A fully human novel coronavirus variant potent neutralizing antibody H4B6 and its application

Abstract

This invention discloses a fully human monoclonal antibody, H4B6, against variants of the novel coronavirus. This antibody, obtained through flow cytometry-single-cell PCR screening, features unique CDR partitioning, with its antigen recognition epitope located in the receptor binding domain (RBD) of the spike protein. H4B6 exhibits broad-spectrum, highly effective neutralizing activity against the major variants of the novel coronavirus. This monoclonal antibody, characterized by high expression, fully human origin, and excellent stability, is suitable for industrial production and has significant clinical application value in addressing current and future outbreaks caused by emerging variants.

Description

Technical Field

[0001] The invention discloses an antibody, belonging to the technical field of proteins or polypeptides. Background Art

[0002] Novel coronavirus infection (COVID-19) is a new, highly contagious disease caused by the novel coronavirus (SARS-CoV-2). Since its outbreak in late 2019, it has caused a global pandemic. As the number of infections increases and the epidemic persists, the virus has continued to evolve, generating numerous variants. Some have significantly increased transmissibility, causing widespread epidemics in multiple regions or exhibiting significant immune escape, reducing the effectiveness of existing treatments and preventive measures. The World Health Organization has designated these variants as "variants of concern" (VOCs). These include the previously prevalent Alpha, Beta, Gamma, and Delta variants, as well as the currently circulating highly contagious Omicron variant and its subvariants. Globally, BA.1 has been rapidly replaced by BA.2. BA.2 and BA.4 / 5 subvariants have driven further diversification of circulating SARS-CoV-2, resulting in the emergence of several additional subvariants, including BA.2.75, BA.2.76, BA.4.6, BQ.1, BQ.1.1, and BF.7. The spread of these variants has posed significant challenges to the global response to the epidemic.

[0003] SARS-CoV-2 belongs to the genus Betacoronavirus in the family Coronaviridae. It is an enveloped, single-stranded, positive-sense RNA virus with a genome length of approximately 30 kb. The first two-thirds of the genome consists of the nonstructural genes ORF1a / b, which primarily encode enzymes involved in viral replication (RNA-dependent RNA polymerase, RdRp). The second third encodes four structural proteins: spike (S), envelope (E), membrane (M), and nucleocapsid (N). The S protein contains the viral receptor binding domain (RBD) that binds to the angiotensin-converting enzyme 2 (ACE2) receptor on the surface of human cells, mediating viral attachment and entry. It is a key protein for the virus to invade susceptible host cells.

[0004] Neutralizing antibodies are one of the most promising therapeutic agents. Compared to small molecule drugs, they offer advantages such as a well-defined mechanism of action, strong specificity, high sensitivity, and minimal cross-reactivity. They are a key area of ​​research for the treatment of COVID-19. Compared to vaccines, neutralizing antibodies can provide immediate protection against circulating strains of the virus. They also offer a powerful alternative for those who, due to medical reasons, are unable to respond effectively to vaccines, including the elderly and those with compromised immune systems. Furthermore, neutralizing antibodies can be a treatment option for those experiencing breakthrough infections. Neutralizing antibodies can prevent and treat COVID-19 infection by blocking viral binding to their receptors and activating immune cells such as macrophages and NK cells, as well as complement, to kill and eliminate viral particles and infected cells through multiple mechanisms. Currently, seven monoclonal antibodies for COVID-19 have received emergency use authorization (see Table 1), but the emergence of variants has challenged the effectiveness of many of these monoclonal antibodies. Among them, antibody drugs developed by Regeneron, Eli Lilly, Junshi Biosciences, and GlaxoSmithKline have shown significantly reduced or even complete ineffectiveness against Omicron and its subtypes, leading to the revocation of their emergency use authorization by the US FDA. BRII196 and 198, developed by Brii Bioscience and approved for use in my country, also show significantly reduced neutralizing activity against Omicron subtype variants. Therefore, the development of a new generation of neutralizing antibody drugs that can provide broad-spectrum protection is urgently needed.

[0005] Table 1: COVID-19 antibody drugs that have received emergency use authorization

[0006] .

[0007] Currently, neutralizing monoclonal antibodies can be obtained through hybridoma technology, humanized transgenic mice, phage library screening, and single-cell PCR technology. Single-cell PCR technology, with its advantages of fully human origin and good natural stability, is widely used in the development of neutralizing antibodies for COVID-19. The principle of single-cell PCR technology is that people who have recovered from novel coronavirus infection or received the COVID-19 vaccine have protective monoclonal antibodies against the virus. The gene encoding the antibody is located in a single lymphocyte in human peripheral blood. This gene can be "fished" through flow cytometric sorting and single-cell PCR technology. Then, through genetic engineering methods, this molecule can be produced on a large scale in vitro.

[0008] The purpose of this invention is to use flow sorting-single-cell PCR technology to obtain monoclonal antibodies with excellent broad-spectrum neutralizing activity from the peripheral blood of recipients of the recombinant new coronavirus vaccine, and to provide fully human monoclonal antibodies with good protective effects against COVID-19 to cope with the current epidemic and possible mutant strains that may appear in the future. Summary of the Invention

[0009] To achieve the above objectives, the present invention first provides an anti-SARS-CoV-2 monoclonal antibody screened by flow cytometry-single-cell PCR technology. The amino acid sequences of the CDR1, CDR2, and CDR3 regions of the heavy chain variable region of the monoclonal antibody are shown in the amino acid sequences of positions 26-33, 51-57, and 96-106 of SEQ ID NO: 1, respectively; and the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the light chain variable region are shown in the amino acid sequences of positions 27-32, 50-52, and 89-97 of SEQ ID NO: 5, respectively. The monoclonal antibody is designated "H4B6" in the present invention.

[0010] In a preferred embodiment, the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 5.

[0011] In a more preferred embodiment, the amino acid sequence of the heavy chain constant region of the antibody is shown as SEQ ID NO: 3, and the amino acid sequence of the light chain constant region is shown as SEQ ID NO: 7.

[0012] Second, the present invention also provides a polynucleotide encoding the heavy chain and light chain of the above-mentioned monoclonal antibody, the sequence of the polynucleotide encoding the heavy chain variable region of the antibody is shown in SEQ ID NO: 2, and the sequence of the polynucleotide encoding the light chain variable region of the antibody is shown in SEQ ID NO: 6.

[0013] In a preferred embodiment, the sequence of the polynucleotide encoding the heavy chain constant region of the antibody is shown as SEQ ID NO: 4, and the sequence of the polynucleotide encoding the light chain constant region of the antibody is shown as SEQ ID NO: 8.

[0014] Third, the present invention also provides a functional element for expressing the polynucleotide encoding the heavy chain and light chain of the monoclonal antibody. This functional element can be a traditional expression vector.

[0015] In a preferred embodiment, the functional element is a linear expression cassette.

[0016] In another preferred embodiment, the functional element is a mammalian expression vector.

[0017] Fourthly, the present invention also provides a host cell containing the above linear expression cassette.

[0018] In a preferred embodiment, the cells are Expi 293F cells.

[0019] In another preferred embodiment, the cells are CHO-K1 or CHO-S cells. The antibodies provided by the present invention can be used to construct engineered cell lines using CHO-K1 or CHO-S cells to achieve industrial production.

[0020] Finally, the present invention also provides the use of the above-mentioned monoclonal antibodies in the preparation of COVID-19 therapeutic drugs.

[0021] The monoclonal antibody provided by the present invention was obtained by flow sorting-single cell PCR screening and has a unique CDR partitioning. Its antigen recognition epitope is located in the RBD region of the S1 protein. The affinity of the antibody to the wild-type S-ECD of SARS-CoV-2 is 1.5nM, and the affinity to the S-ECD of BA.4 and BA.4.6 is 6.8nM and 4.0nM, respectively. In the pseudovirus neutralization experiment, the IC 50 The IC for neutralizing Delta pseudovirus is 96.8 ng / mL. 50 The IC for neutralizing BA.2 pseudovirus is 71.8 ng / mL. 50 The IC value for neutralizing BA.2.75 pseudovirus is 313.1 ng / mL. 50 The IC value for neutralizing BA.2.76 pseudovirus is 955.3 ng / mL. 50 The IC value for neutralizing BA.4 pseudovirus is 160.2 ng / mL. 50 The IC for neutralizing BA.4.6 pseudovirus is 48.0 ng / mL. 50 The IC for neutralizing BF.7 pseudovirus is 24.5 ng / mL. 50 The IC for neutralizing BJ.1 pseudovirus is 17.0 ng / mL. 50 The concentration of H4B6 was 52.1 ng / mL, demonstrating broad-spectrum, highly effective neutralization of H4B6 against the major variants currently identified. The monoclonal antibody disclosed in this invention is characterized by high expression, fully human origin, and excellent stability, making it suitable for industrial production and possessing significant clinical application value in addressing current and future outbreaks caused by emerging variants. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Flow cytometry single cell sorting diagram;

[0023] Figure 2Capillary electrophoresis analysis of H, κ, and λ chain genes after nested PCR amplification.

[0024] Figure 3 . Binding activity graph of antibody expression supernatant and BA.4 / BA.2.12.1;

[0025] Figure 4 Output of search results for the variable region sequence of monoclonal antibody H4B6;

[0026] Figure 5 BLI detection of the binding activity of monoclonal antibody H4B6 to S1, RBD, NTD, and S2 proteins;

[0027] Figure 6 BLI detection of H4B6 affinity for WT S protein;

[0028] Figure 7 BLI detection of H4B6 affinity for BA.4 S protein;

[0029] Figure 8 BLI detection of H4B6 affinity for BA.4.6 S protein;

[0030] Figure 9 . H4B6 has broad-spectrum neutralizing activity against SARS-CoV-2 pseudoviruses. DETAILED DESCRIPTION

[0031] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0032] Example 1. Screening and preparation of human anti-SARS-CoV-2 monoclonal antibodies

[0033] 1. Blood Sample Collection

[0034] After obtaining informed consent, 20 mL of blood samples were collected from subjects who received the inhaled recombinant novel coronavirus vaccine one month after aerosol immunization for subsequent experiments.

[0035] 2. Flow Cytometry Isolation of Memory B Cells

[0036] The collected blood samples were separated from PBMCs using Ficoll density gradient centrifugation. The process was as follows:

[0037] 1) Take fresh anticoagulated whole blood using EDTA. Add an equal volume of separation buffer to the centrifuge tube. Spread the blood sample evenly over the separation buffer, maintaining a clear interface between the two liquids.

[0038] 2) Balance the tube, centrifuge at room temperature, 800g, acceleration / deceleration 3, and centrifuge for 30 minutes. After centrifugation, the tube contains red blood cells at the bottom, the separation medium in the middle, and the plasma / tissue homogenate layer at the top. Between the plasma layer and the separation medium layer is a thin, dense white membrane, representing the mononuclear cell layer (including lymphocytes and monocytes).

[0039] 3) Carefully transfer the buffy coat layer to a new 50 mL centrifuge tube, dilute it 3-fold with PBS, and mix thoroughly by inversion. Centrifuge at 600 g for 10 minutes at room temperature in a swing-out rotor. Discard the supernatant. Repeat this wash twice.

[0040] 4) Resuspend the lymphocytes in PBS. Count the cells to be sorted and add all antibodies except the anti-His tag antibody and antigen according to the recommended amounts in Table 2. Incubate at 4°C for 1 hour. Wash twice with PBS + 2% FBS, then add the anti-His tag antibody. Make up the reaction mixture with PBS + 2% FBS and incubate at 4°C for 1 hour.

[0041] Table 2. Fluorescent antibodies / antigens for flow cytometry sorting

[0042] .

[0043] 5) Repeat washing 2-3 times with PBS containing 2% FBS, resuspend in 1 mL of FPBS, remove cell clumps using a 40 μm cell sieve, and store at 4°C in the dark until sorting.

[0044] 6) Use a cell sorter (Beckman MofloXDP) to sort single memory B cells specific for SARS-CoV-2 S-ECD. The sorting strategy is: CD3 - / CD19 + / IgG + / CD27 + / BA.4 / BA.2.12.1 S-ECD + ,like Figure 1 , Figure 1 - Circle the lymphocytes in A. Figure 1 -Circle CD3 in B - / CD19 + B cells, Figure 1 - Circle IgG in C + / CD27 + memory B cells, Figure 1 BA.4 / BA.2.12.1 S-ECD is circled in -D +Single memory B cells were directly sorted into a 96-well plate. 20 μL of RNase-free water and 20 U of RNase inhibitor were pre-added to each well of the 96-well plate and stored at -80°C.

[0045] 3. Amplification of fully human monoclonal antibody variable region genes using single-cell PCR technology

[0046] 1) Reverse transcription PCR

[0047] With reference to the instruction manual (QIAGEN, 210212), the procedure is briefly described as follows:

[0048] 234 single cells were sorted by flow cytometry. All of the following primers specific for each subtype of heavy chain (H), kappa light chain (κ), and lambda light chain (λ) were added to each reaction system (primer sequences are shown in Table 3). Primers:

[0049] H: 5′ L-VH 1, 5′ L-VH3, 5′ L-VH 4 / 6, 5′L-VH5, HuIgG-const-anti, 3′ Cm CH1;

[0050] κ: 5′ L Vκ 1 / 2, 5′ L Vκ 3, 5′ L Vκ 4, 3′ Cκ 543–566;

[0051] λ: 5′ L Vλ 1, 5′ L Vλ 2, 5′ L Vλ 3, 5′ L Vλ 4 / 5, 5′ L Vλ 6, 5′ L Vλ 7, 5′ LVλ 8, 3′ Cλ.

[0052] Table 3 Reverse transcription PCR primer sequences

[0053] .

[0054] The PCR reaction system contained 6 μL of 5× buffer, 1.2 μL of dNTPs, 1.2 μL of reverse transcriptase (Qiagen, 210212), the primers as above, and a single-cell template, which was made up to 30 μL with water. The PCR reaction conditions were: reverse transcription at 50°C for 30 min, initial denaturation at 95°C for 15 min, followed by 40 cycles of 95°C for 40 s, 55°C for 30 s, and 72°C for 1 min, and a final extension at 72°C for 10 min.

[0055] 2) Nested PCR

[0056] 1 μL of the reverse transcription product was used as a template for nested PCR reaction to amplify the variable regions of H, κ, and λ. The primers for amplifying the heavy chain variable region, κ light chain variable region, and λ light chain variable region are shown in Table 4 below.

[0057] Table 4. Nested PCR primer sequences

[0058] .

[0059] The PCR reaction system contained 5 μL of 10× buffer, 1 μL of 10 mM dNTP mix, 0.5 μL of DNA polymerase (Nanjing Novozymes Biotechnology Co., Ltd., P201), 0.2 μL of each primer, 1 μL of the reverse transcription product as template, and water to 50 μL. PCR reaction conditions were: initial denaturation at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, with a final extension at 72°C for 7 min.

[0060] 3) Capillary electrophoresis

[0061] Nested PCR amplification products were subjected to capillary electrophoresis using a QIAGEN DNA Fast Analysis Cartridge (Qiagen, 929008). A single clone in which both the heavy and light chain genes were successfully amplified was considered a successfully paired clone. A total of 18 pairs of H chains and κ chains were successfully paired, and 17 pairs of H chains and λ chains were successfully paired. Figure 2 It is the identification pattern of capillary electrophoresis after nested PCR amplification of H, κ, and λ chain genes.

[0062] 4. Antibody expression using linear expression cassettes

[0063] Compared to traditional expression vector construction methods, constructing a linear expression cassette is much faster. The designed linear expression cassette contains all the elements for monoclonal antibody expression in mammalian cells. From the 5' end, the linear expression cassette includes the CMV promoter sequence (Genbank accession number: X03922.1), the coding sequence for the antibody leader peptide, the antibody variable region (amplified from a single cell), the antibody constant region (synthesized by Sangon Biotechnology, the heavy chain constant region sequence is represented by SEQ ID NO:3, the DNA coding sequence is represented by SEQ ID NO:4, the kappa light chain constant region sequence is represented by SEQ ID NO:7, the DNA coding sequence is represented by SEQ ID NO:8), and the poly A tail (Genbank accession number: X03896.1). This linearized DNA is then transfected into cells for antibody expression.

[0064] The specific process is to connect and construct the various PCR fragments through in vitro overlap extension PCR technology:

[0065] 1) Amplify the promoter-leader sequence

[0066] The heavy and light chain promoter-leader sequences were amplified using pMD-CMVH and pMD-CMVL as templates, respectively. The PCR reaction system for amplifying the heavy chain promoter-leader sequence included: 10 ng of template plasmid pMD-CMVH, 5 μL of 10× buffer, 4 μL of 2.5 mM dNTPs, 0.5 μL of DNA polymerase, primer 5'-CMV-UP (matching the upstream sequence of the CMV promoter) (5'-GATATACGCGTTGACATTGATTATTGAC-3'), and primer 3'-leader-H (HR) (5'-ACACTGAACACCTTTTAAAATTAG-3', for heavy chain fusion; the signal peptide sequence is 5'-ATGAACTTCGGGCTCAGCTTGATTTTCCTTGTCCTAATTTTAAAAGGTGTC-3'). The amino acid sequence encoded by the heavy chain is MNFGLSLIFLVLILKGV. The PCR reaction system for amplifying the light chain promoter-leader sequence fragment included: 10 ng of template plasmid pMD-CMVL, 5 μL of 10× buffer, 4 μL of 2.5 mM dNTPs, 0.5 μL of DNA polymerase, primer 5'-CMV-UP (5'-GATATACGCGTTGACATTGATTATTGAC-3'), primer 3'-leader-L(HR) (5'-CCCACAGGTACCAGATACCCATAG -3') for light chain fusion, the full-length signal peptide sequence nucleotide sequence is 5'-ATGGATTCACAGGCCCAGGTTCTTATGTTACTGCTGCTATGGGTATCTGGTACCTGTGGG-3', the amino acid sequence is MDSQAQVLMLLLLWVSGTCG, the signal peptide sequence is derived from the variable region of a mouse monoclonal antibody), and the suspension was filled to 50 μL with water.

[0067] PCR reaction conditions were as follows: pre-denaturation at 95 °C for 10 min, followed by 30 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, and a final extension at 72 °C for 10 min.

[0068] 2) Amplification of antibody constant region-poly A tail fragment

[0069] The H chain constant region-poly A tail fragment PCR system includes: template plasmid pMD-TKH 10 ng, 10× buffer 5 μL, 2.5 mM dNTP 4 μL, DNA polymerase 0.5 μL, primer 5'-CH (5'-ACCAAGGGCCCATCGGTCTTCCCC-3'), primer 3'-TK-POLY(A) (5'-AAGTGTAGCGGTCACGCTGCGCGTAACC -3'), and water to 50 μL.

[0070] The κ chain constant region-poly A tail fragment PCR system includes: template plasmid pMD-TKκ 10 ng, 10× buffer 5 μL, 2.5 mM dNTP 4 μL, DNA polymerase 0.5 μL, primer 5'-Cκ (5'-ACTGTGGCTGCACCATCTGTCTTC-3'), primer 3'-TK-POLY(A) (5'-AAGTGTAGCGGTCACGCTGCGCGTAACC -3'), and water to 50 μL.

[0071] The λ chain constant region-poly A tail fragment PCR system includes: template plasmid pMD-TKλ 10 ng, 10× buffer 5 μL, 2.5 mM dNTP 4 μL, DNA polymerase 0.5 μL, primer 5'-Cλ (CTACGTCAGCCCAAGGCTGCCCCC), primer 3'-TK-POLY(A) (5'-AAGTGTAGCGGTCACGCTGCGCGTAACC -3'), and water to 50 μL.

[0072] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 10 min, followed by 30 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 2 min, and a final extension at 72°C for 10 min.

[0073] 3) Amplification of antibody variable regions

[0074] 1 μL of the nested PCR product was used as a template, and Vazyme Taq Plus DNA polymerase was used according to the product instructions to amplify the H chain, κ chain, and λ chain of the antibody using the corresponding mixed primers. The corresponding primers are shown in Table 5 below.

[0075] Table 5. PCR primer sequences

[0076]

[0077] .

[0078] ※ The single underlined part is used for fusion with the upstream fragment, and the underlined bold part is used for fusion with the downstream fragment.

[0079] The PCR reaction system contained 5 μL of 10× buffer, 1 μL of 10 mM dNTP mix, 0.5 μL of DNA polymerase (Nanjing Novozymes Biotechnology Co., Ltd., P201), 0.2 μL of each primer, 1 μL of the nested PCR product as template, and water to 50 μL. PCR reaction conditions were: initial denaturation at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min, with a final extension at 72°C for 7 min.

[0080] 4) Amplify the linear expression cassettes of heavy and light chains separately

[0081] The PCR reaction system includes:

[0082] Template: 10 ng of purified promoter-leader sequence fragment, 10 ng of heavy chain / light chain variable region fragment, 10 ng of heavy chain / light chain constant region-poly A tail fragment, 5 μL of 10× buffer, 1 μL of 10 mM dNTP mix, 0.5 μL of DNA polymerase (Nanjing Novozymes Biotech Co., Ltd., P201), primers 5'-CMV-UP (5'-GATATACGCGTTGACATTGATTATTGAC -3') and 3'-TK-POLY(A) (5'-AAGTGTAGCGGTCACGCTGCGCGTAACC-3'), and fill to 50 μL with water.

[0083] The PCR reaction conditions were as follows: pre-denaturation at 94 °C for 5 min, followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, and a final extension at 72 °C for 7 min.

[0084] 5) PCR product recovery, purification and quantification

[0085] PCR products were directly recovered using an OMEGA recovery kit. DNA quantification: PCR products were quantified using a Nano kit (GE Healthcare).

[0086] 6) Cell co-transfection: 293T cells were transfected at 2×10 5 / mL was inoculated into a 96-well cell culture plate and cultured overnight at 37°C in a cell incubator containing 5% CO2.

[0087] The next day, 20 μL of serum-free Opti-MEM medium was added to each well of a 96-well plate. 0.1 μg of each successfully constructed heavy and light chain linear expression cassette PCR product was added and mixed thoroughly. 0.4 μL of Turbofect (ThermoScientific, R0531) transfection reagent was added. After incubation for 15-20 minutes, the cells were added dropwise to the wells of 293T cells cultured overnight. Incubate at 37°C in a 5% CO2 incubator for 48 hours, then collect the cell culture supernatant for later use.

[0088] 5. ELISA screening of antibodies with binding activity

[0089] 1) Coating: The day before the experiment, dilute the recombinant SARS-CoV-2 S-ECD antigen and goat anti-human IgG (H&L) antibody (Abcam, ab97221) to a concentration of 2 μg / mL in coating buffer. Coat the 96-well ELISA plate with 100 μL per well at 4°C overnight.

[0090] 2) Blocking: On the day of the experiment, wash the plates three times using a plate washer (BIO-TEK, 405_LS). Add 100 µL of blocking solution to each well and incubate at 37°C for 1 hour.

[0091] 3) Sample incubation: Wash the plate three times, add 50 µL of transfected cell culture supernatant and 50 µL of diluent, and incubate at 37°C for 1 hour.

[0092] 4) Secondary antibody incubation: Wash the plate three times, dilute HPR-labeled goat anti-human IgG secondary antibody (Abcam, ab97225) at 1:10,000 in diluent, add 100 µL per well to the corresponding wells of the ELISA plate, and incubate at 37°C for 1 hour.

[0093] 5) Color development: Wash the plate three times, add 100 μL of TMB single-component color development solution to each well, develop for 6 minutes at room temperature in the dark, then add 50 μL of stop solution to each well to terminate the reaction. Measure the OD value at 450-630 nm on a microplate reader. Use the well without the sample to be tested as the negative control. 450-630 Wells with an expression level >2.1 times that of the negative control were considered positive.

[0094] 6. Construction of expression vector and preparation of monoclonal antibody

[0095] Construct light and heavy chain recombinant expression plasmids for the expression and preparation of monoclonal antibodies.

[0096] 1) Construction of pCDNA3.4-H4B6-H expression plasmid:

[0097] The heavy chain was amplified using the linear expression cassette as a template, and a 1.4 kb heavy chain fragment was recovered by gel excision. The expression vector pCDNA3.4 (ThermoFisher Scientific, A14697) was digested with EcoRI / BamH I and recovered. The heavy chain and vector fragments were ligated by homologous recombination (NEBuilder HiFi DNA Assembly Master Mix, E2621L). The TOP10 clones were transformed and sequenced to construct the heavy chain expression vector pCDNA3.4-H4B6-H.

[0098] 2) Construction of pCDNA3.4-H4B6-κ expression plasmid:

[0099] Using the light chain expression cassette as a template, the light chain was amplified, and a light chain fragment of approximately 0.7 kb was recovered by gel electrophoresis. The light chain and vector fragments were connected by homologous recombination, and TOP10 was transformed and cloned for sequencing and identification. The light chain expression vector pCDNA3.4-H4B6-κ was successfully constructed.

[0100] 3) Transient expression of monoclonal antibodies and affinity chromatography purification

[0101] Using the Expi293 expression system, 15 μg of heavy chain and 15 μg of light chain were mixed and transfected into Expi 293F cells. The operation was carried out according to the instructions (ThermoFisher Scientific, A14635). The culture medium was harvested after 5-6 days, and the supernatant was about 30 mL after centrifugation. A 5 mL pre-packed Protein A affinity chromatography column was used. Before loading, it was balanced with 20 mM PBS. The sample was injected after the conductivity showed a baseline. After loading, the column was washed with 20 mM PBS until the baseline was stable. The target protein was eluted with 0.1 M glycine buffer at pH 3.0 and the OD value was 0. 280 After reaching the baseline, stop collecting and wash the column with at least 3 column volumes of 20 mM PBS until the baseline is stable, then wash the column with 20% ethanol.

[0102] Results: 35 monoclonal antibodies with paired heavy and light chain genes were expressed in linear expression cassettes, and the expression levels and binding activities of the monoclonal antibodies to BA.4 or BA.2.12.1 S-ECD protein were analyzed. Figure 3 The results showed that 12 mAbs specifically bound to either BA.4 or BA.2.12.1 S-ECD. The heavy and light chain genes of the 12 mAbs with binding activity were constructed and inserted into the pCDNA3.4 vector. The mAbs were expressed, purified, and cryopreserved for subsequent activity analysis.

[0103] 7. Sequence analysis

[0104] The DNA sequence of the PCR amplified product of the screened clone H4B6 was determined and analyzed, and the variable region search was performed on the IMGT website (http: / / www.imgt.org / IMGT_vquest / analysis). The sequence was a typical antibody sequence, which was consistent with expectations. The search results are as follows: Figure 4 As shown, Figure 4 -A shows the search results of the heavy chain variable region of antibody H4B6. The highest homology in the V region is 96.14%, the highest homology in the J region is 85.42%, and the D region uses reading frame 3. Figure 4 -B shows the search results for the light chain of antibody H4B6, with the highest homology in the V region being 96.77% and the highest homology in the J region being 97.37%. Sequence analysis of monoclonal antibody H4B6 revealed that the polynucleotide sequence encoding the heavy chain variable region is set forth in SEQ ID NO:2, the amino acid sequence of the heavy chain variable region is set forth in SEQ ID NO:1, and the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the heavy chain variable region are set forth in amino acids 26-33, 51-57, and 96-106 of SEQ ID NO:1, respectively. The polynucleotide sequence encoding the light chain variable region is set forth in SEQ ID NO:6, the amino acid sequence of the light chain variable region is set forth in SEQ ID NO:5, and the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the light chain variable region are set forth in amino acids 27-32, 50-52, and 89-97 of SEQ ID NO:5, respectively.

[0105] Example 2. Analysis of epitopes recognized by antibody H4B6

[0106] 1. Prepare the following buffers: Running Buffer (PBS + 0.02% Tween 20 + 0.2% BSA), Regeneration Buffer (10 mM Gly, pH 1.75).

[0107] 2. Sample Preparation: Dilute the antibody to 50 nM (7.5 μg / mL) in Running Buffer. Dilute each to 200 nM depending on the molecular weight of the antigen protein. Pipette 250 μL into the corresponding wells of a 96-well plate. Plate A is where the sample is located. Add the corresponding sample according to the designed layout and place it on the tilted plate rack.

[0108] 3. Turn on the Gator instrument and open the data acquisition software. After the instrument completes its self-test, select the program module. Carefully remove the HFc probe from its box with tweezers and immerse it in a 96-well plate containing 200 μL of buffer. Place the 96-well plate on a horizontal plate rack, with the probe located on plate B.

[0109] 4. Select the K Assay program for sample detection: Select K Assay in the main interface Assay Setup, set the Equilibration Setting to 600 s, Shaker A Speed ​​to 400 rpm, and Shaker B Speed ​​to 1000 rpm in Basic Parameters; select the sample type according to the experimental scheme of Baseline – Loading – Baseline – Association – Dissociation in Plate Set Up, and enter the sample information in the 96-well plate, including sample name and concentration; define the Position, Time, Speed ​​and Step Type of each step in AssaySteps, Step 1 is Baseline, Time is 60 s, Speed ​​is 1000 rpm, Step 2 is Loading, Time is 100 s, Speed ​​is 400 rpm, Step 3 is Baseline, Time is 60 s, Speed ​​is 1000 rpm, Step 4 is Association, Time is 300 s, Speed ​​is 1000 rpm, Step 5 is Dissociation, Time is 300 s, Speed ​​is 1000 rpm; click Start in Preview to start running the program.

[0110] 5. Result Analysis: In the Results & Analysis module on the main interface, click New KAnalysis and select the experiment to be analyzed in Experiment Selection. Align the result curves with the starting point of Association and click Processed to display the aligned data. Export the result data and image, and determine the antibody binding epitope based on the result image.

[0111] Results: The binding activity of H4B6 to different antigen epitopes was detected. Figure 5 H4B6 specifically binds to both the S1 and RBD proteins of SARS-CoV-2, but not to the NTD or S2 proteins. The results indicate that the epitope recognized by the monoclonal antibody H4B6 is located in the RBD region of the S1 protein.

[0112] Example 3: Affinity identification of antibody H4B6

[0113] 1. Prepare the following buffers: Running Buffer (PBS + 0.02% Tween 20 + 0.2% BSA), Regeneration Buffer (10 mM Gly, pH 1.75).

[0114] 2. Sample Preparation: Dilute the antibody to 50 nM (7.5 μg / mL) in Running Buffer and the antigen to 200 nM, 100 nM, 50 nM, 25 nM, 12.5 nM, and 6.25 nM. Pipette 250 μL of each into the corresponding wells of a 96-well plate. Plate A is where the samples are located. Add the corresponding samples according to the designed layout and place them on the tilted plate rack.

[0115] 3. Turn on the Gator instrument and open the data acquisition software. After the instrument completes its self-test, select the program module. Carefully remove the HFc probe from its box with tweezers and immerse it in a 96-well plate containing 200 μL of buffer. Place the 96-well plate on a horizontal plate rack, with the probe located on plate B.

[0116] 4. Select the K Assay program for sample detection: Select K Assay in the main interface Assay Setup, set the Equilibration Setting to 600 s, Shaker A Speed ​​to 400 rpm, and Shaker B Speed ​​to 1000 rpm in Basic Parameters; select the sample type according to the experimental scheme of Baseline – Loading – Baseline – Association – Dissociation in Plate Set Up, and enter the sample information in the 96-well plate, including sample name and concentration; define the Position, Time, Speed ​​and Step Type of each step in Assay Steps, Step 1 is Baseline, Time is 60 s, Speed ​​is 1000 rpm, Step 2 is Loading, Time is 100 s, Speed ​​is 400 rpm, Step 3 is Baseline, Time is 60 s, Speed ​​is 1000 rpm, Step 4 is Association, Time is 300 s, Speed ​​is 1000 rpm, Step 5 is Dissociation, Time is 300 s, Speed ​​is 1000 rpm; click Start in Preview to start running the program.

[0117] 5. Result Analysis: In the Results & Analysis module on the main interface, click New KAnalysis and select the experiment to be analyzed in Experiment Selection. In Reference, set Ref.Probe to define the control probe in the experiment. Select the non-control well, click Edit Formula, select the multiple-minus-multiple operation mode, subtract the reference, and click Processed to display the processed data. In Binding Fitting, select Global for Fitting in Parameters and click Binding CurveFit to calculate the fitting curve. In Kinetic Analysis, select Binding Fitting Graph and click Calculate Kinetics to calculate and display the binding kinetic data ka, kd, and KD of the monoclonal antibody H4B6 and different antigens.

[0118] result: Figure 6 、 Figure 7 and Figure 8 The affinity constants of H4B6 and S-ECD of WT (wild type, Genbank number: NC_045512.2), BA.4 and BA.4.6 are respectively shown. The results show that the affinity constants KD are 1.5nM, 6.77nM and 4.02nM, respectively. The measured R 2 The results showed that the neutralizing antibody has a good affinity for the S antigen of both the wild type and Omicron subvariant of SARS-CoV-2, making it possible to develop it into a specific drug for novel coronavirus infection.

[0119] Table 6. Binding kinetics of monoclonal antibody H4B6 to different antigens

[0120] .

[0121] Example 4. Identification of the pseudovirus neutralizing activity of antibody H4B6

[0122] 1. The purified monoclonal antibody was serially diluted 3-fold from the initial concentration using the culture medium DMEM + 10% FBS and added to a 96-well culture plate. Three replicate wells were set up with a volume of 50 μL / well. Then, 50 μL of pseudovirus suspension of wild-type or mutant novel coronavirus (the virus was diluted to the appropriate titer with DMEM + 10% FBS) was added to each well and mixed thoroughly. A survival control (no virus and antibody) and a death control (only virus) were set up. The cells were incubated at 37°C in a 5% CO2 cell culture incubator for 1 hour.

[0123] 2. HEK293T cells were digested with 0.25% trypsin and diluted to 2.5×10 5 The cells were inoculated into 96-well cell culture plates at a concentration of 100 μL / well and cultured overnight in a 37°C 5% CO2 cell culture incubator.

[0124] 3. After 48 h, discard 100 μL of cell culture supernatant, add 100 μL of chromogenic substrate, and incubate in the dark for 2 min. Transfer 150 μL to a 96-well white microplate and read the luciferase signal using a Tecan Spark multi-function microplate reader. Calculate the antibody neutralization rate using [1 - (sample - survival control signal) / (death control signal - survival control signal)] × 100%. GraphPad Prism 8 was used to fit the curve and calculate the antibody IC. 50 value.

[0125] Results: See Figure 9 IC of monoclonal antibody H4B6 against wild-type pseudovirus of 2019-nCoV 50 The IC for neutralizing Delta pseudovirus is 96.8 ng / mL. 50 The IC for neutralizing BA.2 pseudovirus is 71.8 ng / mL. 50 The IC value for neutralizing BA.2.75 pseudovirus is 313.1 ng / mL. 50 The IC value for neutralizing BA.2.76 pseudovirus is 955.3 ng / mL. 50 The IC value for neutralizing BA.4 pseudovirus is 160.2 ng / mL. 50 The IC for neutralizing BA.4.6 pseudovirus is 48.0 ng / mL. 50 The IC for neutralizing BF.7 pseudovirus is 24.5 ng / mL. 50 The IC for neutralizing BJ.1 pseudovirus is 17.0 ng / mL. 50 The concentration of H4B6 was 52.1 ng / mL. The results showed that H4B6 has a broad spectrum of highly effective neutralizing activity against pseudoviruses of major variants of concern.

Claims

1. A fully human monoclonal antibody against SARS-CoV-2, characterized in that: The amino acid sequences of the CDR1, CDR2, and CDR3 regions of the heavy chain variable region of the fully human monoclonal antibody against SARS-CoV-2 are shown in the amino acid sequences at positions 26-33, 51-57, and 96-106 of SEQ ID NO: 1, respectively; the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the light chain variable region are shown in the amino acid sequences at positions 27-32, 50-52, and 89-97 of SEQ ID NO: 5, respectively.

2. The fully human monoclonal antibody against SARS-CoV-2 according to claim 1, characterized in that The amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID NO: 1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO:

5.

3. The fully human monoclonal antibody against SARS-CoV-2 according to claim 2, characterized in that The amino acid sequence of the heavy chain constant region of the antibody is shown in SEQ ID NO: 3, and the amino acid sequence of the light chain constant region is shown in SEQ ID NO:

7.

4. A polynucleotide encoding the heavy and light chains of the fully human monoclonal antibody against SARS-CoV-2 according to any one of claims 1 to 3, characterized in that: The polynucleotide sequence encoding the heavy chain variable region of the antibody is shown in SEQ ID NO: 2, and the polynucleotide sequence encoding the light chain variable region of the antibody is shown in SEQ ID NO:

6.

5. The polynucleotide according to claim 4, wherein The sequence of the polynucleotide encoding the heavy chain constant region of the fully human monoclonal antibody against SARS-CoV-2 is shown in SEQ ID NO: 4, and the sequence of the polynucleotide encoding the light chain constant region of the fully human monoclonal antibody against SARS-CoV-2 is shown in SEQ ID NO:

8.

6. A functional element comprising the polynucleotide encoding the heavy and light chains of the fully human monoclonal antibody against SARS-CoV-2 according to claim 5, characterized in that: The functional element is a linear expression cassette or a mammalian expression vector.

7. A host cell comprising the functional element according to claim 6.

8. The host cell according to claim 7, characterized in that The cells are Expi 293F cells.

9. The host cell according to claim 7, characterized in that The cells are CHO-K1 or CHO-S cells.

10. Use of the fully human monoclonal antibody against SARS-CoV-2 according to any one of claims 1 to 3 in the preparation of a drug for the treatment or prevention of COVID-19.

Images