An immunomagnetic bead and its application in the separation of renal tubular epithelial cells
By using immunomagnetic beads to conjugate the antibody, the problem of high cost and poor specificity of renal tubular epithelial cells in the prior art is solved, efficient and low-cost tubular epithelial cell isolation is achieved, and the isolation purity and cell activity are improved, which is suitable for the diagnosis and treatment of renal transplant patients.
Patent Information
- Application Number
- CN202110988884.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-08-26
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2041-08-26
AI Technical Summary
The existing tubular epithelial cell sorting methods are costly, have poor specificity or have low isolation purity, making it difficult to meet the needs of clinical diagnosis and treatment.
Using immunomagnetic beads, the efficient separation of renal tubular epithelial cells is achieved by coupling the magnetic beads to antibodies and specifically binding the antigen on the surface of renal tubular epithelial cells.
It realizes efficient, low-cost, and strong specific isolation of renal tubular epithelial cells, improves isolation purity and cell activity, and is suitable for clinical diagnosis and treatment of renal transplant patients.
Smart Images

Figure BDA0003231778070000081 
Figure BDA0003231778070000101
Abstract
Description
Technical Field
[0001] The present invention relates to an immunomagnetic bead and its application in the separation of renal tubular epithelial cells, belonging to the technical field of immunoassay. Background Art
[0002] Renal tubular epithelial cells refer to a layer of cells outside the renal tubules and are also a type of cells with great diagnostic significance in the formed components of urine. In normal urine, renal tubular epithelial cells are relatively rare. If they appear or increase, it may indicate renal tubular lesions or renal tubular necrosis; in chronic kidney diseases, the cell morphology of renal tubular epithelial cells also changes. Therefore, renal tubular epithelial cells are often used as markers for the clinical diagnosis of kidney injury. In addition, the main function of renal tubular epithelial cells is reabsorption. Transporters such as glucose transporter (GLUT) expressed on their cell surface can reabsorb and transport glucose, amino acids, etc. in the primary urine. Studying the changes in the expression and function of various glucose transporters on renal tubular epithelial cells in disease states is also of great significance for understanding their physiological functions and clarifying the pathogenesis of diseases (such as type 2 diabetes).
[0003] Kidney transplant is an effective means for treating end-stage kidney diseases. Among them, antibody-mediated rejection (AMR) is an important factor affecting the survival time of the transplanted kidney and the quality of life of kidney transplant patients after surgery. At present, studies have shown that the occurrence of AMR is closely related to donor specific antibodies (DSA). Therefore, in the current Banff diagnostic criteria, DSA is also used as one of the risk factors for AMR diagnosis.
[0004] DSA is a specific antibody produced in the body of transplant patients against the donor organ and is mainly related to the genotype differences of human leukocyte antigen (HLA) between the donor and the recipient. Monitoring donor specific antibodies after transplantation is beneficial for early detection of the occurrence of AMR and can help patients obtain timely drug prevention and treatment for AMR. However, the lack of donor HLA genotype in clinical practice affects the determination of DSA.
[0005] Renal tubular epithelial cells in the urine of kidney transplant patients are derived from the transplanted donor kidney. Therefore, by enriching and sorting renal tubular epithelial cells in urine, the genotype of the donor can be detected, providing more detailed, accurate and valuable information for the clinical practice after kidney transplantation and also providing more meaningful guidance for the diagnosis and treatment in kidney transplant clinics.
[0006] Currently, the commonly used methods for sorting renal tubular epithelial cells mainly include flow cytometry sorting, sucrose density gradient centrifugation cell separation, membrane filtration separation, etc. Among them, flow cytometry sorting requires professional instruments and has the defect of high cost; sucrose density gradient centrifugation cell separation has the defect of poor specificity; membrane filtration separation has the defect of low separation purity. Therefore, there is an urgent need to find a method for sorting renal tubular epithelial cells with low cost, strong specificity and high separation purity to overcome the defects of existing renal tubular epithelial cell sorting methods. Summary of the Invention
[0007] To solve the above problems, the present invention provides an immunomagnetic bead, which is used for separating renal tubular epithelial cells in a sample. The immunomagnetic bead includes a magnetic bead and an antibody conjugated to the magnetic bead; the antibody can specifically bind to the surface antigen of renal tubular epithelial cells.
[0008] In one embodiment of the present invention, the magnetic bead is at least one of tosyl magnetic beads, carboxyl magnetic beads, streptavidin magnetic beads or epoxy magnetic beads.
[0009] In one embodiment of the present invention, the magnetic bead is tosyl magnetic bead.
[0010] In one embodiment of the present invention, the particle size of the magnetic bead is 3 - 5.5 μm.
[0011] In one embodiment of the present invention, the particle size of the magnetic bead is 4.5 μm.
[0012] In one embodiment of the present invention, the antibody is sodium-dependent glucose transporter 2 antibody (Anti-SGLT2).
[0013] In one embodiment of the present invention, the coupling ratio of the antibody to the magnetic bead is 5 - 50 μg:1 mg.
[0014] In one embodiment of the present invention, the coupling ratio of the antibody to the magnetic bead is 30 μg:1 mg.
[0015] The present invention also provides a method for preparing the above immunomagnetic bead, and the method is: coupling the magnetic bead and an antibody that can specifically bind to renal tubular epithelial cells.
[0016] In one embodiment of the present invention, the coupling is: incubating the magnetic bead and an antibody that can specifically bind to renal tubular epithelial cells in a buffer solution.
[0017] In one embodiment of the present invention, the buffer solution is at least one of PBS buffer solution or Tris-Hcl buffer solution.
[0018] In one embodiment of the present invention, the buffer is PBS buffer.
[0019] In one embodiment of the present invention, the concentration of the buffer solution is 0.01 to 0.1 M and the pH is 7 to 7.4.
[0020] In one embodiment of the present invention, the concentration of the buffer solution is 0.1 M and the pH is 7.4.
[0021] In one embodiment of the present invention, the incubation temperature is 25-35° C. and the incubation time is 16-24 h.
[0022] In one embodiment of the present invention, the concentration of the magnetic beads in the buffer solution is 0.5-2 mg / mL.
[0023] In one embodiment of the present invention, the concentration of the antibody in the buffer is 5 to 50 μg / mL.
[0024] The present invention also provides a kit for separating renal tubular epithelial cells in a sample, and the kit comprises the above-mentioned immunomagnetic beads.
[0025] In one embodiment of the present invention, the kit further comprises buffer 1 and buffer 2.
[0026] In one embodiment of the present invention, the buffer 1 is at least one of PBS buffer or Tris-HCl buffer.
[0027] In one embodiment of the present invention, the buffer 1 is PBS buffer.
[0028] In one embodiment of the present invention, the concentration of the buffer solution 1 is 0.01-0.1 M and the pH is 7-7.4.
[0029] In one embodiment of the present invention, the concentration of the buffer solution 1 is 0.1 M and the pH is 7.4.
[0030] In one embodiment of the present invention, the buffer 2 is at least one of a phosphate buffer or a Tris-HCl buffer.
[0031] In one embodiment of the present invention, the buffer 2 is a phosphate buffer.
[0032] In one embodiment of the present invention, the concentration of the buffer solution 2 is 0.01-0.1 M and the pH is 7-7.4.
[0033] In one embodiment of the present invention, the concentration of the buffer solution 2 is 0.1 M and the pH is 7.2.
[0034] In one embodiment of the present invention, the buffer 2 contains 0.1-0.2% (m / v, g / 100 mL) bovine serum albumin.
[0035] In one embodiment of the present invention, the buffer 2 does not contain Ca 2+ and Mg 2+ .
[0036] The present invention also provides a method for separating renal tubular epithelial cells from a sample, and the method is: using the above-mentioned immunomagnetic beads or the above-mentioned kit.
[0037] In one embodiment of the present invention, the method comprises the following steps:
[0038] Cell extraction step: centrifuging the sample to obtain a precipitate; washing the precipitate with buffer 1 to obtain a cell suspension;
[0039] Cell capture step: adding the immunomagnetic beads to the cell suspension so that the renal tubular epithelial cells bind to the immunomagnetic beads;
[0040] Cell separation step: after taking out the immunomagnetic beads from the cell suspension, washing the immunomagnetic beads with buffer 2 to wash away the unbound cells, and obtaining purified renal tubular epithelial cells.
[0041] In one embodiment of the present invention, the centrifugation speed is 400 g-600 g and the time is 10-20 min.
[0042] In one embodiment of the present invention, the addition amount of the immunomagnetic beads in the precipitate suspension is 10-30 μL / mL.
[0043] In one embodiment of the present invention, the cell capture step is: after adding the immunomagnetic beads to the cell suspension, tilting and rotating at 2-8 °C, an inclination angle of 30-45° (the angle with the horizontal plane), and a rotation speed of 100-200 rpm for 20-30 min, so that the renal tubular epithelial cells bind to the immunomagnetic beads.
[0044] In one embodiment of the present invention, the sample is urine, renal tubular tissue or urine cell culture medium.
[0045] The present invention also provides the application of the above-mentioned immunomagnetic beads or the above-mentioned kit or the above-mentioned method in the separation of renal tubular epithelial cells.
[0046] The technical solution of the present invention has the following advantages:
[0047] The present invention provides an immunomagnetic bead for separating renal tubular epithelial cells in a sample. The immunomagnetic bead includes a magnetic bead and an antibody conjugated to the magnetic bead. The antibody can specifically bind to the surface antigen of renal tubular epithelial cells in the sample to efficiently capture renal tubular epithelial cells. Using the immunomagnetic bead to separate renal tubular epithelial cells in the sample has the advantages of low cost, strong specificity, high separation purity, simple operation and high sensitivity. Moreover, the renal tubular epithelial cells sorted by the immunomagnetic bead have a high recovery rate and cell activity, and have little impact on downstream applications. Therefore, separating renal tubular epithelial cells in the sample with the immunomagnetic bead has great application prospects in clinical practice.
[0048] Further, the magnetic bead is a tosyl magnetic bead; the tosyl magnetic bead has a stronger binding ability with the antibody, so that when using the immunomagnetic bead to separate renal tubular epithelial cells in the sample, the binding efficiency is higher.
[0049] Further, the particle size of the magnetic bead is 4.5 μm; the magnetic bead at this particle size has the largest body surface area ratio in an equal-volume magnetic bead suspension, can bind more antibodies, so that when using the immunomagnetic bead to separate renal tubular epithelial cells in the sample, the adsorption force is higher.
[0050] Further, the antibody is a sodium-dependent glucose transporter 2 antibody; the sodium-dependent glucose transporter 2 antibody is mainly present on the luminal side of renal tubular epithelial cells and can specifically bind to renal tubular epithelial cells, so that when using the immunomagnetic bead to separate renal tubular epithelial cells in the sample, the specificity is stronger.
[0051] Further, the coupling ratio of the antibody to the magnetic bead is 30 μg: 1 mg; the magnetic bead and the antibody have the highest coupling efficiency at this coupling ratio. Specific embodiments
[0052] The following embodiments are provided to better further understand the present invention, which are not limited to the best embodiments, and do not limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior art features falls within the protection scope of the present invention.
[0053] For those not specifying specific experimental steps or conditions in the following embodiments, the operations or conditions of the conventional experimental steps described in the literature in this field can be followed. For the reagents or instruments not indicating the manufacturer, they are all conventional reagent products that can be obtained through commercial purchase.
[0054] Example 1: Immunomagnetic bead and its preparation
[0055] This embodiment provides an immunomagnetic bead, which includes tosyl magnetic beads with a particle size of 4.5 μm and sodium-dependent glucose transporter 2 antibody (Anti-SGLT2) conjugated to the magnetic beads; on the immunomagnetic beads, the conjugation ratio of the antibody to the magnetic beads is 30 μg: 1 mg.
[0056] The preparation method of the immunomagnetic beads includes the following steps:
[0057] (1) Pre-cleaning of magnetic beads
[0058] Take 1 mg of tosyl magnetic beads ( M-450 Tosylactivated, Cat No.14013) and place them in a 1.5 mL centrifuge tube. Place the tube on a magnetic rack, discard the supernatant to obtain magnetic beads; add 1 mL of PBS buffer (PH = 7.4, 0.01 M) to the magnetic beads, and then vortex at 30 °C for 30 s for cleaning. After cleaning 2 times, resuspend with 1 mL of PBS buffer (PH = 7.4, 0.01 M) to obtain a magnetic bead suspension;
[0059] (2) Conjugation of magnetic beads with antibody
[0060] Take 1 mL of the magnetic bead suspension and place it in a 1.5 mL centrifuge tube. Place the tube on a magnetic rack, discard the supernatant to obtain magnetic beads; after resuspending the magnetic beads in PBS buffer (PH = 7.4, 0.01 M), continue to add 30 μg of sodium-dependent glucose transporter 2 antibody (Anti-SGLT2, purchased from abcam company) to the PBS buffer (PH = 7.4, 0.01 M) to obtain an incubation system with a total incubation volume of 1 mL; incubate the incubation system at 25 °C for 20 h to obtain an incubation solution. During the incubation, place the incubation system in a rotary mixer and continuously invert and mix at a condition of 150 rpm; place the incubation solution on a magnetic rack, discard the supernatant to obtain immunomagnetic beads; add 1 mL of phosphate buffer (PH = 7.2, 0.01 M) containing 0.1% (m / v, g / 100 mL) bovine serum albumin without Ca 2+ and Mg 2+ to the immunomagnetic beads, and then invert and mix at 4 °C for 5 min for cleaning. After cleaning twice, resuspend with 1 mL of phosphate buffer (PH = 7.2, 0.01 M) containing 0.1% (m / v, g / 100 mL) bovine serum albumin without Ca 2+ and Mg 2+ to obtain an immunomagnetic bead suspension.
[0061] Example 2: Kit for separating renal tubular epithelial cells from a sample
[0062] This embodiment provides a kit for separating renal tubular epithelial cells from a sample, and the kit includes:
[0063] Immunomagnetic beads of Example 1;
[0064] PBS buffer (PH = 7.0, 0.01M);
[0065] Calcium-free 2+ and magnesium-free 2+ phosphate buffer (PH = 7.2, 0.01M) containing 0.1% (m / v, g / 100mL) bovine serum albumin.
[0066] Example 3: Method for isolating renal tubular epithelial cells from a sample (taking a urine sample as an example)
[0067] This example provides a method for isolating renal tubular epithelial cells from a sample. The method uses the kit of Example 2 and includes the following steps:
[0068] Cell extraction step: Centrifuge 50 mL of the sample at 400 g for 10 min, discard the supernatant, and retain 1 mL of the precipitate; add 10 mL of PBS buffer (PH = 7.0, 0.01M) to the precipitate to wash the precipitate, then centrifuge at 400 g for 10 min, discard the supernatant, and retain 1 mL of the cell suspension;
[0069] Cell capture step: After adding 25 μL of immunomagnetic beads to the cell suspension, place it on a rotary mixer and gently tilt and rotate at 4 °C, an inclination angle of 45° (angle with the horizontal plane), and a rotation speed of 150 rpm for 20 min to allow the renal tubular epithelial cells to bind to the immunomagnetic beads;
[0070] Cell separation step: Place the combined cell suspension on a magnetic rack, discard the supernatant to obtain immunomagnetic beads bound with renal tubular epithelial cells; add 1 mL of calcium-free 2+ and magnesium-free 2+ phosphate buffer (PH = 7.2, 0.01M) containing 0.1% (m / v, g / 100mL) bovine serum albumin, then invert and mix at 4 °C for 5 min for washing to wash away unbound cells. After washing four times, resuspend with 1 mL of calcium-free 2+ and magnesium-free 2+ phosphate buffer (PH = 7.2, 0.01M) containing 0.1% (m / v, g / 100mL) bovine serum albumin to obtain an immunomagnetic bead suspension bound with purified renal tubular epithelial cells.
[0071] Experimental Example 1: Detection experiment on the coupling efficiency of immunomagnetic beads
[0072] This example provides a detection experiment on the coupling efficiency of immunomagnetic beads. The experimental procedure is as follows:
[0073] On the basis of the immunomagnetic bead preparation method of Example 1, 30 μg of sodium-dependent glucose transporter 2 was replaced with 10 μg, 20 μg, and 40 μg, respectively. Before incubation, the concentration of sodium-dependent glucose transporter 2 in the incubation system was detected by the BCA protein quantification method (for the specific BCA protein quantification method, see YEASEN Cat: No20201ES7). After incubation, the concentration of sodium-dependent glucose transporter 2 in the supernatant was detected by the BCA protein quantification method. And, according to the detected concentration of sodium-dependent glucose transporter 2, the coupling efficiency of the immunomagnetic beads was calculated (the detection results are shown in Table 1), and the calculation formula is as follows:
[0074] E = (protein content 孵育前 - protein content 孵育后 ) / protein content 孵育前 .
[0075] As can be seen from Table 1, at the contents of 30 μg and 40 μg, the antibody content coupled to the magnetic beads is the highest. Therefore, the best effect of preparing the immunomagnetic beads of Example 1 is achieved with a coupling ratio of 30 μg: 1 mg.
[0076] Table 1 Coupling efficiency of immunomagnetic beads
[0077]
[0078] Experimental Example 2: Immunosorting experiment of immunomagnetic beads and renal tubular epithelial cells
[0079] This example provides an immunosorting experiment of immunomagnetic beads and renal tubular epithelial cells, and the experimental process is as follows:
[0080] (1) Construct a standard product verification model
[0081] 50 mL of urine samples from 5 healthy women were collected respectively. After adding 10 μL of renal tubular epithelial cell line (male, Cat No. SNLM-165, purchased from Shangen Biotech Co., Ltd.) to each sample, centrifugation was performed (400 g / 10 min), the supernatant was discarded, and 1 mL of precipitate was retained; after adding 10 mL of PBS buffer (PH = 7.0, 0.01 M) to the precipitate for washing, centrifugation was performed (400 g / 10 min), the supernatant was discarded, and 2 mL of cell suspension was retained.
[0082] The above cell suspension was divided into two equal parts, each part being 1 mL. One part was used to extract DNA with the DNA Blood mini kit (Qiagen, Cat. No51104), and the SRY gene content was determined by fluorescence quantitative PCR;
[0083] Among them, the primer information used is: forward primer: AAAGGCAACGTCCAGGATAGAG (SEQ ID NO.1), reverse primer: TGAGTTTCGCATTCTGGGATT (SEQ ID NO.2), probe sequence: AAGCGACCCATGAA (SEQ ID NO.3); the reaction system is 25 μL, including TaqMan TM Universal PCR Master Mix (Thermo Fisher Scientific, Cat.No4304437) 12.5 μL, 0.5 μL of each 10 μM forward and reverse primers, 0.25 μL of 10 μM probe, 2 μL of DNA; the reaction conditions are 95°C / 10 min, 45 cycles of 95°C / 10 s, 60°C / 1 min.
[0084] (2) Immunomagnetic bead and immunoselection of renal tubular epithelial cells
[0085] Add 25 μL of the immunomagnetic beads from Example 1 to 1 mL of cell suspension, place it on a rotary mixer, and gently tilt and rotate at 4°C, an inclination angle of 45° (angle with the horizontal plane), and a rotation speed of 150 rpm for 20 min to allow renal tubular epithelial cells to bind to the immunomagnetic beads; place the combined cell suspension on a magnetic stand, discard the supernatant to obtain immunomagnetic beads bound with renal tubular epithelial cells; add 1 mL of phosphate buffer without Ca 2+ and Mg 2+ (PH = 7.2, 0.01 M) to the immunomagnetic beads bound with renal tubular epithelial cells, and invert and mix at 4°C for 5 min for washing to remove unbound cells. After washing four times, resuspend with 1 mL of phosphate buffer without Ca 2+ and Mg 2+ (PH = 7.2, 0.01 M) to obtain an immunomagnetic bead suspension bound with purified renal tubular epithelial cells.
[0086] (3) Verification of cell sorting efficiency
[0087] Extract DNA from the immunomagnetic bead suspension bound with purified renal tubular epithelial cells using the DNA Blood minikit (Qiagen, Cat.No 51104) as well, and determine the SRY gene content by fluorescence quantitative PCR. The conditions for fluorescence quantitative PCR are the same as in step (1); by comparing the SRY gene content in the samples before and after immunoselection, calculate the sorting efficiency. The calculation formula is as follows:
[0088] E = SYR copy number 分选后 / SYR copy number 分选前 。
[0089] The results showed that the average SYR gene copy number before sorting was 1.91×10 4 copies / mL, and the average SYR gene copy number after sorting was 1.8×10 4 copies / mL, and the recovery rate was 94.2%. It shows that the immunomagnetic beads of Example 1 have the advantages of strong specificity and high sensitivity.
[0090] Experimental Example 3: HLA typing accuracy experiment of immunomagnetic beads
[0091] This example provides an HLA typing accuracy experiment of immunomagnetic beads, and the experimental process is as follows:
[0092] Urine samples were collected from 3 kidney transplant patients with known donor HLA genotypes (detected by PCR-SBT method, TBG Catalog No.: 50110, 50210, 50410, 50350, 50510, 50610), and the target cells were captured according to the operation process of Example 3 to obtain 3 immunomagnetic bead suspensions combined with purified renal tubular epithelial cells; DNA was extracted from the 3 immunomagnetic bead suspensions combined with purified renal tubular epithelial cells respectively using DNA Blood mini kit (Qiagen, Cat. No 51104), and the extracted DNA was used for SMRT Bell library construction and PacBio sequencing. The obtained sequencing data was compared with the IMGT / HLA database (https: / / www.ebi.ac.uk / ipd / imgt / hla / ) to obtain the donor HLA genotype, and the comparison results are shown in Table 2.
[0093] As can be seen from Table 2, the donor HLA genotypes obtained by sequencing the target cells captured by the immunomagnetic beads of Example 1 are highly consistent with the known donor HLA genotypes, and most of the accuracies can reach 6 digits. It shows that the renal tubular epithelial cells can be specifically separated by the immunomagnetic beads of Example 1, the interference of other source cells in the sample can be reduced, the donor HLA genotype after kidney transplantation can be accurately typed, and the accuracy of HLA typing can be improved.
[0094] Table 2 HLA typing results
[0095]
[0096] Obviously, the above embodiments are merely examples for clear illustration and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to exhaustively list all implementation manners here. And the obvious changes or modifications derived therefrom still fall within the protection scope of the present invention. Sequence Listing <110> Shanghai Aogen Diagnostic Technology Co., Ltd. <120> An Immunomagnetic Bead and Its Application in the Isolation of Renal Tubular Epithelial Cells <160> 3 <170> PatentIn version 3.3 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <400> 1 aaaggcaacg tccaggatag ag 22 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <400> 2 tgagtttcgc attctgggat t 21 <210> 3 <211> 14 <212> DNA <213> Artificial Sequence <400> 3 aagcgaccca tgaa 14
Claims
1. An immunomagnetic bead, characterized in that, The immunomagnetic beads are composed of tosyl magnetic beads with a particle size of 4.5 μm and sodium-dependent glucose transporter 2 antibodies conjugated to the magnetic beads; on the immunomagnetic beads, the conjugation ratio of the antibody to the magnetic beads is 30 μg: 1 mg.
2. A method for preparing the immunomagnetic beads according to claim 1, characterized in that, The method is as follows: Take 1 mg of tosyl magnetic beads and place them in a 1.5 mL centrifuge tube. Place the tube on a magnetic stand, discard the supernatant to obtain the magnetic beads; add 1 mL of PBS buffer to the magnetic beads, vortex at 30 °C for 30 s for washing. After washing twice, resuspend with 1 mL of PBS buffer to obtain a magnetic bead suspension. Take 1 mL of the magnetic bead suspension and place it in a 1.5 mL centrifuge tube. Place the tube on a magnetic stand, discard the supernatant to obtain the magnetic beads; after resuspending the magnetic beads in PBS buffer, continue to add 30 μg of sodium-dependent glucose transporter 2 antibody to the PBS buffer to obtain an incubation system with a total incubation volume of 1 mL; incubate the incubation system at 25 °C for 20 h to obtain an incubation solution. During incubation, place the incubation system in a rotary mixer and continuously invert and mix at 150 rpm. Place the incubation solution on a magnetic stand and discard the supernatant to obtain the immunomagnetic beads.
3. A method for preparing a suspension of the immunomagnetic beads according to claim 1, characterized in that, The method is as follows: preparing immunomagnetic beads using the method described in claim 2; adding 1 mL of phosphate buffer without Ca 2+ and Mg 2+ to the immunomagnetic beads, then inverting and mixing evenly at 4°C for 5 min for washing. After washing twice, resuspending with 1 mL of phosphate buffer without Ca 2+ and Mg 2+ to obtain an immunomagnetic bead suspension.
4. A kit for separating renal tubular epithelial cells from a sample, characterized in that, The kit contains immunomagnetic beads, PBS buffer, and phosphate buffer containing 0.1% bovine serum albumin without Ca 2+ and Mg 2+ ; the immunomagnetic beads are the immunomagnetic beads described in claim 1.
5. A method for separating renal tubular epithelial cells from a sample, characterized in that, The method is as follows: Use the kit according to claim 4, including the following steps: Cell extraction step: Centrifuge 50 mL of the sample at 400 g for 10 min, discard the supernatant, and retain 1 mL of the precipitate; add 10 mL of PBS buffer to the precipitate to wash the precipitate, then centrifuge at 400 g for 10 min, discard the supernatant, and retain 1 mL of cell suspension. Cell capture step: Add 25 μL of immunomagnetic beads to the cell suspension, then place it on a rotary mixer and gently tilt and rotate at 4 °C, an inclination angle of 45 °, and a rotation speed of 150 rpm for 20 min to allow the renal tubular epithelial cells to bind to the immunomagnetic beads. Cell separation step: Place the combined cell suspension on a magnetic stand, discard the supernatant to obtain immunomagnetic beads conjugated with renal tubular epithelial cells; add 1 mL of phosphate buffer without Ca 2+ and Mg 2+ to the immunomagnetic beads conjugated with renal tubular epithelial cells, then invert and mix gently at 4°C for 5 min for washing to remove unbound cells. After washing four times, resuspend with 1 mL of phosphate buffer without Ca 2+ and Mg 2+ to obtain an immunomagnetic bead suspension conjugated with purified renal tubular epithelial cells.
6. Use of the immunomagnetic beads according to claim 1 or the kit according to claim 4 or the method according to claim 5 in the separation of renal tubular epithelial cells.
Citation Information
Patent Citations
Method for separating placental trophoblastic cells by using immunomagnetic bead process
CN107312747A
Urine-derived epithelial cell lines for diagnosis and therapy of an Anti-BK-virus or Anti-graft immune response
EP3203237A1