Application of pectin methylesterase inhibitor gene GhPMEI39 or its homologous gene in improving plant seed vigor

Abstract

The present invention provides an application of a pectin methylesterase inhibitor gene GhPMEI39 or a gene sequence with a homology of more than 37% to improve the vigor of plant seeds, and relates to the technical field of molecular breeding. The inventors found in further research that pectin methylesterase and its homologous genes can regulate the seed vigor of plants such as cotton, and overexpression of the pectin methylesterase inhibitor gene GhPMEI39 or its homologous genes can significantly improve the seed vigor of plants. The gene can be introduced into plants as a target gene to promote the seed vigor of plants such as cotton, extend the seed life, and thereby improve the genetic characteristics of cotton seed vigor.

Description

Technical Field

[0001] The invention relates to the technical field of molecular breeding, and in particular to the application of a pectin methylesterase inhibitor gene GhPMEI39 or a homologous gene thereof in improving the vitality of plant seeds. Background Art

[0002] Cotton is the largest cash crop in China, and its yield ranks first among my country's cash crops. Cotton seeds are important means of production for developing cotton production and increasing cotton yields. They are the basis for embryo survival and a necessary structure to ensure that plants produce the next generation. After the seeds are harvested, their vitality will decrease or even be completely lost as the storage time increases. Low-vitality seeds lead to low germination rates, slow emergence, and weak resistance to adversity, which is not conducive to ensuring cotton yields. Therefore, it is of great significance to improve the vitality of cotton seeds.

[0003] Some existing technologies improve the stress resistance of cotton seeds by external reagent treatment. For example, Chinese patent CN112616838B discloses a cotton seed initiator and a method for treating cotton seeds with the initiator. The initiator includes gibberellins, thiamethoxam and adjuvants. The initiator is used to treat cotton seeds under adverse conditions to significantly improve seed vitality and improve the germination rate of seeds in saline soil adversity. Other existing technologies improve cotton seed vitality by means of genetic engineering. For example, Chinese patent CN110904131A discloses a cotton GhGlu19 gene and its application in increasing cotton yield. Inhibiting the expression of GhGlu19 gene can enhance seed vitality. External reagent treatment is prone to produce reagent residues, complicated operation, and is not suitable for large-scale promotion and application. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a pectin methylesterase inhibitor gene GhPMEI39 or a gene sequence with a homology of more than 37% to improve plant seed vigor, and can obtain a transgenic plant with high seed vigor of stable inheritance.

[0005] To achieve the above objectives, the first aspect of the present invention provides the use of pectin methylesterase inhibitor gene GhPMEI39 or a gene sequence with a homology of more than 37% thereto in improving plant seed vigor. The gene sequence of pectin methylesterase inhibitor gene GhPMEI39 is shown in SEQ ID NO.1.

[0006] SEQ ID NO.1 is the CDs sequence of the pectin methylesterase inhibitor gene GhPMEI39 without the stop codon:

[0007] .

[0008] Preferably, the plant comprises cotton or Arabidopsis thaliana.

[0009] Preferably, the gene sequence with a homology of more than 37% to the pectin methylesterase inhibitor gene GhPMEI39 includes the Arabidopsis homologous gene PMEI8 as shown in SEQ ID NO.2:

[0010] ATGAACAAAAAAATGGCTTTGCTTGCAAAACTTCTTATCCTCACCACACTTGTAACAACAATATCAGTAATATCCAGAGCCAATGAAGAGCTAATGATGCAACAATGTCACAACTCTGACAATCCCACCTTGTGT CTTCGCTGTCTAAGCTCCGACCCTGGTTCTCATGAGGCCGACAAAGTAGGACTGGCTCGTATCATCCTCAAATGCATCAACTCACACCTCCTTGTTCTCACCAAGAACGCTTCCACTTTGGGCTCGCAGCACTAC CAGAATCCAAATACTGCAGCAGCGTTGAAGCAGTGCGGTTTGGGTTTCTCAACGGCTAAGCATGGCGTGGGAGAGGCCGACACTCAACTTATAACCGGAGATTACGACAAGGCTGCGTATGACGTCAGCGTGAAG GTGGTGAATCTCCGGTATCGTGCCGCAACAGTCTCGAGGCACTCAACATTCAAGTCCCTTCAAGTTTCCGTTACCATATGGATGTATACTTGGCGTTGACTCAAGCTCTCCTCAGGATCGTTGATCGCTTCTAG

[0011] Preferably, the method of improving plant seed vigor comprises overexpressing the pectin methylesterase inhibitor gene GhPMEI39 or a gene sequence with a homology of more than 37% thereto in seeds.

[0012] In the present invention, the plant seed vigor can be identified by TTC method:

[0013] The oxidation state of TTC (2,3,5-triphenyltetrazolium chloride) is colorless and can be reduced by hydrogen to insoluble red triphenyltetrazolium chloride (TTF). Seeds should be soaked in TTC aqueous solution to allow it to penetrate into the cells of the embryo. If the embryo is alive, the dehydrogenase in it can use TTC as a hydrogen acceptor to reduce it to triphenyltetrazolium chloride and it will be red. If the embryo is dead, it cannot be dyed. If the vitality of the embryo declines or partially loses its vitality, the dyeing is lighter or partially dyed. Therefore, the vitality of the seed can be identified based on the location of the embryo dyeing or the depth of the dyeing.

[0014] Preferably, the method for improving cotton seed vigor by using pectin methylesterase inhibitor gene GhPMEI39 comprises the following steps:

[0015] A1, constructing the expression vector A of the pectin methylesterase inhibitor gene GhPMEI39 with the termination codon removed;

[0016] Preferably, in step A1, the primer sequences used to construct the expression vector A include:

[0017] The upstream primer as shown in SEQ ID NO.3: AACACGGGGGACTCTAGA;

[0018] The downstream primer as shown in SEQ ID NO.4: TACAAACCTATCAACTATTCT.

[0019] In some specific embodiments, the expression vector A is constructed using a PGWB2 vector containing a CaMV 35S promoter.

[0020] A2, transferring the expression vector A into the target cotton plant to obtain the GhPMEI39 overexpressing cotton plant, cultivating the cotton seeds, and screening the GhPMEI39 overexpressing cotton seeds.

[0021] In some specific embodiments, the expression vector A is transferred into the target cotton plant by Agrobacterium infection.

[0022] In some specific embodiments, the expression levels of GhPMEI39 in transgenic plants and wild plants are compared by semi-quantitative PCR or quantitative PCR to screen cotton seeds with overexpression of GhPMEI39.

[0023] In some specific embodiments, the GhUBQ7 gene shown in SEQ ID NO. 7 is used as an internal reference gene when quantitatively comparing the expression levels of GhPMEI39 in transgenic plants and wild plants by CPR.

[0024] SEQ ID NO.7:

[0025] CCTAGCCGCTGTACTTCTACTCCCATTTTTCTTTGCGCATCTTCGCCCATCGCCAAGATGCAGATCTTCGTCAAAACCCTAACGGGGAAGACTATAACCCTAGAGGTCGAGTCTTCGGACACCATTGACAATGTCAAAGCTAAGATCCAAGACAAGGAAGGCATTCCACCTGACCAACAACGTCTTATCTTCGCCGGCAAGCAACTCGAAGATGGCCGCACCTTAGCCGACTACAACATCCAGAAGGAATCCACTCTACACCTTGTCCTCCGTCTCAGGGGAGGTGCGAAGAAGAGAAAGAAGAAGACCTACACCAAGCCCAAGAAGATCAAGCACAAGAAGAAGAAGGTCAAGCTCGCTGTCCTCCAGTTTTACAAGGTGGATGAGTCCGGGAAGGTTCAGAGACTGAGAAAAGAGTGCCCTAATGCGGAATGTGGCGCCGGGACCTTCATGGCTAACCATTTTGATAGGCACTATTGCGGTAAGTGTGGGCTCACTTACGTTTACCAGAAGGCTGGTGGGGATTGAGTAGAGTCCGCTTCTACCTTCGGTTAGTGTCCTGCAAAAAATTGAATCTATAGCTATTTTTCTTTACAATATGAACATTAGGGCTTTGATTTTCCGTAATCGTTGAACTTTTTTAAATTTATGTATGCTTTATTATGTTATGATACTTTGGGTATGATTTTGGAGTTTTGAATGATTTATCAAATCAGCTTTTTGAATCAAAAAAAAAAAAAAAAAAAAAAAAA

[0026] The following amplification primers can be used to detect the expression level of the GhUBQ7 gene:

[0027] Forward primer as shown in SEQ ID NO.8: CCCGAAACCTGCATAAAATG;

[0028] Forward primer as shown in SEQ ID NO.9: GCGATCAAATTGGTTTTCGT.

[0029] Preferably, the method for improving the seed vigor of non-cotton plants by using a gene sequence having a homology of more than 37% with the pectin methylesterase inhibitor gene GhPMEI39 comprises the following steps:

[0030] B1, search for homologous genes to the pectin methylesterase inhibitor gene GhPMEI39 in non-cotton plants;

[0031] Preferably, when the non-cotton plant seed is Arabidopsis thaliana, and the gene sequence having a homology of more than 37% with the pectin methylesterase inhibitor gene GhPMEI39 is the Arabidopsis thaliana homologous gene PMEI8 as shown in SEQ ID NO.2, the primer sequences for constructing the expression vector B in step B2 include:

[0032] Upstream primer as shown in SEQ ID NO.5: CACCATGAACAAAAAAATGGCTTT;

[0033] The downstream primer as shown in SEQ ID NO.6: CTAGAAGCGATCAACGATCC.

[0034] B2, construct expression vector B containing the GhPMEI39 homologous gene with the termination codon removed;

[0035] In some specific embodiments, the expression vector B is constructed using a PGWB2 vector containing a CaMV 35S promoter.

[0036] B3, transferring the expression vector B into the target plant to obtain GhPMEI39 overexpressing plants, cultivating them to obtain plant seeds, and screening non-cotton plant seeds overexpressing GhPMEI39.

[0037] In some specific embodiments, the expression vector A is transferred into the target cotton plant by Agrobacterium infection.

[0038] In some specific embodiments, the expression levels of GhPMEI39 in transgenic plants and wild plants are compared by semi-quantitative PCR or quantitative PCR to screen cotton seeds with overexpression of GhPMEI39.

[0039] In some specific embodiments, when quantitatively comparing the expression levels of GhPMEI39 in transgenic plants and wild plants by CPR, the GhUBQ7 gene shown in SEQ ID NO.7 is used as an internal reference gene, and the amplification primers shown in SEQ ID NO.8 and SEQ ID NO.9 can be used to detect the expression level of the GhUBQ7 gene.

[0040] The second aspect of the present invention provides a kit for improving plant seed vigor, comprising a transgenic expression vector construction reagent for the pectin methylesterase inhibitor gene GhPMEI39 or a gene sequence with a homology of more than 37% thereto, and an overexpression identification reagent.

[0041] In some specific embodiments, the transgenic expression vector construction reagents include GhPMEI39 amplification primers as shown in SEQ ID NO.3 and SEQ ID NO.4; or PMEI8 amplification primers as shown in SEQ ID NO.5 and SEQ ID NO.6.

[0042] Preferably, the overexpression identification reagent includes an internal reference gene GhUBQ7 expression detection reagent and a GhUBQ7 amplification primer; the sequence of the internal reference gene GhUBQ7 is shown in SEQ ID NO.7: GhUBQ7 amplification primers include:

[0043] Upstream primer as shown in SEQ ID NO.8: CCCGAAACCTGCATAAAATG;

[0044] The upstream primer as shown in SEQ ID NO.9: GCGATCAAATTGGTTTTCGT.

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] Pectin methylesterase (PME) is a key enzyme in pectin demethylesterification modification. Pectin methylesterase inhibitor (PMEI) can specifically bind to PME, regulate its activity, and jointly determine the demethylesterification of pectin. The inventor's early research showed that the pectin demethylesterification process mediated by both plays an important role in plant growth and development processes and stress responses such as pollen tube development, root organ formation, and seed germination.

[0047] In further research, the inventors found that pectin methylesterase and its homologous genes can regulate the seed vigor of plants such as cotton. Overexpression of the pectin methylesterase inhibitor gene GhPMEI39 or its homologous gene can significantly improve the seed vigor of plants. This gene can be introduced into plants as a target gene to promote the seed vigor of plants such as cotton, extend the seed life, and thereby improve the genetic characteristics of cotton seed vigor. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 This is a graph showing the relative expression of the GhPMEI39 gene during cotton seed germination in Example 3;

[0049] Figure 2 The germination rate of cotton seeds in Example 3 is statistically shown;

[0050] Among them, 35S:GhPME139-8, 35S:GhPME139-9, and 35S:GhPME139-12 represent three overexpression lines of cotton PMEI39 gene;

[0051] Figure 3 This is the germination diagram of cotton seeds within 24 hours in Example 3;

[0052] Among them, 35S:GhPME139-8, 35S:GhPME139-9, and 35S:GhPME139-12 represent three overexpression lines of cotton PMEI39 gene;

[0053] Figure 4 This is a statistical diagram of methanol content in seeds of each plant in Example 3;

[0054] Among them, 35S:GhPME139-8, 35S:GhPME139-9, and 35S:GhPME139-12 represent three overexpression lines of cotton PMEI39 gene;

[0055] Figure 5 This is a statistical graph of the germination rates of Arabidopsis pmei8-1 and Col-0 in Example 3;

[0056] Among them, pmei8-1 refers to the Arabidopsis mutant (PMEI8 is the homologous gene of GhPMEI39); Col-0 refers to the Arabidopsis wild type (Columbia type); CDT 0 days refers to the artificial aging treatment of 0 days; CDT 3 days refers to the artificial aging treatment of 3 days;

[0057] Figure 6 This is a diagram showing the seed viability data of Arabidopsis pmei8-1 and Col-0 after artificial aging treatment for 0 and 3 days in Example 3;

[0058] Among them, pmei8-1 refers to the Arabidopsis mutant (PMEI8 is the homologous gene of GhPMEI39); Col-0 refers to the Arabidopsis wild type (Columbia type); CDT 0 days refers to the artificial aging treatment of 0 days; CDT 3 days refers to the artificial aging treatment of 3 days;

[0059] Figure 7 The seed viability diagram of Arabidopsis pmei8-1 and Col-0 after artificial aging treatment for 0 days and 3 days represented by TTC staining in Example 3;

[0060] Among them, pmei8-1 refers to the Arabidopsis mutant (PMEI8 is the homologous gene of GhPMEI39); Col-0 refers to the Arabidopsis wild type (Columbia type); CDT 0 days refers to the artificial aging treatment of 0 days; CDT 3 days refers to the artificial aging treatment of 3 days;

[0061] Figure 8 This is a statistical diagram of the methyl esterification degree of Arabidopsis mutant pmei8-1 and wild-type Arabidopsis WT seeds in Example 3. DETAILED DESCRIPTION

[0062] The technical solution provided by the present invention is described in detail below in conjunction with the embodiments. Obviously, the described embodiments are only part of the implementation methods of the present application, rather than all the implementation methods. It should be noted that based on these embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field belong to the scope of protection of the present invention.

[0063] Example 1

[0064] Transduction of GhPMEI39 into recipient cotton includes the following steps:

[0065] 1.1 Cloning the cDNA sequence of GhPMEI39 without the stop codon (SEQ ID NO.1), using pENTR-GhPMEI39 and Gateway LR reaction, the GhPMEI39 cDNA fragment was cloned into the target vector PGWB2 (CaMV 35S promoter) to obtain the pENTR-GhPMEI39 expression vector;

[0066] The sequences of the GhPMEI39 primers are:

[0067] Upstream primer (SEQ ID NO. 3): 5′-AACACGGGGGACTCTAGA-3′;

[0068] Downstream primer (SEQ ID NO. 4): 5′-TACAAACCTATCAACTATTCT-3′.

[0069] 1.2pGWB2-GhPMEI39 Ti plasmid was transferred into Agrobacterium tumefaciens strain LBA4404, and the hypocotyls of 7-day-old ZM24 sterile cotton seedlings (5 days in the dark and 2 days in the light) were used as explants for dipping and cultivation, thereby obtaining transgenic overexpression cotton and harvesting its seeds;

[0070] 1.3 Extract total RNA from the seeds harvested in step 1.2, and use semi-quantitative or quantitative PCR to detect and compare the expression levels of GhPMEI39 in transgenic lines and wild-type plants, identify GhPMEI39 overexpression, and further obtain seeds of positive lines;

[0071] The quantitative PCR method was used to detect and compare the expression of the GhPMEI39 gene in the transgenic lines and the wild-type plants, with GhUBQ7 (DQ116441) as the internal reference gene. The GhUBQ7 amplification primers are as follows:

[0072] Upstream primer: 5′-CCCGAAACCTGCATAAAATG-3′;

[0073] Downstream primer: 5′-GCGATCAAATTGGTTTTCGT-3′.

[0074] 1.4 Disinfect the seeds of the positive strains in step 1.3, and reproduce the seeds of the GhPMEI39 overexpression or heterologous expression transgenic plant strains with good genetic stability according to conventional cultivation and management methods.

[0075] Example 2

[0076] Through protein comparison, it was found that the homologous gene of GhPMEI39 in Arabidopsis is PME18, and PME18 was transduced into the recipient Arabidopsis, including the following steps:

[0077] 1.1 Clone the cDNA sequence of PMEI8 without the stop codon (SEQ ID NO.2), and use pENTR-PMEI8 and Gateway LR reaction to clone the PMEI8 cDNA fragment into the target vector PGWB2 (CaMV 35S promoter) to obtain the pENTR-PMEI8 expression vector;

[0078] The sequences of the PME18 primers are:

[0079] Upstream primer (SEQ ID NO. 5): CACCATGAACAAAAAAATGGCTTT;

[0080] Downstream primer (SEQ ID NO. 6): CTAGAAGCGATCAACGATCC.

[0081] 1.2pGWB2-PMEI8 Ti plasmid was transferred into Agrobacterium tumefaciens strain LBA4404, and the hypocotyls of 7-day-old ZM24 sterile Arabidopsis seedlings (dark treatment for 5 days and light treatment for 2 days) were used as explants for dipping and cultivation, thereby obtaining transgenic overexpression Arabidopsis, and its seeds were harvested;

[0082] 1.3 Extract total RNA from the seeds harvested in step 1.2, and use semi-quantitative or quantitative PCR to detect and compare the expression of PMEI8 in transgenic lines and wild-type plants, identify PMEI8 overexpression, and further obtain seeds of positive lines;

[0083] The quantitative PCR method was used to detect and compare the expression of the PME18 gene in transgenic lines and wild-type plants, with GhUBQ7 (DQ116441) as the internal reference gene. The GhUBQ7 amplification primers are as follows:

[0084] Upstream primer: 5′-CCCGAAACCTGCATAAAATG-3′;

[0085] Downstream primer: 5′-GCGATCAAATTGGTTTTCGT-3′.

[0086] 1.4 Disinfect the seeds of the positive strains in step 1.3, and reproduce the seeds of PME18 overexpression or heterologous expression transgenic plant strains with good genetic stability according to conventional cultivation and management methods.

[0087] Example 3

[0088] This example is used to verify the effects of GhPMEI39 and its homologous genes on plant seed vigor.

[0089] 1. Analysis of PMEI39 gene expression during seed germination

[0090] Using wild cotton variety ZM24, 4-6 healthy and full seeds were selected, 75% alcohol surface disinfection for 3-5 minutes, distilled water rinsed 5 times, the seed surface was wiped dry, placed in a 9cm culture dish with two layers of filter paper, 4-5mL distilled water was added, and placed in a 30℃ dark incubator for 0, 6, 12, 24, 36, 48, 60 hours of imbibition, and then samples were taken. The seeds were frozen in liquid nitrogen and quickly ground into powder, and the samples were stored at -80℃. The experiment was repeated 3 times.

[0091] The results are as follows Figure 1 As shown, it can be seen that GhPMEI39 is a gene specifically expressed in mature seeds.

[0092] 2. Germination test on GhPMEI39 overexpressing seeds (GhPMEI39 OE) and wild-type ZM24

[0093] 20 seeds of GhPMEI39 overexpressing cotton seeds and ZM24 cotton seeds obtained according to Example 1 were placed in a 9 cm culture dish covered with filter paper after surface disinfection, three biological replicates were set, 4-5 ml of water was added, and the culture dish was placed in a 30° C. incubator. The germination rate was counted every 12 h for 6 days, and the germination standard was taken as the radicle length exceeding 1 / 2 of the seed length.

[0094] The results are as follows Figure 2 , 3 As shown in the figure, the germination rate of GhPMEI39 OE was significantly improved compared with ZM24. It can be seen that the GhPMEI39 gene plays an important role in promoting cotton seed germination and seedling growth.

[0095] 3. Determination of methyl ester content in GhPMEI39 overexpressing cotton seeds

[0096] The GhPMEI39 overexpression strains obtained according to Example 1 were detected respectively: 35S:GhPME139-8, 35S:GhPME139-9, and 35S:GhPME139-12.

[0097] The methanol content in cotton seeds of 35S:GhPME139-8, 35S:GhPME139-9, 35S:GhPME139-12 and ZM24 varieties was taken to characterize the degree of methyl esterification. Referring to the method of Christian Silva-Sanzana, 200 mg of seeds were ground in liquid nitrogen, rinsed with 10 mL of 80% (v / v) ethanol solution at room temperature three times, 30 min each time, then rinsed with 1:1 (v / v) methanol:chloroform three times, and then rinsed with 100% acetone three times, each 30 min. The final alcohol-insoluble (AIR) material was evaporated to dryness overnight at room temperature. 1 mg of AIR was mixed with 100 μL of deionized water in a 1.5 mL tube, 100 μL of 1M NaOH was added at 4 ° C, and HG methyl groups were released after alkaline treatment for 1 h, and 100 μL of 1M HCl was added to neutralize the reaction. In a separate 2 mL tube, methanol oxidation was performed using alcohol oxidase by mixing 100 μL of 200 mM Tris-HCl buffer (pH 7.5), 40 μL of 3 mg / mL N-methylbenzothiazolinone-2-hydrazone, 25 μL of previously demethylated sample, and 20 μL of 0.02 U / μL of alcohol oxidase. After a brief vortex, the reaction mixture was incubated at 30 °C for 20 min. The colorimetric reaction was initiated by adding 200 μL of aminosulfonic acid / ammonium ferric sulfate (0.5% [w / v] in deionized water), vortexing briefly, and incubating at room temperature for 20 min. Finally, 600 μL of deionized water was added, and the absorbance was measured at 620 nm. The results are expressed as μmol methanol released per gram of AIR.

[0098] The results of the test are as follows Figure 4 As shown, the methyl ester content of GhPMEI39 OE was significantly increased compared with ZM24, indicating that GhPMEI39 has the function of regulating pectin methyl esterification.

[0099] 4. Phenotypic analysis of Arabidopsis thaliana mutants of the Arabidopsis homologous gene pmei8-1

[0100] Effect of artificial aging of pmei8-1 Arabidopsis mutant materials on seed germination ability: Mature dry seeds (mutants, wild type) grown and harvested at the same time and under the same environment were placed in a sealed glass container with saturated KCl solution and stored at 25°C and 82% relative humidity (RH) for 3 days. After equilibration, the seeds were stored in a humidified incubator at 42°C and 82% relative humidity (RH) for 3 days. After CDT treatment, the seeds were dried at room temperature for 2 days, then the seeds were placed in a 1.5ml centrifuge tube, soaked in ddH2O for 15min, and then surface disinfected with 75% alcohol for 2min, 10% sodium hypochlorite for 7min, and washed with distilled water 5 times, each time for 2min. Finally, the seeds were spotted on 1 / 2MS culture medium and placed in a light incubator to count the germination rates of those without artificial aging and those with artificial aging for three days. The intervals between different germination rates were calculated as mean ± SD. Seed germination analysis of all genotypes was repeated 3 times, with about 100 seeds in each repeat.

[0101] pmei8-1 is a commercial T-DNA insertion mutant (ID, CS828053, SAIL_649_D02), in which the T-DNA is inserted into the first exon of the gene. For specific methods, see reference (Insertional Mutagenesis of Genes Required for Seed Development in Arabidopsis thaliana. McElver, J. 2001, GENETICS).

[0102] The results are as follows Figure 5-7 As shown, seed germination of the pmei8-1 mutant was significantly reduced, indicating that the homologous gene PMEI8 in Arabidopsis has a similar function in regulating seed vigor.

[0103] V. Detection of the degree of methylation (DM) in seeds of pmei8-1 Arabidopsis mutants The whole dried seeds of Arabidopsis mutant pmei8-1 and wild-type Arabidopsis WT were immunostained with two pectin antibodies LM19 and LM20 representing different degrees of methylation: Whole seed immunolabeling was performed according to the method previously described by Amélie Turbant, Yu et al. First, the whole seeds were blocked with 3% (w / v) skim milk powder (1×PBS) for 1 h, and then incubated in 3% (w / v) skim milk powder (1×PBS) diluted 10 times with primary antibodies (LIM19 for low methylation and LIM20 for high methylation) for 1.5 h. The seeds were gently washed three times in 1×PBS and then incubated in Alexa fluor488-labeled anti-rat IgG (for LIM19 and LIM20 monoclonal antibodies) for 2 h in the dark. The seeds were rinsed again with 1×PBS for 3 times and then placed in the dark with 0.5% Calcofluor (fluorescent brightener) for 10 min. After washing three times in water, the seeds were imaged on a FluoView FV1000 spectral confocal laser microscope using 405 and 488 nm lasers.

[0104] The results are as follows Figure 8 As shown, in the Arabidopsis mutant pmei8-1, the fluorescence of LM19, an indicator of low methylated pectin, was stronger, while the high methylated pectin label LM20 was weaker, while the wild Arabidopsis WT showed the opposite trend. This result indicated that the content of methylated pectin was lower in the mutant, that is, the degree of methylation (DM) of seeds of the Arabidopsis mutant pmei8-1 was reduced.

[0105] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of overexpression of pectin methylesterase inhibitor gene GhPMEI39 in improving cotton seed germination rate. The gene sequence of pectin methylesterase inhibitor gene GhPMEI39 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The method for improving cotton seed germination rate by using pectin methylesterase inhibitor gene GhPMEI39 comprises the following steps: A1, constructing the expression vector A of the pectin methylesterase inhibitor gene GhPMEI39 with the termination codon removed; A2, transferring the expression vector A into the target cotton plant to obtain the GhPMEI39 overexpressing cotton plant, cultivating the cotton seeds, and screening the GhPMEI39 overexpressing cotton seeds.

Images