe A is shown in SEQ ID NO.9, the nucleotide sequence of the nucleic acid probe B is shown in SEQ ID NO.10, and the nucleotide sequence of the hairpin probe A is shown in SEQ ID NO.11; The target piRNA is piR-20365, and the nucleotide sequence of the hairpin probe C is shown in SEQ ID NO.

13.

3. A kit, characterized in that A detection system comprising the target miRNA of claim 1 or the target piRNA of claim 2.

4. The kit according to claim 3, wherein The kit also includes n-butanol, Na + , at least one of a divalent metal chelating agent.

5. The kit according to claim 4, characterized in that The method for using the kit comprises the following steps: The detection system is connected with the sample to be detected, Na + Mixing to obtain a reaction system; mixing the reaction system with 9 to 12 times the volume of n-butanol, and after the reaction, qualitatively and / or quantitatively detecting the target miRNA or target piRNA according to the fluorescence intensity.

6. The kit according to claim 5, characterized in that The reaction temperature is 16°C to 26°C.

7. The kit according to claim 5, characterized in that The reaction time is 20 min to 60 min.

8. The kit according to claim 5, wherein In the reaction system, Na + The concentration is 180 mM~220mM.

9. The kit according to claim 5, characterized in that In the reaction system, the concentration of the nucleic acid probe A is 15 nM to 35 nM.

10. The kit according to claim 5, characterized in that In the reaction system, the concentration of the nucleic acid probe B is 15 nM to 35 nM.

11. The kit according to claim 5, characterized in that In the reaction system, the concentration of the hairpin probe A is 30 nM to 70 nM.

12. The kit according to claim 5, characterized in that In the reaction system, the concentration of the hairpin probe B is 15 nM to 35 nM.

13. The kit according to claim 5, characterized in that In the reaction system, the concentration of the hairpin probe C is 15 nM~35 nM.

14. A method for qualitatively and / or quantitatively detecting a target miRNA or target piRNA for non-disease diagnosis purposes, characterized in that: The method comprises the following steps: combining the detection system according to claim 1 or 2 with the sample to be detected, Na + Mixing to obtain a reaction system; mixing the reaction system with 9 to 12 times the volume of n-butanol, and after the reaction, qualitatively and / or quantitatively detecting the target miRNA or target piRNA according to the fluorescence intensity.

15. Use of the target miRNA detection system of claim 1, the target piRNA detection system of claim 2, or the kit of any one of claims 3 to 13 in nucleic acid detection for non-disease diagnosis purposes.

Images