A molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7 and its application

By designing specific molecular markers K-7415F and K-7415R to amplify the wheat stem-based rot gene Fhb7, the problem of time-consuming and labor-intensive and difficult identification of traditional methods is solved, efficient breeding process and accurate genotype identification are achieved, and the breeding efficiency of wheat stem-based rot resistance is improved.

CN115927714BActive Publication Date: 2025-08-01SHANDONG AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211018120.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-24
Publication Date
2025-08-01
Estimated Expiration
2042-08-24

AI Technical Summary

Technical Problem

In the prior art, traditional methods are time-consuming and labor-intensive, difficult to identify phenotypes, low breeding efficiency, and difficult to efficiently use the Fhb7 gene to enhance the resistance of wheat against stem-based rot.

Method used

Molecular markers specifically identifying the wheat anti-stem-based rot gene Fhb7 were designed and applied, and amplified using PCR primers K-7415F and K-7415R, combined with agarose gel detection, to achieve accurate identification of the Fhb7 gene.

Benefits of technology

Through molecular marker assisted selection breeding, the efficiency of wheat resistant to stem-based rot breeding is improved, the breeding process is shortened, and accurate genotype identification methods are provided, which are suitable for production practice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115927714B_ABST
    Figure CN115927714B_ABST
Patent Text Reader

Abstract

The present invention discloses a molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7 and its application, wherein the PCR primer sequences are K-7415F and K-7415R. The detection steps are as follows: extracting the genomic DNA of the wheat-Thinopyrum ponticum short fragment translocation line leaves by the CTAB method; performing PCR amplification on the extracted DNA using the molecular marker K-7415; loading and electrophoresing the PCR products on a 1% agarose gel, and after the electrophoresis is completed, taking pictures and observing the results with an AlphaInnotech V.1.2 type gel imaging system. The molecular marker K-7415 in the present invention is tightly linked to the fusarium crown rot resistance gene Fhb7. Using this molecular marker can improve the efficiency of molecular marker-assisted selection, and can be directly applied to the wheat fusarium crown rot resistance production practice, providing technical support for breeding fusarium crown rot-resistant wheat improved lines carrying Fhb7 by the method of molecular marker-assisted selection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of wheat molecular breeding, and specifically relates to a molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7 and its application. Background Art

[0002] Wheat is one of the important food crops in the world. Improving the resistance of wheat to various diseases can recover 15-20% of the yield loss caused by diseases every year. Fusarium crown rot is a kind of wheat fungal disease, which has been increasing year by year in the Huang-Huai wheat region of China in recent years and has become an important disease seriously threatening wheat production. It was listed as one of the 10 industrial technical problems in China in 2022.

[0003] Research shows that cultivating and planting disease-resistant varieties is the most economical and effective measure to solve the problem of wheat fusarium crown rot. However, there are few effective resistance sources available in current production. Fhb7 from Thinopyrum elongatum is currently the only known major resistance gene. Using biotechnology methods, this gene can be transferred into popular wheat varieties susceptible to fusarium crown rot. However, traditional methods are time-consuming and laborious, difficult in phenotypic identification, and low in breeding efficiency. With the help of molecular marker-assisted selection breeding, this problem can be effectively solved. Summary of the Invention

[0004] Aiming at the defects of the prior art, the present invention provides a molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7 and its application.

[0005] The object of the present invention is to provide a linked molecular marker that specifically recognizes and amplifies the wheat fusarium crown rot resistance gene Fhb7, and its application in wheat fusarium crown rot resistance breeding.

[0006] The technical solution of the present invention is as follows:

[0007] The present invention provides a molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7. The PCR primer sequence K-7415F is the sequence shown in SEQ ID NO.1, and the primer sequence K-7415R is the sequence shown in SEQ ID NO.2;

[0008] SEQ ID NO.1: TTATCTGTCACGAGCATAGGC;

[0009] SEQ ID NO.2: AGTATTCTTCTTGAGGCGAGTC.

[0010] The present invention also provides an application of the molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7 in identifying the fusarium crown rot resistance genotype of wheat-Thinopyrum elongatum short fragment translocation lines.

[0011] The present invention provides a method for identifying the genotype of wheat-Thinopyrum ponticum short fragment translocation lines resistant to Fusarium crown rot. Amplification is carried out using primers K-7415F and K-7415R. An amplified band of 165 bp indicates that the test sample contains the Fhb7 gene; the absence of an amplified band indicates that the test sample does not contain the Fhb7 gene.

[0012] Preferably, the PCR amplification and band detection include the following steps:

[0013] (1) Extract genomic DNA from the sample using the CTAB method;

[0014] (2) Perform PCR amplification using the extracted DNA as a template;

[0015] (3) Detect the PCR products using 1% agarose gel.

[0016] More preferably, 1 μL of DNA template, 7.5 μL of 2× Taq Master Mix, 1 μL each of primers K-7415F and K-7415R with a concentration of 10 μmol / L, and add water to 15 μL.

[0017] More preferably, the reaction program of the PCR is 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, for 35 cycles; 72°C for 10 min.

[0018] The present invention also provides an application in molecular breeding of wheat resistant to Fusarium crown rot.

[0019] The advantages of the present invention are as follows: The present invention is not restricted by environmental conditions. By obtaining the molecular marker K-7415 closely linked to the wheat Fusarium crown rot resistance gene Fhb7, the resistance of wheat to Fusarium crown rot can be predicted. According to the size of the target band, it provides the possibility to accurately screen out the lines carrying the wheat Fusarium crown rot resistance gene Fhb7. This molecular marker can directly serve production practice, thereby improving the efficiency of wheat Fusarium crown rot resistance breeding, accelerating the breeding process, and being popularized and applied in wheat molecular breeding. Description of the Drawings

[0020] Figure 1 The sequence amplified by the molecular marker K-7415 on chromosome 7E of Thinopyrum ponticum (the primer sequence positions are within the arrows).

[0021] Figure 2Detection results of molecular marker K-7415 in the BC3F1 population samples of wheat-Thinopyrum elongatum short fragment translocation lines (M, DL2000 Marker bands are 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp in sequence; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, BC3F1 individual plants; 13, Mengmai 023; 14, Shannong 2-16).

[0022] Figure 3 Detection results of molecular marker K-7415 in the BC3F3 population samples of wheat-Thinopyrum elongatum short fragment translocation lines (M, DL2000 Marker bands are 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp in sequence; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, BC3F3 individual plants; 13, Mengmai 023; 14, Shannong 2-16).

[0023] Figure 4 Phenotypes of the resistance identification of basal stalk rot in individual plants with different molecular marker K-7415 genotypes in the BC3F2 population of wheat-Thinopyrum elongatum short fragment translocation lines. Detailed implementation manners

[0024] The above content of the present invention will be further described in detail through specific embodiments below. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention belong to the technical scope of the present invention.

[0025] Example 1 Development of molecular marker K-7415

[0026] Through Primer Premier 6.0 software, primers were designed according to the conserved sequence segments around the Fhb7 gene in the Thinopyrum elongatum genome database ( Figure 1 ), genomic DNA of wheat and Thinopyrum elongatum were extracted respectively, and through PCR amplification and sequencing analysis, the obtained amplified sequence was from Thinopyrum elongatum, thus designing specific primers for identifying the Fhb7 gene.

[0027] Example 2 Transfer and utilization of wheat basal stalk rot resistance gene Fhb7 with the assistance of molecular marker K-7415

[0028] In January 2016, at Shandong Agricultural University, generation addition was carried out using an artificial climate chamber. The wheat-Thinopyrum ponticum short segment translocation line Shanong 2-16 carrying Fhb7 was used as the donor parent, and the wheat variety Mengmai 023 susceptible to stem base rot was used as the recurrent parent. Combining molecular marker-assisted selection, backcrossing was continuously carried out 3 times to obtain the BC3F1 population. During each backcross process, molecular marker K-7415 was used for assisted selection to retain the wheat-Thinopyrum ponticum short segment translocation line hybrids carrying Fhb7. The single plants of the BC3F1 generation carrying Fhb7 were self-crossed once to obtain the BC3F2 population and planted in the artificial climate chamber. The stem base rot resistance of the single plants was identified by inoculating with diseased wheat grains ( Figure 4 ), and the single plants with good agronomic traits and good resistance to Fusarium head blight were retained. Harvesting was carried out by single plant to obtain BC3F3 seeds. 12 seeds were taken from each single plant for molecular marker-assisted detection. If all carried the Fhb7 gene, it was proved that the single plant was a homozygous material ( Figure 3 ), and it was sown in the field continuously and purified by conventional methods.

[0029] A molecular marker for detecting the wheat stem base rot resistance gene Fhb7 according to the present invention, wherein the primers include:

[0030] Primer sequence K-7415F: TTATCTGTCACGAGCATAGGC (SEQ ID NO.1);

[0031] Primer sequence K-7415R: AGTATTCTTCTTGAGGCGAGTC (SEQ ID NO.2).

[0032] A method for identifying the wheat stem base rot resistance genotype based on the molecular marker K-7415 according to the present invention includes the following steps:

[0033] (1) Extract the genomic DNA of the sample by the CTAB method;

[0034] The specific steps for extracting the DNA of wheat samples by the CTAB method are as follows:

[0035] Cut 2-3 cm of wheat leaves and put them into a 2 mL centrifuge tube. After freezing the leaves with liquid nitrogen, quickly grind them into powder. Add 400 μL of CTAB extraction buffer preheated to 65 °C and incubate in a water bath at 65 °C for 45 min. Then, add an equal volume of chloroform, mix well and let stand for 3 min. Centrifuge at 12000 rpm for 10 min and extract 350 μL of the supernatant. Add 350 μL of isopropanol and 35 μL of sodium acetate, mix well and let stand for 15 min. Subsequently, centrifuge at 12000 rpm for 10 min, pour off the supernatant, and the precipitate is genomic DNA. Wash the precipitate twice with 500 μL of 70% ethanol, dissolve the precipitate with water and store it at low temperature for standby.

[0036] (2) Perform PCR amplification using the extracted DNA as a template;

[0037] The PCR reaction system described above includes: 1 μL of DNA template, 7.5 μL of 2× Taq Master Mix, 1 μL each of primers K-7415F and K-7415R with a concentration of 10 μmol / L, and water is added to make up to 15 μL.

[0038] The PCR reaction program is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, for 35 cycles; 72°C for 10 min.

[0039] (3) Detect the PCR products using 1% agarose gel.

[0040] [[ID=1,4]]Analysis of the electrophoresis results shows that primers K-7415F and K-7415R amplified a 165-bp band, indicating that the individual plants 1, 3, 4, 5, 7, 8, 9, 10, 11, 12 of the BC3F1 generation of the wheat-Thinopyrum ponticum short segment translocation line carry the Fhb7 gene; the inability to amplify a band indicates that the individual plants 2, 6 of the BC3F1 generation of the wheat-Thinopyrum ponticum short segment translocation line do not contain the Fhb7 gene ( Figure 2 ) Primers K-7415F and K-7415R can amplify a 165-bp band in the individual plants 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 of the BC3F3 generation of the wheat-Thinopyrum ponticum short segment translocation line, indicating that all individual plants of the BC3F3 generation of the wheat-Thinopyrum ponticum short segment translocation line carry the Fhb7 gene, proving that the individual plants of the BC3F2 generation that produced this BC3F3 generation population are homozygotes ( Figure 3 ).

Claims

1. A molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7, characterized in that: In the molecular marker, the primer sequence K-7415F is the sequence shown in SEQ ID NO.1, and the primer sequence K-7415R is the sequence shown in SEQ ID NO.2; SEQ ID NO.1: TTATCTGTCACGAGCATAGGC; SEQ ID NO.2: AGTATTCTTCTTGAGGCGAGTC; Using primers K-7415F and K-7415R for amplification PCR and band detection, a 165bp DNA band is amplified, and the sequence of the 165bp DNA band is 155-319bp in the 400bp sequence shown in SEQ ID NO.

3.

2. Application of a molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7 in identifying the fusarium crown rot resistance genotype of wheat-Thinopyrum ponticum short fragment translocation lines.

3. Use of a molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7 according to claim 2, characterized in that, The application in identifying the genotype of wheat-Thinopyrum elongatum short fragment translocation line resistant to stem base rot is as follows: Using primers K-7415F and K-7415R for PCR amplification and band detection, a 165-bp DNA band is amplified, indicating that the test sample contains Fhb7 gene; No band can be amplified, indicating that the test sample does not contain Fhb7 gene.

4. Use of a molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7 according to claim 3, characterized in that The PCR amplification and band detection include the following steps: (1) Extract the genomic DNA of the sample by the CTAB method; (2) Perform PCR amplification using the extracted DNA as a template; (3) Detect the PCR product by 1% agarose gel.

5. Use of a molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7 according to claim 4, characterized in that, The reaction system of the PCR includes: 1 μL of DNA template, 7.5 μL of 2 × Taq Master Mix, 1 μL each of primers K-7415F and K-7415R with a concentration of 10 μmol / L, and add water to 15 μL.

6. Use of a molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7 according to claim 4, characterized in that: The reaction program of the PCR is 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 10 min.

7. Application of a molecular marker for detecting the wheat fusarium crown rot resistance gene Fhb7 in molecular breeding for wheat fusarium crown rot resistance.