Use of fusA gene and method for indicating Vibrio splendens to enter a persisting state
By using the fusA gene as an indicator and combining real-time fluorescence quantitative PCR method, the metabolic status of Canlan Yi Bacteria was detected, which solved the problem of difficult to quickly and accurately judge the bacteria entering a low metabolic state in the prior art, and achieved rapid and accurate judgment of the metabolic status.
Patent Information
- Application Number
- CN202310000892.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-03
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2043-01-03
AI Technical Summary
The prior art is difficult to quickly and accurately determine whether bacteria enter a low metabolic state, especially when detecting the metabolic level of Vibrio Cancer, which lacks effective indicator genes.
The fusA gene was used as an indicator to detect the expression of the Vitiligo fusA gene by designing specific upstream and downstream amplification primers combined with real-time fluorescence quantitative PCR method. If the fusA gene expression decreases to 40% or less of the active bacteria, the bacteria are considered to enter a low-metabolism retention state.
It realizes the rapid and accurate judgment of bacterial metabolic status, and can determine the metabolic status of Vibrio splendor within 3 to 5 hours. It has the advantages of fast detection process, easy analysis of results and quantitative.
Smart Images

Figure CN115927689B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of environmental microorganisms, in particular to a fusA The purpose of the gene and the method of instructing Vibrio splendens to enter the persister state. Background Art
[0002] Persistent bacteria are a small proportion of the subpopulation in the bacterial flora that grows slowly or is temporarily dormant. The presence of this small portion of bacteria in the host is the root cause of stubborn and recurrent infectious diseases. In the natural environment and biological environment, a small portion of bacteria of various pathogens, including Mycobacterium tuberculosis, Salmonella typhi, Escherichia coli and Pseudomonas aeruginosa, can be transformed into persisters. Persistent bacteria are extremely easy to recover. When the concentration of antibacterial drugs in the body is reduced or the body's immunity is reduced, it is extremely easy to recover into metabolically active and pathogenic strains, which become the basis for the recurrence of various infectious diseases. The treatment failure and stubborn recurrence of many chronic recurrent bacterial diseases, such as tuberculosis caused by Mycobacterium tuberculosis, chronic urinary tract infection caused by Escherichia coli, typhoid fever caused by Salmonella typhi, peptic ulcer caused by Helicobacter pylori, and endocarditis and osteomyelitis caused by Staphylococcus aureus, are all caused by pathogens entering the persister state. Therefore, detecting the metabolic state of bacteria, especially whether they are in a low metabolic persister state, is of great significance for the occurrence and recurrent infection of diseases.
[0003] When bacteria respond to adverse environmental factors, they survive by reducing metabolism and entering a low-metabolism persister form. Therefore, any process involved in bacterial substance synthesis and energy metabolism may be related to the formation of persisters, so the process involves complicated mechanisms and systems. Genes related to the inhibition of DNA, protein, cell wall or ATP energy synthesis processes are all involved in the formation of bacterial persisters. The common method for screening persisters is to use high concentrations of antibiotics, generally 10 times the minimum inhibitory concentration (10×MIC) of antibiotics to kill active bacteria. Those that tolerate high concentrations of antibiotics are considered to be persisters, and then multiple antibiotic tolerance tests and single cell recovery observations under a microscope are performed for verification. In recent years, molecular marker methods have occasionally been used to detect bacteria entering a persister state. When Mycobacterium tuberculosis enters a dormant persistence period from a growth and reproduction period, the original tricarboxylic acid cycle will turn to a pathway that depends on the glyoxylate cycle branch, while obtaining energy and carbon sources, reducing the metabolic rate to maintain its long-term survival in the host cell. Therefore, isocitrate cleavage synthase (ICL), a key enzyme in the glyoxylate metabolic pathway, is a key enzyme in the intracellular anaerobic metabolism of Mycobacterium tuberculosis, and its expression can be used to indicate that Mycobacterium tuberculosis has evolved from active bacteria to persister bacteria.
[0004] In the process of bacterial protein translation, the translocation process of peptide chain extension requires elongation factor G (EF-G), which interacts with the ribosome to stabilize its intermediate state. The GTPase activity of EF-G is activated after ribosome binding, and GTP hydrolysis is used to promote conformational changes in the translocation process and promote protein synthesis. Therefore, this process is a key process that determines the peptide bond of protein synthesis. The gene encoding the synthetic EF-G protein in Vibrio splendens is fusA Gene.
[0005] Vibrio splendens is an important conditional pathogen commonly found in marine aquaculture environments, and can infect a number of marine aquaculture economic species, including sea cucumbers, scallops, oysters, clams, and American fish. Vibrio splendens can enter a persister state to avoid being killed by antibiotics and host immune factors, but there are currently no reports on indicator genes for Vibrio splendens to enter a persister state. Summary of the invention
[0006] The technical problem to be solved by the present invention is to provide a method for simply, quickly and accurately judging whether bacteria have entered a low metabolic state. fusA The purpose of genes and how they indicate high or low metabolic levels in Vibrio splendens.
[0007] The technical solution adopted by the present invention to solve the above technical problems is: a fusA Use of genes in bacterial metabolic state indicators, the fusA The nucleotide sequence of the gene is shown in SEQ ID NO:1.
[0008] Above fusA A method for genetically instructing Vibrio splendens to enter a persistence state, comprising the following steps: designing fusA The upstream and downstream amplification primers of the gene were combined with the real-time fluorescence quantitative PCR method. fusA When the gene expression level drops to 40% or less of the active bacteria, Vibrio splendens can be identified as entering a low-metabolism persistence state. fusA The sequence of the upstream primer fusAF for gene PCR amplification was: 5′-CATTCAAGAACAAGGGTG-3′; fusA The sequence of the downstream primer fusAR for gene PCR amplification is: 5'-CGAACGAAAGTTAGAGCA-3'.
[0009] Further, the specific steps are as follows:
[0010] (1) Collect OD 600=0.6-2.0 brilliant bacteria liquid was divided into two parts, one of which was used as active bacteria; the other part was added with 250 μg / mL antibiotics for 4 hours, and centrifuged at 12,000 g for 5 minutes to collect the bacteria. This part of the bacteria was the persister bacteria that tolerated the antibiotics by reducing the metabolic level. The total RNA from the persister bacteria and active bacteria was extracted using a bacterial RNA extraction kit, and the mRNA in the total RNA was reverse transcribed into cDNA using a reverse transcription kit;
[0011] (2) Prepare the following reaction mixture using the reagents in the real-time fluorescence quantitative PCR kit: SYBR reaction solution, 10 μL; 10 μM fusAF primer, 1 μL; 10 μM fusAR primer, 1 μL; cDNA template, 0.5 μL; internal reference dye ROX, 0.5 μL; ddHO 2 O, 7 μL; the internal reference gene is 16S rDNA, according to fusA A gene amplification method is used to prepare an amplification reaction mixture of an internal reference gene;
[0012] (3) Place the prepared reaction mixture in a real-time fluorescence quantitative PCR instrument for amplification reaction: ① 95 ℃, 5 minutes; ② 95 ℃, 30 seconds; ③ 52 ℃, 30 seconds, 72°C, 20 seconds, return to step 2 for 40 cycles; 72 ℃, 10 minutes, obtain the sample fusA C T value;
[0013] (4) Calculation of gene expression Note: 2 -△△Ct The relative expression level of genes was calculated by: -△△CT =2 -[(SfusA的CT-CfusA的CT)-(S16S的CT-C16S的CT)] , where S is the sample retained bacteria, C is the active bacteria, and the active bacteria fusA The gene expression level is regarded as 1, and the fusA A positive value is when the relative gene expression is lower than 40% of the expression of active bacteria, indicating that the metabolic state of the bacteria has entered a low metabolic persistence state.
[0014] Preferably, in step (1), the cultured cells are collected and cultured to the stable phase OD 600 =2.0 of brilliant bacterial fluid.
[0015] Compared with the prior art, the advantages of the present invention are: the present invention discloses for the first time a fusAThe invention discloses a method for indicating bacteria to enter a persistence state and a pair of specific nucleic acid marker sequences, fusAF: 5'-CATTCAAGAACAAGGGTG-3' and fusAR: 5'-CGAACGAAAGTTAGAGCA-3', which can be used to detect the metabolic state of Vibrio splendens. The pair of specific nucleic acid marker sequences is applied to real-time fluorescence quantitative reverse transcription PCR reaction to detect bacteria with relatively consistent metabolic state. fusA When the mRNA expression of the gene drops below 40% of that in the active bacteria, the bacteria enter a low metabolic retention state. This method can be used to determine the metabolic state of Vibrio splendens within 3 to 5 hours. It has the advantages of rapid detection process, easy analysis and quantification of the test results, and provides a relatively simple judgment method for studying the metabolism and physiological functions of Vibrio splendens.
[0016] In summary, by detecting differentially expressed proteins in bacteria with different metabolic states, we screened fusA The gene is used as a marker molecule, and the protein encoded by this gene is the elongation factor G in the translation process. fusA A pair of primers is designed to detect the mRNA level of the gene under specific conditions. fusA The expression level of the gene can be used to quickly and sensitively determine whether the metabolic level in the bacteria has changed and whether it has entered the persister state. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Picture 1 The colony count of Vibrio splendens before and after the 250 μg / mL (10×MIC) tetracycline screening. (A) The result of 10-fold gradient dilution of Vibrio splendens before tetracycline was added, and 10 μL of the dilution solution was dropped on the plate; (B) The result of 10-fold gradient dilution of the bacterial suspension after 250 μg / mL tetracycline treatment, and 10 μL of the dilution solution was dropped on the plate;
[0018] Picture 2 It is the determination of ATP content in active bacteria and persisting bacteria. The ATP content in active bacteria is 1, and * indicates P <0.05;
[0019] Picture 3 GO enrichment analysis of proteins with decreased differentially expressed genes obtained by transcriptome sequencing of active and persister bacteria;
[0020] Picture 4The electrophoresis results of PCR amplification products using the genome of Vibrio splendens as template and fusAF and fusAR as forward and reverse primers. Lane 1 is the DNA molecular weight standard of DL2000, with molecular weight bands of 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp and 100 bp from top to bottom; Lanes 2, 3 and 4 are the amplification results using fusAF and fusAR as primers;
[0021] Picture 5 Real-time fluorescence quantitative reverse transcription PCR fusA The relative expression of genes. Untreated Vibrio splendens were collected at different growth stages, and the OD 600 The bacteria with different concentrations of 0.6, 1.2 and 2.0 were used as controls (active bacteria Vs). The bacteria with different concentrations of 250 μg / mL tetracycline were treated to obtain bacteria with tolerance to high concentrations of antibiotics as persister samples (VsP). RNA of the two bacteria was extracted, reverse transcribed, and real-time fluorescence quantitative PCR was performed. The vertical axis is fusA The relative expression of genes fusA Genes in each OD 600 The expression of active bacteria at the time of 600 The values were 0.6, 1.2 and 2.0 respectively. * indicates P < 0.05. DETAILED DESCRIPTION
[0022] The present invention is further described in detail below with reference to the accompanying drawings.
[0023] Specific implementation
[0024] Acquisition of persisters
[0025] Take 5 mL of Vibrio splendens cultured overnight, centrifuge at 12,000 g for 5 minutes, remove the supernatant, wash twice with 0.8% NaCl solution and prepare a bacterial suspension. At this time, the bacterial suspension is divided into two portions, each with 2 mL. One portion remains unchanged, and one portion is added with tetracycline at a final concentration of 250 μg / mL for 4 hours, centrifuged at 12,000× g for 5 minutes, washed twice with 0.8% NaCl solution, and resuspended in 2 mL of 0.8% NaCl solution. This sample is a bacterial cell that is tolerant to high concentrations of antibiotics. The bacterial cells before and after high concentration antibiotic treatment were diluted 10 times in a gradient, and 10 μL of each concentration gradient was aspirated and dropped into 2216E solid culture medium. The results are as follows: Picture 1 As shown. In the bacteria without antibiotic treatment, dilution 10 11 There are still about 50 bacteria when the suspension is diluted 10 times, while in the bacterial suspension with antibiotics, only 7When the concentration of antibiotics is high, there are about 10 bacteria. Therefore, the bacteria resistant to high concentrations of antibiotics account for 0.002% of the total number of bacteria. These bacteria that can still survive under the action of high concentrations of antibiotics are defined as low-metabolism persisters. In order to verify whether the metabolism of persisters is lower than that of active bacteria, we used an ATP assay kit (Nanjing Jiancheng, A095-1-1) to measure the ATP content in the collected bacteria. The results are as follows Picture 2 As shown, the ATP content in the persister bacteria was significantly reduced to about 50% of that in the control bacteria. Specific embodiment 2
[0027] Transcriptome analysis of persisters and active bacteria and screening of marker molecules
[0028] Take 100 mL of Vibrio splendens cultured overnight, centrifuge at 12,000 g for 5 min, remove the supernatant, wash twice with 0.8% NaCl solution and prepare a bacterial suspension. At this time, the bacterial suspension is divided into two portions, each with 40 mL. One portion remains unchanged, and this active bacterial sample is named Vs2_0. Another portion is added with tetracycline at a final concentration of 250 μg / mL for 4 hours, centrifuged at 12,000× g for 5 minutes, washed twice with 0.8% NaCl solution, and resuspended in 2 mL of 0.8% NaCl solution. This low-metabolism persister bacterial sample is named VsP2_0. The two samples of Vs2_0 and VsP2_0 were sent to Novogene Biotechnology Co., Ltd. for transcriptome sequencing analysis to obtain differentially expressed genes in two types of bacteria with different metabolic states. The differentially expressed genes were enriched by GO, and the results are as follows Picture 3 As shown. Amide biosynthesis and translation processes are the biological processes with the most enrichment of down-regulated proteins, ribosomes and ribonucleoproteins are the cellular components with the most enrichment of down-regulated proteins, and ribosomal structural protein activity and structural molecule activity are the molecular functions with the most enrichment of down-regulated proteins. Therefore, in persisters, the down-regulation of translation-related processes and activities is the most iconic process for the enrichment of down-regulated proteins. By screening differentially expressed proteins related to the translation process in bacteria with different metabolic states, elongation factor G was obtained as a signature protein with reduced expression enriched in the translation process. Specific embodiment three
[0030] Differential expression according to transcriptome fusA Gene information (gene_id: DUN60_RS11105), the reference genome sequence is Vibrio splendidus strain Vibrio sp. chromosome 1, complete sequence (NCBI Reference Sequence: NZ_CP031055.1, screened in the genome of Vibrio splendens fusAGene. In Vibrio splendidus fusA The gene sequence is as shown in SEQ ID NO: 1: ATGGCAGATTTATCGAAATACAGAAACATTGGTATTTTCGCGCACGTTGATGCGGGTAAAACAACTACCACTGAGCGTATCCTTAAGCTAACTGGTCAGATCCACAAGACTGGTGAAGTACATGATGGCGAATCAACTACTGACTTCATGGAACAGGAAGCTGAGCGCGGAATTACTATCCAATCAGCAGCTGTAAGCTGTTTCTGGAACGGTCACCGTCTAAACGTTATCGATACTCCTGGACACGTTGACTTCACAGTTGAAGTATACCGTTCTCTTAAAGTACTTGATGGCGGTATCGGTGTATTCTGTGGTTCTGGTGGTGTTGAACCACAATCAGAAACTAACTGGCGCTACGCTAACGAATCAGAAGTATCTCGTCTGATCTTCGTTAACAAACTAGACCGTATGGGTGCAGATTTCTACAACGTTGTTGACCAAGTTAAAAACGTTCTAGGTGCAACTCCTCTAGTTATGGTTCTACCAATCGGCCGCGAAGATGAATTCGTGGGTGTTGTAGACCTTCTAAGCCGTAAAGCATACGTTTGGGATGACACTGGTCTTCCTGAAAACTACGAAATCCTAGATGTTCCTGCGGACATGGTAGATGACGTAGAGCAATACCGTGAAGAGCTAATCGAAACTGCTGTAGAGCAAGACGATGACCTAATGGAAGCTTACATGGAAGGTGAAGAGCCTTCTATCGAAGACATCAAGCGTTGTATCCGTAAAGGTACTCGTGACCTAGCGTTCTTCCCAACTTACTGTGGTTCTG CATTCAAGAACAAGGGTG TTCAAATCATCCTTGACGCTGTTGTAGATTACCTACCTTCTCCAACTGAAGTTGATCCTCAACCTCTAATGGATGAGAACGGTGAAGAAACTGGTAAGCACGCTATCGTTTCTACTGAAGAAACGTTTAAAGCTCTTGCATTCAAAATCATGGATGACCGTTTCGG TGCTCTAACTTTCGTTCG
[0031] 2. Design primers based on gene sequence fusA Gene specific amplification
[0032] The gene sequence was used to design primers using Primer 3.0 to obtain the following primer sequences: fusAF: 5'-CATTCAAGAACAAGGGTG-3' and fusAR: 5'-CGAACGAAAGTTAGAGCA-3'. The Tm value of the primers was 52 degrees, and the target fragment amplified was 202 bp.
[0033] First, prepare the PCR mixture, the system is as follows: PCR buffer, 2.5 μL; dNTP, 2 μL; 10 μM fusAF, 0.5 μL; 10 μM fusAF, 0.5 μL; template, 0.5 μL; Taq enzyme, 0.5 μL; ddH 2 O: 18.5 μL. PCR program: 95°C, 5 minutes; 95°C, 30 seconds; 52°C, 30 minutes; 72℃, 20 seconds, return to Step, 30 cycles; 72°C, 10 minutes. The PCR results are as follows Picture 4 As shown, the expected specific DNA band of about 202 bp was amplified, indicating that the primers can be used for real-time fluorescence quantitative PCR experiments.
[0034] 3. Real-time fluorescence quantitative PCR assay fusA mRNA expression level of genes
[0035] When the cells grow to different cell densities, OD 600 = 0.6, 1.2 and 2.0 respectively for the retained bacteria and active bacteria fusA Gene expression determination.
[0036] When the cells grew to OD 600 =0.6, take out 20 mL, centrifuge at 12,000× g for 5 min, remove supernatant, wash twice with 0.8% NaCl solution and prepare bacterial suspension, at this time, the bacterial suspension is divided into two parts, each with 10 mL. One part remains unchanged in this state, and this sample is named active bacteria Vs0.6 sample, and one part is added with tetracycline at a final concentration of 250 μg / mL for 4 hours, centrifuged at 12,000× g for 5 minutes, washed twice with 0.8% NaCl solution, and resuspended in 2 mL of 0.8% NaCl solution, and this sample is named low-metabolism persister bacteria VsP0.6 sample;
[0037] When the cells grew to OD 600 =1.2, take out 20 mL, centrifuge at 12,000× g for 5 min, remove supernatant, wash twice with 0.8% NaCl solution and prepare bacterial suspension, at this time, the bacterial suspension is divided into two parts, each with 10 mL. One part remains unchanged in this state, and this sample is named active bacteria Vs1.2 sample, and one part is added with tetracycline at a final concentration of 250 μg / mL for 4 hours, centrifuged at 12,000× g for 5 minutes, washed twice with 0.8% NaCl solution, and resuspended in 2 mL of 0.8% NaCl solution, and this sample is named low metabolic persister VsP1.2 sample;
[0038] When the cells grew to OD 600 =2.0 (this is the stable growth period of the bacteria), take out 20 mL, centrifuge at 12,000g for 5 minutes to remove the supernatant, wash twice with 0.8% NaCl solution and prepare a bacterial suspension. At this time, the bacterial solution is divided into two portions, each with 10 mL. One portion remains unchanged in this state, and this sample is named the active bacteria Vs2.0 sample. One portion is added with tetracycline at a final concentration of 250 μg / mL for 4 hours, centrifuged at 12,000× g for 5 minutes, washed twice with 0.8% NaCl solution, and resuspended in 2 mL of 0.8% NaCl solution. This sample is named the low-metabolism persister bacteria VsP2.0 sample; the bacterial precipitate is placed in an ice-water mixture to terminate metabolism. The bacterial cells are used to extract total RNA using a bacterial RNA extraction kit (Beijing Tiangen Bacterial Total RNA Extraction Kit DP430) and A 260 The concentration of mRNA was measured by reverse transcription kit (Takara Reverse Transcription Kit RR037A) to reverse transcribe mRNA into cDNA, and the real-time fluorescence quantitative PCR kit (Takara Fluorescence Quantitative qPCR Kit RR430B) was used to perform the following reaction:
[0039] ①Configure the real-time fluorescence quantitative PCR reaction system, in which the internal reference genes 16S and fusA The genes were mixed in the following ratios: SYBR reaction solution, 10 μL; 10 μM fusAF primer, 1 μL; 10 μM fusAR primer, 1 μL; cDNA template, 0.5 μL; ROX, 0.5 μL; ddH 2 O, 7 μL. The internal reference used in real-time fluorescence quantitative PCR was 16S rDNA, and the primer sequences were 933F (5'-GCACAAGCGGTGGAGCATGTGG-3') and 16SRTR (5'-CGTGTGTAGCCCTGGTCGTA-3').
[0040] ② Place the PCR reaction buffer in the ABI7500 real-time fluorescence quantitative PCR instrument for PCR. The reaction procedure is: 95°C, 5 minutes; 95°C, 30 seconds; 52°C, 20 seconds; 72 ℃, 20 seconds back to the first Step 40 cycles; PCR was performed in ABI7500 real-time fluorescence quantitative PCR instrument at 72°C for 10 minutes according to the optimal program set in the manual to obtain the C T Value (the number of cycles required for the fluorescence value in the PCR system to reach the fluorescence threshold of the instrument).
[0041]
[0042] The active bacteria sample Vs was the bacteria that had not been treated with 10×MIC tetracycline; the persister bacteria group VsP sample was the low-metabolism persister bacteria sample obtained after treatment with 250 μg / mL tetracycline.
[0043] Using 2 -△△Ct The relative expression level of genes was calculated by the method. -△△CT =2 -[(SfusA的CT-CfusA的CT)-(S16S的CT-C16S的CT)]。
[0044] At the same OD 600 When the active bacteria Vs group samples, fusA The expression of the gene is regarded as 1, then, in the samples of the persister VsP group, fusA The expression of genes was calculated as follows:
[0045] In OD 600 =0.6, in the samples of the persister bacteria VsP0.6 group, fusA The gene expression is:
[0046] ①2 -[(SfusA的CT-CfusA的CT)-(S16S的CT-C16S的CT)] =2 -[(25.8-25.2)-(17.3-18.9)] =2 -(2.2) =0.22
[0047] In OD 600 =1.2, in the samples of the persister bacteria VsP1.2 group, fusA The gene expression is:
[0048] ②2 -[(SfusA的CT-CfusA的CT)-(S16S的CT-C16S的CT)] =2 -[(26.9-24.1)-(17.6-16.4)] =2 -(1.6) =0.33
[0049] In OD 600=2.0, in the samples of the persister bacteria VsP2.0 group, fusA The gene expression is:
[0050] 2 -[(SfusA的CT-CfusA的CT)-(S16S的CT-C16S的CT)] =2 -[(26.9-24.8)-(18.0-17.3)] =2 -(1.4) =0.38
[0051] In persisters fusA When the expression level of the gene drops to less than 40% of the expression level in active bacteria, it is considered that the bacterial metabolism has entered a low-metabolism persister state.
[0052] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the spirit and scope of the present invention shall also fall within the protection scope of the present invention.
Claims
1. A fusA Use of genes as indicators of bacterial metabolic status, Features: The fusA The nucleotide sequence of the gene is shown in SEQ ID NO:
1. fusA When the gene expression level drops to 40% or less of active bacteria, it can be determined that Vibrio splendens has entered a low-metabolism persistence state.
2. A fusA Methods for genetically instructing Vibrio splendens to enter a persister state, Features The following steps are involved: design fusA The upstream and downstream amplification primers of the gene were combined with the real-time fluorescence quantitative PCR method. fusA When the gene expression level drops to 40% or less of the active bacteria, Vibrio splendens can be identified as entering a low-metabolism persistence state. fusA The sequence of the upstream primer fusAF for gene PCR amplification was: 5′-CATTCAAGAACAAGGGTG-3′; fusA The sequence of the downstream primer fusAR for gene PCR amplification is: 5'-CGAACGAAAGTTAGAGCA-3'.
3. A method according to claim 2 fusA Methods for genetically instructing Vibrio splendens to enter a persister state, Features The specific steps are as follows: (1) Collect OD 600 =0.6-2.0 of Vibrio splendens bacterial solution, divided into two parts, one as active bacteria; the other part was added with 250μg / mL of antibiotics for 4 hours, and centrifuged at 12,000g for 5 minutes to collect the bacteria. This part of the bacteria is the persister bacteria that tolerate antibiotics by reducing the metabolic level. The total RNA in the persister bacteria and active bacteria was extracted using a bacterial RNA extraction kit, and the mRNA in the total RNA was reverse transcribed into cDNA using a reverse transcription kit; (2) Prepare the following reaction mixture using the reagents in the real-time fluorescence quantitative PCR kit: SYBR reaction solution, 10 μL; 10 μM fusAF primer, 1 μL; 10 μM fusAR primer, 1 μL; cDNA template, 0.5 μL; internal reference dye ROX, 0.5 μL; ddHO 2 O, 7 μL; the internal reference gene is 16S rDNA, according to fusA A gene amplification method is used to prepare an amplification reaction mixture of an internal reference gene; (3) Place the prepared reaction mixture in a real-time fluorescence quantitative PCR instrument for amplification reaction: the reaction procedure is: (1) 95°C, 5 minutes; (2) 95°C, 30 seconds; (3) 52°C, 20 seconds; (4) 72°C, 20 seconds, return to step (2) for 40 cycles; (5) 72°C, 10 minutes to obtain the sample fusA C T value; (4) Calculation of gene expression Note: 2 -△△Ct The relative expression level of genes was calculated by: -△△CT =2 -[(SfusA的CT-CfusA的CT)-(S16S的CT-C16S的CT)] , where S is the sample cell, C is the active cell, and the active cells fusA The gene expression level is regarded as 1, and the fusA A relative gene expression level lower than 40% of that of active bacteria is considered a positive value, indicating that the metabolic state of the bacteria has entered a low-metabolism persistence state.
4. A method according to claim 3 fusA Methods for genetically instructing Vibrio splendens to enter a persister state, Features: The OD value of the cultured cells in step (1) was collected and cultured to the stable phase. 600 =2.0 of Vibrio splendens bacterial solution.
Citation Information
Patent Citations
Gene chips for detecting multiple pathogenic bacteria in animals cultivated in sea water and uses thereof
CN102869785A
Genes identified as required for proliferation of E. coli
US20020022718A1