Primer set for background screening of chromosome 18 in tobacco plants resistant to leaf blight and its application

By developing SNP markers and KASP primer combinations for breeding tobacco resistant to leaf blight, and utilizing PCR amplification and fluorescence signal detection, the problems of long breeding cycles and high costs in existing technologies have been solved, enabling rapid and accurate background screening and improving breeding efficiency.

CN115927717BActive Publication Date: 2025-11-14YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202211021293.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-24
Publication Date
2025-11-14
Estimated Expiration
2042-08-24

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively utilize co-dominant KASP markers for background selection in tobacco leaf spot disease breeding, resulting in long breeding cycles, high costs, and difficulty in quickly and accurately achieving targeted improvement of leaf spot disease resistance in major flue-cured tobacco varieties.

Method used

We developed a combination of SNP markers and KASP primers for breeding tobacco resistant to leaf blight. By PCR amplification and fluorescence signal detection, we rapidly screened out leaf blight-resistant tobacco plants with a background on chromosome 18 of the backcross parent K326 tobacco. We then used the linkage relationship of SNP loci for accurate background screening.

Benefits of technology

It achieves efficient, low-cost, and automated detection of background recovery rate in single plants, shortens the breeding cycle, improves breeding efficiency, and ensures that the entire chromosome contains only the genotype of the backcross parent, making it suitable for large-scale screening of tobacco breeding resistant to leaf blight.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003814276440000071
    Figure BDA0003814276440000071
  • Figure BDA0003814276440000072
    Figure BDA0003814276440000072
  • Figure BDA0003814276440000081
    Figure BDA0003814276440000081
Patent Text Reader

Abstract

This invention belongs to the field of tobacco breeding and relates to a primer set for screening chromosome 18 background in tobacco plants resistant to leaf spot wilt and its application. A PCR primer set for screening breeding background in leaf spot wilt-resistant tobacco is provided, comprising a first PCR primer set and / or a second PCR primer set; the first PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:1-3; the second PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:4-6; the leaf spot wilt-resistant tobacco is the offspring of a cross and backcross between the donor parent *Polygonum polara* and the recipient parent *Polygonum cuspidatum*. The primer set of this invention can be used for early-generation screening of leaf spot wilt-resistant tobacco with a *Polygonum cuspidatum* background (K326), greatly shortening the breeding cycle for targeted improvement of *Polygonum cuspidatum* resistance in *Polygonum cuspidatum* and improving breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of tobacco breeding and relates to primer sets used to identify the genotypes of the donor parent Polarta and the backcross parent K326 in the backcross breeding of leaf spot resistant tobacco, especially primer sets used for background screening of chromosome 18 in leaf spot resistant tobacco and their application in the targeted improvement of K326 tobacco against leaf spot resistant tobacco or the breeding of leaf spot resistant tobacco varieties. Background Technology

[0002] In crop production, some superior varieties excel in many important traits such as yield and agronomy. However, due to poor performance in certain traits (such as disease resistance and insect resistance), their yield and quality potential is often difficult to fully realize, thus restricting large-scale planting. Targeted variety improvement involves using backcrossing to introduce the superior target trait from the donor to the recurrent parent variety, while maintaining other superior traits possessed by the recurrent parent. This is an effective and important breeding method for breeders to improve single or a few undesirable traits in varieties. The improved variety retains the same genetic background and other traits as the original superior variety, representing an upgraded version.

[0003] In modern breeding, marker-assisted selection has significantly accelerated the process of targeted improvement breeding. In particular, marker-assisted backcross background selection utilizes molecular markers to select individual plants with genomes identical to the recurrent parents in the backcross progeny, reducing the number of backcross generations and achieving targeted improvement within a short timeframe. Theoretically, marker-assisted backcross breeding is the fastest and optimal breeding scheme for targeted improvement of traits controlled by single or multiple major genes. Compared to conventional backcross breeding for targeted improvement, marker-assisted backcross background selection allows improved varieties to enter the market sooner.

[0004] Tobacco spotted wilt disease (TSWD) is a serious disease caused by infection with viruses of the genus *Orthotospoviruses*. Tomato spotted wilt virus (TSWV) is a representative species of this genus. *Nicotiana alata*, a wild species of the *Nicotiana* genus, exhibits excellent resistance to TSWV and is currently the only usable source of resistance to TSWV. Gajos et al. successfully used *Nicotiana otophora* as a bridging parent to transfer the TSW resistance gene locus (RTSW locus, where RTSW is...) to the TSW locus. R esistance to TSWThe term "Polalta" (abbreviated as V) was used to breed 'Polalta', a breeding material resistant to leaf spot wilt, from wild tobacco (N. alata) to cultivated tobacco (N. tabacum L.). 'Polalta' is a European strain with dark-colored air-cured tobacco lineage, exhibiting significant background differences from the dominant flue-cured tobacco strains in the Chinese and international markets. While hybridization using Polarta as the male parent and the main flue-cured tobacco variety K326 as the female parent can yield leaf spot wilt-resistant tobacco with agronomical traits indistinguishable from the main variety, differences in metabolic products and chemical composition still exist between the resulting resistant tobacco and the main variety, posing a risk that the style characteristics may not fully meet the requirements of flue-cured tobacco industrial production. To mitigate this risk in flue-cured tobacco varieties improved for leaf spot wilt, backcrossing with leaf spot wilt-resistant tobacco is necessary to directionally improve the leaf spot wilt resistance of main flue-cured tobacco varieties. Using molecular markers for backcrossing-assisted background selection can accelerate the process of directionally improving leaf spot wilt resistance in flue-cured tobacco.

[0005] Single nucleotide polymorphisms (SNPs) are widely distributed throughout the genome and are the most common form of genetic variation among plant individuals. Common SNPs include base substitutions, transversions, insertions, and deletions. While most SNPs, widely distributed throughout the genome, do not directly determine phenotype, their close linkage to phenotype-determining loci makes them important molecular markers. SNPs have become one of the most ideal molecular markers for studying the genetics of complex traits in plants.

[0006] Kompetitive allele-specific PCR (KASP) is a method of SNP genotyping that uses specific matching of primer terminal bases. The basic principle is that two primers with different terminal bases each carry a fluorescent adapter sequence. Based on the different fluorescent signals carried by the amplified products, a large number of samples can be rapidly detected, and their genotypes accurately determined. Since its introduction, KASP technology has rapidly gained market share due to its high flexibility, accuracy, and cost-effectiveness, playing an important role in crop-assisted breeding.

[0007] Currently, there are no reports on the use of codominant KASP markers for background selection in the backcross breeding of tobacco varieties resistant to leaf blight. Developing codominant specific KASP molecular markers based on foreground donor parents and background backcross parents would enable rapid, accurate, low-cost, high-throughput, and automated detection of background reversion rates in backcross individual plants, accelerating the targeted improvement of leaf blight resistance in major flue-cured tobacco varieties. Summary of the Invention

[0008] The technical problem to be solved by the present invention is to provide SNP markers, primer combinations and methods for background screening of chromosome 18 in tobacco resistant to leaf blight, so as to promote the targeted improvement of K326 tobacco resistance to leaf blight.

[0009] To address the aforementioned technical problems, this invention provides a PCR primer set for background screening in tobacco breeding resistant to leaf blight, comprising a first PCR primer set and / or a second PCR primer set.

[0010] The first PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:1-3; the second PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:4-6.

[0011] The resistant leaf spot tobacco is the offspring of a cross between the donor parent, Pollalta tobacco, and the recipient parent, K326 tobacco, and a backcross.

[0012] The first PCR primer set was used to amplify the SNP site at 49668475bp on chromosome 18 of tobacco, where the genotype of Polara tobacco is T and the genotype of K326 tobacco is C.

[0013] The second PCR primer set was used to amplify the SNP site at 50440100 bp on chromosome 18 of tobacco, where the genotype of Polara tobacco is A and the genotype of K326 tobacco is G.

[0014] The location of the SNP site on the chromosome was determined based on the whole genome sequence of tobacco K326.

[0015] The present invention also provides a KASP primer set for background screening in tobacco breeding resistant to leaf blight, comprising a first KASP primer set and / or a second KASP primer set;

[0016] The first KASP primer set consists of three primers: F1-1, F1-2, and R1. F1-1 is formed by tandem a first tag sequence and the nucleotide sequence shown in SEQ ID NO:1 from the 5' end to the 3' end; F1-2 is formed by tandem a second tag sequence and the nucleotide sequence shown in SEQ ID NO:2 from the 5' end to the 3' end; and the nucleotide sequence of R1 is shown in SEQ ID NO:3.

[0017] The second KASP primer set consists of three primers: F2-1, F2-2, and R2. F2-1 is formed by tandemly connecting a first tag sequence with the nucleotide sequence shown in SEQ ID NO:4 from the 5' end to the 3' end; F2-2 is formed by tandemly connecting a second tag sequence with the nucleotide sequence shown in SEQ ID NO:5 from the 5' end to the 3' end; and the nucleotide sequence of R2 is shown in SEQ ID NO:6.

[0018] The first tag sequence and the second tag sequence have different nucleotide sequences and are not from the same origin as the tobacco genome sequence;

[0019] The resistant leaf spot tobacco is the offspring of a cross between the donor parent, Pollalta tobacco, and the recipient parent, K326 tobacco, and a backcross.

[0020] The first KASP primer set was used to amplify the SNP site at 49668475bp on the 18th chromosome of tobacco, where the genotype of Polara tobacco is T and the genotype of K326 tobacco is C.

[0021] The second KASP primer set was used to amplify the SNP site at 50440100 bp on the tobacco chromosome 18, where the genotype of Polara tobacco is A and the genotype of K326 tobacco is G.

[0022] The location of the SNP site on the chromosome was determined based on the whole genome sequence of tobacco K326.

[0023] The present invention provides a kit comprising the above-described PCR primer combination or the above-described KASP primer combination.

[0024] In some embodiments of the present invention, the kit comprises the above-described KASP primer combination and PCR premix; the PCR premix comprises a first fluorescent probe, a first quenching probe, a second fluorescent probe, and a second quenching probe;

[0025] The nucleotide sequence of the first fluorescent probe is identical to that of the first tag sequence in the KASP primer set, and a first fluorescent group is attached to its 5' end; the nucleotide sequence of the first quencher probe is inversely complementary to the nucleotide sequence of the first tag sequence, and a quencher group is attached to its 3' end.

[0026] The nucleotide sequence of the second fluorescent probe is identical to that of the second tag sequence in the KASP primer set, and a second fluorescent group is attached to its 5' end; the nucleotide sequence of the second quencher probe is inversely complementary to the nucleotide sequence of the second tag sequence, and a quencher group is attached to its 3' end.

[0027] In some embodiments of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM; and the second fluorescent group is HEX.

[0028] The application of the above-mentioned PCR primer combination, KASP primer combination, or kit in the breeding of tobacco resistant to leaf blight is also within the scope of protection of this invention.

[0029] This invention provides a method for screening breeding backgrounds for tobacco resistant to leaf blight, comprising the following steps:

[0030] a) Extracting DNA from tobacco plants resistant to leaf blight;

[0031] b) The DNA of the resistant tobacco leaf blight was amplified by PCR using the above-mentioned PCR primer set;

[0032] c) Detect the amplification results, determine the genotype of the SNP site amplified by each PCR primer set of the resistant tobacco, and screen for resistant tobacco with the SNP site K326 genotype.

[0033] The resistant leaf spot tobacco is the offspring of a cross between the donor parent, Pollalta tobacco, and the recipient parent, K326 tobacco, and a backcross.

[0034] This invention also provides a method for screening breeding backgrounds for tobacco resistant to leaf blight, which includes the following steps:

[0035] a) Extracting DNA from tobacco plants resistant to leaf blight;

[0036] b) Add the above-mentioned KASP primer set and PCR premix to the DNA of the resistant tobacco leaf blight to perform KASP amplification;

[0037] The PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe, and a second quenching probe.

[0038] The nucleotide sequence of the first fluorescent probe is identical to that of the first tag sequence in the KASP primer set, and a first fluorescent group is attached to its 5' end; the nucleotide sequence of the first quencher probe is inversely complementary to the nucleotide sequence of the first tag sequence, and a quencher group is attached to its 3' end.

[0039] The nucleotide sequence of the second fluorescent probe is identical to that of the second tag sequence in the KASP primer set, and a second fluorescent group is attached to its 5' end; the nucleotide sequence of the second quencher probe is inversely complementary to the nucleotide sequence of the second tag sequence, and a quencher group is attached to its 3' end.

[0040] c) Detect fluorescence signals to determine the genotype of the SNP sites amplified by each KASP primer set in the resistant tobacco, and screen for resistant tobacco with the SNP site K326 genotype.

[0041] The resistant leaf spot tobacco is the offspring of a cross between the donor parent, Pollalta tobacco, and the recipient parent, K326 tobacco, and a backcross.

[0042] In some embodiments of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM; and the second fluorescent group is HEX.

[0043] In some embodiments of the present invention, during the KASP amplification,

[0044] The PCR system includes: DNA template, KASP primer working solution, and KASP-TF V4.0 2X Master Mix;

[0045] The PCR program is as follows: Step 1, pre-denaturation at 95℃ for 15 min; Step 2, denaturation at 95℃ for 20 s, followed by 65-57℃ (decreasing by 1℃ per cycle) for 60 s, for a total of 9 cycles; Step 3, denaturation at 95℃ for 20 s, followed by annealing at 57℃ for 1 min, for a total of 32 cycles.

[0046] Experiments have demonstrated that using the KASP primer set developed in this invention, PCR amplification is performed using the genomic DNA of the target tobacco as a template. Genotyping of the PCR amplification products is then performed by fluorescence signal detection. If the genotype of the target tobacco is identical to that of the backcross parent K326, it indicates that the target tobacco does not contain the donor parent's Polarta genotype at that locus or nearby linked sites. This allows for the rapid acquisition of leaf spot wilt-resistant tobacco with a background on chromosome 18 of the backcross parent K326. Screening using continuously distributed SNP markers on a single chromosome ensures that the entire chromosome contains only the backcross parent's genotype. Compared to traditional marker screening, the SNP-KASP primer set developed in this invention offers advantages such as high accuracy, low cost, and high detection efficiency, making it suitable for large-scale screening in leaf spot wilt-resistant tobacco breeding. The identification method using the SNP-KASP primer set of this invention can perform early-generation screening for leaf spot wilt-resistant tobacco breeding backgrounds, significantly shortening the breeding cycle for targeted improvement of K326 tobacco against leaf spot wilt and improving breeding efficiency.

[0047] The term "RTSW locus" or "anti-blight wilt gene locus" used in this invention refers to a DNA segment containing the RTSW gene, which confers resistance to tobacco leaf spot disease in both heterozygous and homozygous states. The "RTSW gene" refers to a gene derived from the genome of winged tobacco (N. alata) that confers resistance to leaf spot disease on plants. Attached Figure Description

[0048] Figure 1 The results of SNP genotyping using the two SNP-KASP primer sets of this invention are shown. In the genotyping results of each primer set, the genotype of parent 1 is obtained after amplification of two homozygous K326 parents, the genotype of parent 2 is obtained after amplification of two homozygous Polarta parents, the heterozygous genotype is obtained after amplification of the F1 generation of three Polarta×K326 hybrids, and the negative result is obtained from ultrapure water without DNA.

[0049] Figure 2 This data represents the results of chromosome 18 background screening using the two SNP-KASP primer sets of this invention in the segregating progeny population of tobacco resistant to leaf blight. In the genotyping results for each primer set, the sample within the upper left dashed circle is homozygous for the K326 genotype, the sample within the lower right dashed circle is homozygous for the Polarta genotype, the sample within the dashed circle on the middle diagonal is heterozygous, and the sample within the lower left dashed circle is an unamplified sample. A total of 384 samples were collected, including 376 DNA samples from tobacco resistant to leaf blight, 2 DNA samples from Polarta, 2 DNA samples from K326, 2 DNA samples from Polarta×K326 F1, and 2 samples of ultrapure water without added DNA (as a negative control). Detailed Implementation

[0050] The present invention will now be described in further detail with reference to the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them.

[0051] For any specific techniques or conditions not specified in the following examples, the techniques or conditions described in the literature in this field or in accordance with the product instructions shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased.

[0052] The tobacco materials used in the following examples:

[0053] Polarta is a TSWV-resistant tobacco material containing the RTSW resistance gene locus, and it has been described in non-patent literature (Laskowska D, A,2010.TSWV resistance in DH lines of tobacco(Nicotianatabacum L.)obtained from a hybrid between'Polalta'and This tobacco material is disclosed in Plant Breeding 129, 731-3. The public can obtain it from tobacco germplasm resource conservation institutions.

[0054] K326 is a main flue-cured tobacco variety that does not contain the resistance gene locus for leaf spot disease (RTSW locus). Its genome sequence is publicly available in non-patent literature (Edwards et al., 2017, A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. Bmc Genomics 18, 448.). The public can obtain its reference genome sequence from the website (https: / / solgenomics.net / organism / Nicotiana_tabacum / genome), and the tobacco material can be obtained from tobacco germplasm resource conservation institutions.

[0055] The F1 generation plants obtained by crossing Polara (♂) with K326 (♀) (K326×Polalta F1), the segregating population obtained by backcrossing K326×Polalta F1 (♂) with K326 (♀) for 7 generations (K326×Polalta BC7F1), the non-linkage-burden-resistant leaf spot wilt-resistant tobacco plant (single plant No. 12, with genotype RTSW / rtsw) obtained from K326×Polalta BC7F1, and the segregating population obtained by backcrossing single plant No. 12 (♂) with K326 (♀) for 1 generation (K326×Polalta BC8F1) were all created by our research group and are preserved at the Yunnan Academy of Tobacco Agricultural Sciences. The screening process for the leaf blight resistant tobacco (single plant No. 12) is detailed in the international patent application PCT / CN2021 / 129382, entitled "Leadership-free leaf blight resistant tobacco plants and their breeding methods," and the Chinese patent application 202111311707.0, entitled "Molecular markers for screening leaf blight resistant tobacco plants without linkage burdens and their applications." The entire contents of these two patent applications are incorporated herein by reference. Previous research results indicate that the agronomic traits of leaf blight resistant tobacco plants with broken linkage burdens are not significantly different from those of K326, and they can be used for leaf blight resistance breeding in tobacco, thus formally entering the commercial breeding process.

[0056] The main reagents used in the following examples are:

[0057] The KASP-TF V4.0 2X Master Mix reagent (catalog number LGC-KBS-1050-132) was purchased from LGCBiosearch. The universal genomic DNA extraction kit using magnetic beads (catalog number DP705) was purchased from Tiangen Biotech Co., Ltd.

[0058] Example 1. Obtaining SNP markers for background screening in tobacco breeding for resistance to leaf blight.

[0059] To obtain leaf spot wilt-resistant tobacco plants from the crosses and backcrosses of Polarta (♂) and K326 (♀) with a chromosomal background as consistent as possible with K326, except for the RTSW locus, it is necessary to develop SNP markers for screening the breeding background of leaf spot wilt-resistant tobacco. Therefore, we used the donor parent Polarta, the recipient parent K326, and previously obtained leaf spot wilt-resistant tobacco plants for marker development.

[0060] We performed whole-genome resequencing on Polarta, K326, and wilt-resistant tobacco (single plant No. 12). The sequencing platform was BGISEQ-500, and the sequencing strategy was PE100. By filtering the raw data, comparing it with the cultivated tobacco reference genome, and detecting SNP variation information, we filtered the SNPs of the two parents (K326 and Polarta), obtaining a total of 50,009 high-quality (GQ (quality value) ≥ 40) SNPs between the two parents, which are distributed across all 24 chromosomes (Table 1).

[0061] Table 1. SNP distribution of the two parents and single plant No. 12

[0062]

[0063] Resequencing SNP analysis of single plant 12 showed that the vast majority of SNP loci were heterozygous, and the SNP genotype characteristics were consistent with backcrossing. After seven generations of backcrossing, over 97% of the loci in the genome were identical to the backcross parent K326. In addition to the 106 heterozygous SNP loci containing RTSW loci on chromosome 12 (chr12), there were also 1257 homozygous or heterozygous SNP loci identical to the donor parent Polarta. Markers need to be designed for screening in the next segregating population.

[0064] The resequencing results show that the ends of chromosome 18 (chr18) contain a relatively dense fragment of donor parental origin. 62 high-confidence SNP sites are continuously distributed at 48193005-60370884 bp on chromosome 18, with a size of approximately 12 Mb (Table 2).

[0065] Table 2. Distribution of SNP sites on chr18

[0066]

[0067]

[0068] In the table, R, M, Y, W, K, and S represent heterozygous genotypes. Specifically, R = A / G, M = A / C, Y = C / T, W = A / T, K = G / T, and S = C / G. The location of the SNP locus on chromosome 18 was determined based on the complete genome sequence of tobacco K326. The complete genome sequence of tobacco K326 can be found at https: / / solgenomics.net / organism / Nicotiana_tabacum / genome.

[0069] In order to screen out exchanged individual plants from the segregating population and ultimately obtain plants in this segment that contain only the background of the recurrent parent K326, we selected 9 SNP loci and designed the SNP-KASP primer set.

[0070] Nine sets of SNP-KASP primers were screened using two homozygous parents (K326 and Polarta) and their F1 hybrids, with ultrapure water without DNA as a negative control. The steps are as follows:

[0071] Preparation of KASP primer working solution: Take 12 μL (100 μM) each of the upstream primer (first upstream primer and second upstream primer) and 30 μL (100 μM) of the downstream primer, and make up to 100 μL with sterile ultrapure water. Mix thoroughly to obtain the KASP primer working solution.

[0072] PCR system: 2 μL DNA template (approximately 30 ng / μL), 0.08 μL KASP primer working solution, 2.5 μL KASP-TF V4.0 2X Master Mix (LGC Corporation, catalog number LGC-KBS-1050-132), and add sterile ultrapure water to a final volume of 5 μL.

[0073] PCR program: Step 1, pre-denaturation at 95℃ for 15 min; Step 2, denaturation at 95℃ for 20 s, followed by annealing at 65-57℃ (decreasing by 1℃ per cycle) for 60 s, for a total of 9 cycles; Step 3, denaturation at 95℃ for 20 s, followed by annealing at 57℃ for 1 min, for a total of 32 cycles; store at 10℃.

[0074] The experiment also included a blank control (NTC) without DNA template in the PCR system, with one blank control set for each primer set.

[0075] The PCR results are as follows: After the reaction, the amplified products were amplified using a fluorescence microplate reader (BMG Labtech, Germany, FLUOstar OPTIMA). SNPviewer software was used to read the fluorescence signal data and determine the genotype. If the fluorescence signal data of the amplified product of the tested tobacco showed blue near the X-axis according to SNPviewer software analysis, the genotype of the tested tobacco was Polarta parental; if the fluorescence signal data of the amplified product of the tested tobacco showed red near the Y-axis according to SNPviewer software analysis, the genotype of the tested tobacco was K326 parental; if the fluorescence signal data of the amplified product of the tested tobacco showed green near the diagonal according to SNPviewer software analysis, the genotype of the tested tobacco was heterozygous; the fluorescence signal data of the amplified product of the negative control showed black near the origin according to SNPviewer software analysis.

[0076] The optimal combination of SNP genotyping results was selected based on genotype consistency, good genotyping efficiency, and uniform distribution on the chromosome. Two SNP markers were ultimately determined for background screening on chromosome 18 of tobacco resistant to leaf blight. Basic information on the KASP primer sets used to detect these two SNP markers is detailed in Table 3. The results of SNP genotyping using the two KASP primer sets are as follows: Figure 1 As shown.

[0077] Table 3 SNP-KASP primer set used for chr18 chromosome background selection.

[0078]

[0079] The SNP-KASP primer set used for chr18 chromosome background selection consists of two primer sets, designated SNP-KASP primer set 1 and SNP-KASP primer set 2. Each primer set consists of three primers: a first upstream primer, a second upstream primer, and a downstream primer, used to amplify one SNP locus. The SNP genotype with the last base of the 3' end of the first upstream primer being Polara is indicated by an uppercase letter in parentheses of the primer name; the SNP genotype with the last base of the 3' end of the second upstream primer being K326 is indicated by a lowercase letter in parentheses of the primer name. In each primer set, the 5' end of the first upstream primer contains a FAM fluorescent tag sequence (GAAGGTGACCAAGTTCATGCT) (SEQ ID NO:11), and the 5' end of the second upstream primer contains a HEX fluorescent tag sequence (GAAGGTCGGAGTCAACGGATT) (SEQ ID NO:12). The fluorescent tag sequences in the primers are underlined in Table 3, while sequences without underlining are genome-specific sequences. The numbers in the primer names indicate the location of the SNP site amplified by that primer set on chromosome 18. Specifically, SNP-KASP primer set 1 amplifies the SNP site at 49668475 bp on chromosome 18, and SNP-KASP primer set 2 amplifies the SNP site at 50440100 bp on chromosome 18. The chromosomal locations of these SNP sites were determined based on the complete genome sequence of Nicotiana tabacum K326. The complete genome sequence of Nicotiana tabacum K326 can be found at https: / / solgenomics.net / organism / Nicotiana_tabacum / genome.

[0080] Example 2. Validation of SNP markers used for background screening in tobacco breeding for resistance to leaf blight.

[0081] The SNP markers obtained in Example 1 for background screening of chromosome 18 in tobacco plants resistant to leaf blight were verified using the segregating population BC1F1 (i.e., K326×PolaltaBC8F1) obtained by backcrossing single plant 12 with K326.

[0082] First, plants containing the RTSW locus were screened from the K326×Polalta BC8F1 segregating population. Using our previously established method for identifying non-virulence gene infiltration, 800 individual plants from the K326×Polalta BC8F1 segregating population were assessed for resistance to Tomato Leaf Spot Virus (SBS). The method for identifying non-virulence gene infiltration is described in Chinese Patent (Patent No. ZL201710414755.X, Invention Title: "A Method for Identifying Tobacco Resistance Using the Tomato Leaf Spot Virus NSm Gene"), the entire contents of which are incorporated herein by reference. The specific operational steps are as follows:

[0083] (1) Agrobacterium EHA105 containing the non-toxic gene NSm expression vector was cultured in Agrobacterium tumefaciens medium LB at 28°C for 24 hours, the cells were collected by centrifugation, and then diluted with infiltration buffer (10 mmol / L MgCl2, 10 mmol / L MES, 200 μmol / L acetosyringone) to form a cell suspension with OD600 = 0.5.

[0084] (2) Using a sterile syringe with the needle removed, inject 9.5-10.5 μL of bacterial suspension from the underside of the leaves of the tobacco plant into the interveinal spaces to form a visible infiltration spot; place the inoculated tobacco plant in an environment of 20-28℃ and 80% humidity, and alternate between continuous light for 16 hours and continuous darkness for 8 hours, for a total of 72 hours of observation.

[0085] (3) Observe that if the tobacco test host produces a hypersensitive reaction (HR) induced by the differential strain containing the non-toxic gene NSm expression vector, then the tobacco test host is confirmed to be a disease-resistant variety relative to the non-toxic gene NSm.

[0086] The NSm-mediated disease resistance identification results showed that among the 800 individual plants in the K326×Polalta BC8F1 segregating population, 415 plants produced an HR response and were TSWV resistant (represented by RTSW), 380 plants did not produce an HR response and were TSWV susceptible (represented by rtsw), and the remaining 5 plants were not included in the statistics because they were too small to be suitable for HR testing.

[0087] We selected 376 plants from 415 HR-positive plants and extracted total DNA from each plant using a universal genomic DNA extraction kit (Tiangen Biotech, DP705) based on magnetic beads. The results of NSm-mediated resistance identification were validated using our previously developed wilt resistance marker NaChr3_59M (see international patent application PCT / CN2021 / 129382 and Chinese patent application 202111311707.0). The results showed that only three plants out of the 376 plants did not match the NSm-mediated resistance identification results, indicating that the accuracy of the NSm-mediated resistance identification method was greater than 99.2%.

[0088] KASP detection was performed on the DNA of 376 HR-positive plants using the two SNP-KASP primer sets shown in Table 3 of Example 1. Two homozygous parents (K326 and Polarta) and their F1 hybrids were used as controls, and ultrapure water without added DNA was used as a negative control. The KASP detection method was the same as in Example 1. The detection results are shown in Table 4 and... Figure 2 As shown.

[0089] Table 4. SNP genotyping results of tobacco plants resistant to leaf blight.

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099] In the table, samples numbered 1-376 are DNA samples from 376 HR-positive plants; samples numbered 377 and 378 are Polara DNA samples; samples numbered 379 and 380 are K326 DNA samples; samples numbered 381 and 382 are Polara × K326 F1 DNA samples; and samples numbered 383 and 384 are ultrapure water without added DNA (negative control). A represents the Polara homozygous genotype; B represents the K326 homozygous genotype; H represents the heterozygous genotype; N indicates negative; and "?" indicates no amplification. Pos indicates positive, and Neg indicates negative.

[0100] The results showed that 124 plants with the K326 homozygous genotype and 249 plants with the heterozygous genotype were obtained from 376 individual plants in the segregating population using two SNP-KASP primer sets. The detection results of SNP-KASP primer set 1 and SNP-KASP primer set 2 were basically consistent, with the two markers in the same region mutually verifying each other, indicating high accuracy.

[0101] To verify the accuracy of the SNP markers, we selected six plants (numbered 11, 17, 24, 30, 102, and 109) for resequencing. The sequencing platform used was BGISEQ-500, and the sequencing strategy was PE100. By filtering the raw data, comparing it with the cultivated tobacco reference genome, and detecting SNP variation information, the obtained resequencing data were filtered by comparing it with high-quality SNPs between parents, and the number of SNPs on chr18 for the six individual plants was obtained (Table 5).

[0102] Table 5. Resequencing results of the six individual strains identified by the SNP-KASP primer set.

[0103] Number of SNPs on chr18 Single Plant No. 12 62 Single plant 12BC1F1-11 60 Single plant 12BC1F1-17 4 Single plant 12BC1F1-24 5 Single plant 12BC1F1-30 60 Single plant 12BC1F1-102 62 Single plant 12BC1F1-109 4

[0104] The results showed that three of the six selected monoclonal lines (lines 17, 24, and 109) exhibited a significant reduction in the number of SNPs on chromosome chr18 that were identical to those of the donor parent. The remaining few SNPs may be due to sequencing errors or background noise inherent in the genomic SNP analysis itself. Therefore, it can be confirmed that the entire chr18 chromosome of the backcross monoclonal lines selected using the SNP-KASP primer set of this invention is completely identical to the backcross parent K326. The resequencing results of the other three monoclonal lines (lines 11, 30, and 102) showed heterozygous genotypes, consistent with the detection results of SNP-KASP primer set 1 and SNP-KASP primer set 2. Furthermore, the number of SNPs in this region on these three monoclonal lines was not significantly different from that on line 12, indicating that no exchange or recombination events occurred at this location.

[0105] Therefore, the SNP-KASP primer set developed in this invention can effectively screen tobacco plants resistant to spotted wilt with a chromosome 18 background of the backcross parent K326. It has the advantages of reliability, simplicity and practicality, and has important application prospects in the evaluation of tobacco germplasm resources and the assisted selection of breeding markers. At the same time, it provides a reference for the cultivation of targeted improved tobacco varieties with high resistance to spotted wilt.

[0106] The above embodiments are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. All equivalent changes and modifications made in accordance with the claims of the present invention should be included in the scope of the present invention.

Claims

1. A PCR primer set for background screening in tobacco breeding for resistance to leaf blight, characterized in that, Including the first PCR primer set and the second PCR primer set; The first PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:1-3; the second PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO:4-6. The resistant leaf spot tobacco is the offspring of a cross between the donor parent, Pollalta tobacco, and the recipient parent, K326 tobacco, and a backcross. The first PCR primer set was used to amplify the SNP site at 49668475bp on chromosome 18 of tobacco, where the genotype of Polara tobacco is T and the genotype of K326 tobacco is C. The second PCR primer set was used to amplify the SNP site at 50440100 bp on chromosome 18 of tobacco, where the genotype of Polara tobacco is A and the genotype of K326 tobacco is G. The location of the SNP site on the chromosome was determined based on the whole genome sequence of tobacco K326.

2. A KASP primer combination for background screening in tobacco breeding for resistance to leaf blight, characterized in that, Including the first KASP primer set and the second KASP primer set; The first KASP primer set consists of three primers: F1-1, F1-2, and R1. The nucleotide sequence of F1-1 is shown in SEQ ID NO:7; the nucleotide sequence of F1-2 is shown in SEQ ID NO:8; and the nucleotide sequence of R1 is shown in SEQ ID NO:

3. The second KASP primer set consists of three primers: F2-1, F2-2, and R2. The nucleotide sequence of F2-1 is shown in SEQ ID NO:9; the nucleotide sequence of F2-2 is shown in SEQ ID NO:10; and the nucleotide sequence of R2 is shown in SEQ ID NO:

6. The resistant leaf spot tobacco is the offspring of a cross between the donor parent, Pollalta tobacco, and the recipient parent, K326 tobacco, and a backcross. The first KASP primer set was used to amplify the SNP site at 49668475bp on the 18th chromosome of tobacco, where the genotype of Polara tobacco is T and the genotype of K326 tobacco is C. The second KASP primer set was used to amplify the SNP site at 50440100 bp on the tobacco chromosome 18, where the genotype of Polara tobacco is A and the genotype of K326 tobacco is G. The location of the SNP site on the chromosome was determined based on the whole genome sequence of tobacco K326.

3. A reagent kit, characterized in that, It includes the PCR primer combination as described in claim 1.

4. A reagent kit, characterized in that, It includes the KASP primer combination as described in claim 2.

5. The reagent kit according to claim 4, characterized in that, The kit also includes a PCR premix; the PCR premix contains a first fluorescent probe, a first quencher probe, a second fluorescent probe, and a second quencher probe. The nucleotide sequence of the first fluorescent probe is shown in SEQ ID NO:11, with a first fluorescent group attached to its 5' end; the nucleotide sequence of the first quencher probe is inversely complementary to the nucleotide sequence of the first fluorescent probe, with a quencher group attached to its 3' end. The nucleotide sequence of the second fluorescent probe is shown in SEQ ID NO:12, with a second fluorescent group attached to its 5' end; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, with a quencher group attached to its 3' end.

6. The reagent kit according to claim 5, characterized in that, The first fluorescent group is FAM, and the second fluorescent group is HEX.

7. The application of the PCR primer combination of claim 1, the KASP primer combination of claim 2, or the kit of any one of claims 3-6 in the breeding of tobacco resistant to leaf blight.

8. A method for screening breeding backgrounds for tobacco resistant to leaf blight, characterized in that, Includes the following steps: a) Extracting DNA from tobacco plants resistant to leaf blight; b) Perform PCR amplification of the DNA of the resistant tobacco leaf blight using the PCR primer set described in claim 1; c) Detect the amplification results, determine the genotype of the SNP site amplified by each PCR primer set of the resistant tobacco, and screen for resistant tobacco with the SNP site K326 genotype. The resistant leaf spot tobacco is the offspring of a cross between the donor parent, Pollalta tobacco, and the recipient parent, K326 tobacco, and a backcross.

9. A method for screening breeding backgrounds for tobacco resistant to leaf blight, characterized in that, Includes the following steps: a) Extracting DNA from tobacco plants resistant to leaf blight; b) Add the KASP primer set and PCR premix as described in claim 2 to the DNA of the resistant tobacco leaf blight to perform KASP amplification; The PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe, and a second quenching probe. The nucleotide sequence of the first fluorescent probe is shown in SEQ ID NO:11, with a first fluorescent group attached to its 5' end; the nucleotide sequence of the first quencher probe is inversely complementary to the nucleotide sequence of the first fluorescent probe, with a quencher group attached to its 3' end. The nucleotide sequence of the second fluorescent probe is shown in SEQ ID NO:12, with a second fluorescent group attached to its 5' end; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, with a quencher group attached to its 3' end. c) Detect fluorescence signals to determine the genotype of the SNP sites amplified by each KASP primer set in the resistant tobacco, and screen for resistant tobacco with the SNP site K326 genotype. The resistant leaf spot tobacco is the offspring of a cross between the donor parent, Pollalta tobacco, and the recipient parent, K326 tobacco, and a backcross.

10. The method according to claim 9, characterized in that, The first fluorescent group is FAM, and the second fluorescent group is HEX.

11. The method according to claim 9, characterized in that, In the KASP amplification, The PCR system includes: DNA template, KASP primer working solution, and KASP-TF V4.0 2X Master Mix; The PCR program is as follows: Step 1, pre-denaturation at 95℃ for 15 min; Step 2, denaturation at 95℃ for 20 s, followed by denaturation at 65-57℃ for 60 s, for a total of 9 cycles, with a temperature decrease of 1℃ per cycle; Step 3, denaturation at 95℃ for 20 s, followed by annealing at 57℃ for 1 min, for a total of 32 cycles.

Citation Information

Patent Citations

  • A method for identifying tobacco resistance using the NSm gene of tomato spotted wilt virus

    CN107400674B

  • Molecular markers for screening tobacco plants resistant to spotted wilt without linkage drag and their application

    CN115247218B

  • Detecting method of tomato spotted wilt virus resistant gene SW-5b

    CN109055511A

  • Tobacco SNP marker developed based on whole genome re-sequencing and KASP technology and application thereof

    CN114507747A