Hydrostatin-amp2 and its encoding gene and application

Abstract

The application relates to the field of biomedicine, and particularly provides a Laticauda colubrina antibacterial peptide Hydrostatin-AMP2, a coding gene and application thereof. The Laticauda colubrina antibacterial peptide Hydrostatin-AMP2 has a protein composed of an amino acid sequence shown as SEQ ID No:1; or, one or more amino acid residues are added, substituted and / or deleted from the amino acid sequence of SEQ ID No:1, and the protein derived from SEQ ID No:1 is related to the Laticauda colubrina antibacterial peptide Hydrostatin-AMP2. Through activity research on the Laticauda colubrina antibacterial peptide Hydrostatin-AMP2, it is found that the Hydrostatin-AMP2 has inhibitory activity on bacteria, the antibacterial peptide can effectively inhibit bacterial proliferation in vitro, and has great clinical application prospect in the field of anti-infection.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the antimicrobial peptide Hydrostatin-AMP2 from the blue-ringed sea snake, its encoding gene, and its applications. Background Technology

[0002] In 2017, the World Health Organization (WHO) released a list of "superbugs" urgently requiring new drugs. These superbugs exhibit multidrug resistance and pathogenicity. Without the development of new drugs, humanity will soon find itself in a situation where no treatments are available. Antimicrobial peptides have long been considered a highly promising alternative to antibiotics, possessing broad-spectrum antibacterial activity. Unlike traditional antibiotics, they can directly affect bacterial cell membranes through electrostatic interactions. Bacteria cannot easily alter their cell membrane structure in a short period, thus preventing the development of drug resistance.

[0003] Currently, Cathelicidins-BF, an effervescent antimicrobial peptide derived from the terrestrial snake *Bungarus fasciatus*, has entered Phase I clinical trials for the treatment of bacterial vaginosis. Sea snakes, being homologous to terrestrial snakes, have been developed into various compound preparations as medicinal animals; however, research on the specific components of sea snakes is limited.

[0004] The inventors obtained a cathelicidins family antimicrobial peptide, Hydrostatin-AMP2, by performing genome sequencing and gene annotation on the blue-ringed sea snake. Summary of the Invention

[0005] The purpose of this invention is to provide a blue-ringed sea snake antimicrobial peptide Hydrostatin-AMP2 and its encoding gene, as well as the application of the blue-ringed sea snake antimicrobial peptide Hydrostatin-AMP2 in the preparation of anti-infective drugs.

[0006] The Hydrostatin-AMP2 of this invention has salt stability and heat resistance, and has extremely strong bactericidal activity, especially against drug-resistant bacteria, and is expected to become a new generation of clinical candidate drugs.

[0007] This invention, through activity studies on the antimicrobial peptide Hydrostatin-AMP2 from the blue-ringed sea snake, discovered the inhibitory activity of Hydrostatin-AMP2 against bacteria. This antimicrobial peptide can effectively inhibit bacterial proliferation in vitro and has great clinical application prospects in the field of anti-infection.

[0008] In a first aspect, the present invention provides a blue-ringed sea snake antimicrobial peptide Hydrostatin-AMP2, wherein the blue-ringed sea snake antimicrobial peptide Hydrostatin-AMP2 has a protein having the following (a) or (b) or (c) or (d):

[0009] (a) A protein consisting of the amino acid sequence shown in SEQ ID No:1;

[0010] (b) A sequence having the same activity as SEQ ID NO:1 derived by substituting, deleting and / or adding one or more amino acid residues to the amino acid sequence of SEQ ID NO:1;

[0011] (c) A sequence with the same activity as SEQ ID NO:1 derived by adding 1-10 amino acid residues to the N-terminus or C-terminus of the amino acid sequence in SEQ ID NO:1;

[0012] (d) Modify the amino acid sequence in SEQ ID NO:1 by attaching polyethylene glycol to the N-terminus or C-terminus to obtain a derived sequence with the same activity as SEQ ID NO:1.

[0013] In a second aspect, the present invention provides a gene encoding the antimicrobial peptide Hydrostatin-AMP2 from the blue-ringed sea snake, which is a DNA molecule as shown in (i) or (ii) below:

[0014] (i) DNA molecules as shown in SEQ ID NO:2;

[0015] (ii) a DNA molecule that hybridizes under stringent conditions with the DNA sequence defined in (i) and encodes the blue sea snake antimicrobial peptide Hydrostatin-AMP2.

[0016] Furthermore, the blue-ringed sea snake antimicrobial peptide Hydrostatin-AMP2 has the amino acid sequence shown in SEQ ID NO:1, is a linear straight-chain polypeptide with a molecular weight of 4198.34 Daltons and an isoelectric point of 12.34.

[0017] In a third aspect, the present invention provides the use of the above-mentioned antimicrobial peptide Hydrostatin-AMP2 from the blue-ringed sea snake, or its encoding gene, in the preparation of antimicrobial drugs.

[0018] Furthermore, the aforementioned antimicrobial infection drug has inhibitory or killing effects on a variety of microorganisms, including Escherichia coli, Staphylococcus aureus, and Klebsiella pneumoniae.

[0019] The present invention also provides an antimicrobial infection drug, wherein the drug has Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake, as the sole active ingredient, or a pharmaceutical composition containing Hydrostatin-AMP2, the antimicrobial peptide from the blue-ringed sea snake.

[0020] Furthermore, the drug is formulated into a pharmaceutical preparation using conventional pharmaceutical excipients.

[0021] Furthermore, the pharmaceutical preparation is a tablet, granule, dispersant, capsule, droplet, injection, powder for injection, or aerosol.

[0022] This invention uses the AlphaFold server to analyze the structure and properties of the antimicrobial peptide Hydrostatin-AMP2 from the blue-ringed sea snake, revealing its typical amphiphilic and α-helical structure. Simultaneously, the DBAASP server was used to predict the antimicrobial spectrum of Hydrostatin-AMP2, indicating its inhibitory activity against various Gram-negative bacteria. The minimum inhibitory concentration (MIC) of Hydrostatin-AMP2 against common bacterial strains was determined using the microbroth dilution method, demonstrating its good antimicrobial activity against both Gram-positive and Gram-negative bacteria. Further analysis using crystal violet staining revealed the biofilm-clearing and inhibitory effects of Hydrostatin-AMP2, demonstrating that it not only inhibits biofilm formation but also significantly eradicates existing mature biofilms. Co-incubation of human blood cells with Hydrostatin-AMP2 showed extremely low hemolytic activity. Therefore, Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake, can be used as an active ingredient in research on antimicrobial infection drugs.

[0023] This invention utilizes bioinformatics analysis tools to obtain the amino acid sequence encoding the antimicrobial peptide Hydrostatin-AMP2 from the blue-ringed sea snake. The peptide is then synthesized using a polypeptide synthesizer, resulting in a simple structure that is easy to prepare. Hydrostatin-AMP2 exhibits low toxicity and broad-spectrum antimicrobial activity.

[0024] Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake, exhibits significant inhibitory activity against Klebsiella pneumoniae, with effects significantly superior to ampicillin. Furthermore, it shows activity against a variety of bacteria and has the potential to become a candidate drug for anti-infective treatment. Attached Figure Description

[0025] Figure 1 This is a predicted structure of Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake.

[0026] Figure 2 These are the chromatographic analysis results of Hydrostatin-AMP2;

[0027] Figure 3 These are the mass spectrometry analysis results for Hydrostatin-AMP2;

[0028] Figure 4The effect of different concentrations of Hydrostatin-AMP2 on the biofilm inhibition of Staphylococcus aureus;

[0029] Figure 5 The biofilm removal effect of different concentrations of Hydrostatin-AMP2 on Staphylococcus aureus;

[0030] Figure 6 The changes in the minimum inhibitory concentration of Hydrostatin-AMP2 against Escherichia coli after incubation in serum for different times;

[0031] Figure 7 The variation of the minimum inhibitory concentration of Hydrostatin-AMP2 against Escherichia coli under different concentrations of sodium chloride;

[0032] Figure 8 The variation of the minimum inhibitory concentration of Hydrostatin-AMP2 against Escherichia coli under different temperature conditions;

[0033] Figure 9 The effect of different concentrations of Hydrostatin-AMP2 on the survival rate of L929 cells;

[0034] Figure 10 The hemolysis rate is the percentage of different concentrations of Hydrostatin-AMP2. Detailed Implementation

[0035] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but should not be considered as limiting the invention. It should be noted that those skilled in the art can make various adjustments and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.

[0036] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0037] The Hydrostatin-AMP2 prepared in Example 3 was used in the experiments of Examples 4-9. The Hydrostatin-AMP2 used in the following examples was synthesized by Beijing Zhongke Yaguang Biotechnology Co., Ltd., and its purity was ≥95% as determined by HPLC.

[0038] Example 1: Structure of Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake

[0039] Simulate the 3D structure of Hydrostatin-AMP2 using the AlphaFold server, such as Figure 1As shown, Hydrostatin-AMP2 is mainly composed of an α-helix structure, with a long, randomly coiled segment at one end, exhibiting amphiphilicity and conforming to the basic structure of known cationic antimicrobial peptides.

[0040] Example 2: Predicting the antibacterial spectrum of Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake.

[0041] The antibacterial spectrum of Hydrostatin-AMP2 was predicted using the DBAASP online server. A positive result indicated activity, and a negative result indicated inactivity. A positive result against human erythrocytes indicated no hemolytic activity. The results are shown in Table 1. Hydrostatin-AMP2 showed activity against Gram-negative bacteria, including *Escherichia coli*, *Pseudomonas aeruginosa*, and *Klebsiella pneumoniae*. It was non-hemolytic and inactive against fungi such as *Candida albicans*. These results indicate that Hydrostatin-AMP2 is non-hemolytic and may have inhibitory activity against Gram-negative bacteria.

[0042] Table 1

[0043]

[0044] Example 3: Synthesis of Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake.

[0045] Hydrostatin-AMP2, an antimicrobial peptide from the blue sea snake, was synthesized in solid phase using the Fmoc method and analyzed by a Varian ProStar 218 high-performance liquid chromatograph (HPLC). Figure 2 ) and Voyager-DE STR mass spectrometry ( Figure 3 Its purity and molecular weight were analyzed. The results show that the purity is >97% and the molecular weight is 4198.34 g / mol.

[0046] The amino acid sequence of the antimicrobial peptide Hydrostatin-AMP2 from the blue-ringed sea snake of the present invention is shown in SEQ ID No:1. The gene sequence is shown in SEQ ID No:2.

[0047] AMP2:KRFKKFFKKLRKSVKKRVKKFFKKPKVIGVSIPF(SEQ ID NO:1)

[0048] Gene sequence:

[0049] AAGAGGTTCAAGAAATTTTTCAAAAAGCTGAGGAAGAGCGTGAAGAAACGTGTCAAGAAATTCTTCAAGAAGCCGAAGGTCATCGGGGTCTCCATCCCCTTC(SEQ ID NO:2)

[0050] Example 4: Minimum Inhibitory Concentration (MIC) of Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake.

[0051] The test strains of Staphylococcus aureus, Escherichia coli, and Propionibacterium acnes were all purchased from Shanghai Fuxiang Biotechnology Co., Ltd. The clinical isolate of Klebsiella pneumoniae was kindly provided by Shanghai Tenth People's Hospital. The assays were performed using the micro-broth 2-fold dilution method.

[0052] The specific experimental steps were as follows: The test strain was inoculated into MH broth medium (purchased from Qingdao Haibo Biotechnology) and cultured at 37℃ with shaking until the logarithmic growth phase. Then, the bacterial culture medium that had reached the logarithmic growth phase was diluted to 1×10⁻⁶ using fresh MH broth medium. 6 Prepare CFU / ml solutions using MH broth, including Hydrostatin-AMP2, ampicillin, and meropenem solutions at concentrations of 1 μg / ml, 2 μg / ml, 4 μg / ml, 8 μg / ml, 16 μg / ml, 32 μg / ml, 64 μg / ml, and 128 μg / ml. Add 100 μl of each of the following solutions to each well of a sterile 96-well plate: Hydrostatin-AMP2, ampicillin, or meropenem solution, followed by 100 μl of the prepared bacterial dilution. Incubate at 37°C for 16–20 hours. Detect the absorbance of the solutions at 600 nm using an ELISA reader.

[0053] The results are shown in Table 2. Hydrostatin-AMP2 exhibited antibacterial activity against both Gram-positive and Gram-negative bacteria, and compared to ampicillin and meropenem, Hydrostatin-AMP2 showed a lower inhibitory concentration against Klebsiella pneumoniae. These results indicate that Hydrostatin-AMP2 has a significant antibacterial effect.

[0054] Table 2

[0055]

[0056] Example 5: Biofilm inhibitory activity of Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake, against Staphylococcus aureus.

[0057] The test strain was inoculated into MH broth medium and cultured at 37°C with shaking until it reached the logarithmic growth phase. It was then diluted to 1×10⁻⁶ using fresh MH broth medium. 6CFU / ml, for later use. Serial dilutions of Hydrostatin-AMP2 were prepared using MH broth medium at concentrations of 0.5, 1, 2, 4, and 8 times the minimum inhibitory concentration (MIC). 100 μl of Hydrostatin-AMP2 solution and 100 μl of bacterial dilution were added to each well of a 96-well plate. For the blank control, 100 μl of bacterial dilution and 100 μl of MH broth medium were added. The plates were incubated at 37°C for 24 hours. The plates were washed three times with sterile PBS to remove airborne bacteria. The plates were fixed with methanol for 20 minutes. The methanol was removed, and the plates were air-dried aseptically. 100 μl of 1% crystal violet solution prepared with PBS was added, and the plates were stained for 30 minutes. The crystal violet was removed, and the plates were washed three times with sterile deionized water. 100 μl of anhydrous ethanol was added to dissolve the biofilm formed at the bottom of the wells. The absorbance of the solution at 600 nm was measured using an ELISA reader to semi-quantitatively estimate the amount of biofilm formed.

[0058] See results Figure 4 Hydrostatin-AMP2, upon interaction with bacteria, can dose-dependently inhibit bacterial biofilm formation. These results demonstrate that Hydrostatin-AMP2 possesses significant bioactivity in inhibiting bacterial biofilm formation.

[0059] Example 6: Biofilm scavenging activity of Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake.

[0060] The test strain was inoculated into MH broth medium and cultured at 37°C with shaking until it reached the logarithmic growth phase. It was then diluted to 1×10⁻⁶ using fresh MH broth medium. 6 CFU / ml. Add 100 μl of bacterial dilution to each well of a 96-well plate and incubate at 37°C for 24 hours. Wash three times with sterile PBS, then add 100 μl of serially diluted Hydrostatin-AMP2 in MH broth at concentrations of 0.5, 1, 2, 4, and 8 times the minimum inhibitory concentration (MIC). Add an equal volume of MH broth to the blank control wells. Incubate at 37°C for 24 hours, then wash three times with sterile PBS. Fix with methanol for 20 minutes. Remove methanol and air dry aseptically. Add 100 μl of 1% crystal violet solution prepared with PBS, stain for 30 minutes, remove crystal violet, and wash three times with sterile deionized water. Add 100 μl of anhydrous ethanol, and use an ELISA reader to detect the absorbance of the solution at 600 nm to semi-quantitatively estimate the remaining biofilm.

[0061] See results Figure 5The Hydrostatin-AMP2 treatment group showed a significant difference from the control group. After the addition of Hydrostatin-AMP2, the absorbance value of the biofilm decreased, and the amount of remaining biofilm was significantly reduced. These results indicate that Hydrostatin-AMP2 has the ability to eradicate mature biofilms.

[0062] Example 7: In vitro stability of Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake.

[0063] (1) Stability of Hydrostatin-AMP2 in serum

[0064] The test strain was inoculated into MH broth medium and cultured at 37°C with shaking until the logarithmic growth phase was reached. The culture was then adjusted to 10⁻⁶ using fresh MH broth medium. 6 CFU / ml, for later use. Dissolve Hydrostatin-AMP2 in sterile deionized water to a final concentration of 10 mg / ml. Mix serum and Hydrostatin-AMP2 solution at a volume ratio of v:v = 4:1 and incubate at 37°C for 1, 2, 3, and 4 hours. At each time point, take equal volumes of Hydrostatin-AMP2 solution and dilute with physiological saline to concentrations of 1 μg / ml, 2 μg / ml, 4 μg / ml, 8 μg / ml, 16 μg / ml, 32 μg / ml, 64 μg / ml, and 128 μg / ml. Add 100 μl of Hydrostatin-AMP2 solution and 100 μl of the above bacterial dilution to each well of a 96-well plate, and incubate at 37°C for 16–20 hours. Detect the absorbance of the solution at 600 nm using an ELISA reader. The stability of Hydrostatin-AMP2 in serum is demonstrated by the change in minimum inhibitory concentration.

[0065] The results are as follows Figure 6 As shown, after incubation, the minimum inhibitory concentration (MIC) of Hydrostatin-AMP2 increased twofold, but it still maintained a good antibacterial effect. These results indicate that Hydrostatin-AMP2 retains its activity after 4 hours of incubation in serum.

[0066] (2) Stability of Hydrostatin-AMP2 in salt solutions of different concentrations

[0067] The test strain was inoculated into MH broth medium and cultured at 37°C with shaking until the logarithmic growth phase. The culture was then adjusted to 1×10⁻⁶ mcg using fresh MH broth medium with final concentrations of 0 mM, 50 mM, 100 mM, 150 mM, and 200 mM sodium chloride. 6CFU / ml, for later use. Dilute Hydrostatin-AMP2 to a series of concentrations using MH broth containing the corresponding sodium chloride concentration: 1 μg / ml, 2 μg / ml, 4 μg / ml, 8 μg / ml, 16 μg / ml, 32 μg / ml, 64 μg / ml, 128 μg / ml. Add 100 μl of Hydrostatin-AMP2 solution to each well of a 96-well plate, followed by 100 μl of the above bacterial dilution. Incubate at 37°C for 18 hours. Measure the absorbance at 600 nm using an ELISA reader. The salt stability of Hydrostatin-AMP2 is demonstrated by the change in minimum inhibitory concentration.

[0068] The results are as follows Figure 7 As shown, treatment with different concentrations of sodium chloride had virtually no effect on the minimum inhibitory concentration (MIC) of Hydrostatin-AMP2. These results indicate that the antibacterial activity of Hydrostatin-AMP2 remains stable in salt solutions of varying concentrations.

[0069] (3) Heat resistance of Hydrostatin-AMP2

[0070] The test strain was inoculated into MH broth medium and cultured at 37°C with shaking until the logarithmic growth phase was reached. The culture was then adjusted to 10⁻⁶ using fresh MH broth medium. 6 CFU / ml, for later use. Dilute Hydrostatin-AMP2 with physiological saline to 1 μg / ml, 2 μg / ml, 4 μg / ml, 8 μg / ml, 16 μg / ml, 32 μg / ml, 64 μg / ml, and 128 μg / ml. Incubate at different temperatures (4℃, 37℃, 80℃, and 100℃) for 1 hour. Add 100 μl of Hydrostatin-AMP2 solution and 100 μl of the above bacterial dilution to each well of a 96-well plate, and incubate at 37℃ for 16-20 hours. Detect the absorbance of the solution at 600 nm using an ELISA reader. The thermostability of Hydrostatin-AMP2 is demonstrated by the change in minimum inhibitory concentration.

[0071] The results are as follows Figure 8 As shown, 4℃, 37℃, and 80℃ did not affect the activity of Hydrostatin-AMP2. Although the high temperature of 100℃ doubled the MIC value of Hydrostatin-AMP2, it still inhibited bacterial proliferation. These results indicate that Hydrostatin-AMP2 has excellent heat resistance.

[0072] Example 8: Cytotoxicity of Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake

[0073] Mouse fibroblast L929 cells (purchased from the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences) were cultured in RPMI-1640 medium (purchased from Hyclone) containing 10% fetal bovine serum (purchased from Gibco) and 1‰ penicillin-streptomycin antibiotic (purchased from Yuanpei Biotechnology).

[0074] The specific experimental steps were as follows: L929 cells were digested with trypsin and resuspended in a culture medium containing antibiotics and serum, and the cell density was adjusted to 2 × 10⁶ cells / year. 4 Cell viability was calculated as follows: 100 μl of culture medium containing Hydrostatin-AMP2 at a concentration of 1 / ml was seeded into 96-well cell culture plates and incubated overnight in a CO2 incubator. The medium was then replaced with 100 μl of culture medium containing the final concentration of Hydrostatin-AMP2, and the cells were incubated for another 24 hours in a CO2 incubator. 10 μl of Cell Counting Kit-8 reagent was added to each well, and the mixture was gently pipetted to mix. The cells were then incubated for another 15-30 minutes. The absorbance of the solution at 480 nm was measured using an ELISA reader. Cell viability was calculated using the formula: Cell viability = (Absorbance value / (Absorbance value)) 对照组 -Absorbance value 实验组 ) / Absorbance value 对照组 *100%, calculate the effect of different concentrations of Hydrostatin-AMP2 on the survival rate of L929 cells.

[0075] The results are as follows Figure 9 As shown, when the concentration of Hydrostatin-AMP2 is as high as 300 μg / ml, the cell viability is still greater than 90%. These results indicate that Hydrostatin-AMP2 is almost non-toxic to L929 cells within its activity range.

[0076] Example 9: Hemolytic activity of Hydrostatin-AMP2, an antimicrobial peptide from the blue-ringed sea snake, against human erythrocytes.

[0077] Hydrostatin-AMP2 was diluted with physiological saline to concentrations of 7.86 μg / ml, 15.63 μg / ml, 31.25 μg / ml, 62.5 μg / ml, 125 μg / ml, and 250 μg / ml. Physiological saline was used as a negative control, and 1% Triton X-100 solution was used as a positive control.

[0078] The specific experimental steps are as follows: Add 200 μl of physiological saline, 1% Triton X-100 solution, or a series of concentrations of Hydrostatin-AMP2 to 1.5 ml centrifuge tubes, and add 50 μl of fresh 2% human blood cell suspension to each tube. Mix well and incubate in a CO2 incubator for 30 minutes. Centrifuge at 25°C and 2000 rpm for 5 minutes. Transfer 180 μl of the supernatant to a 96-well cell culture plate, and use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance of the solution at a wavelength of 540 nm, and calculate the hemolysis rate.

[0079] The results are as follows Figure 10 As shown, even at a concentration as high as 250 μg / ml, the hemolytic rate of human erythrocytes remained no higher than 6%. These results indicate that Hydrostatin-AMP2 has extremely low hemolytic activity.

[0080] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.

[0081]

Claims

1. A blue-ringed sea snake antimicrobial peptide Hydrostatin-AMP2, characterized in that: The amino acid sequence of the antimicrobial peptide Hydrostatin-AMP2 from the blue-ringed sea snake is shown in SEQ ID No:

1.

2. A gene encoding the antimicrobial peptide Hydrostatin-AMP2 from the blue-ringed sea snake as described in claim 1, characterized in that: The encoding gene is a DNA molecule as shown in SEQ ID NO:

2.

3. The application of the blue-ringed sea snake antimicrobial peptide Hydrostatin-AMP2 as described in claim 1 in the preparation of antimicrobial infection drugs, wherein the microorganism is one or more of Escherichia coli, Staphylococcus aureus, or Klebsiella pneumoniae.

4. The application according to claim 3, characterized in that: The antimicrobial infection drug described herein has inhibitory or bactericidal effects against Escherichia coli, Staphylococcus aureus, or Klebsiella pneumoniae.

5. The application of the encoding gene of the antimicrobial peptide Hydrostatin-AMP2 from the blue-ringed sea snake as described in claim 2 in the preparation of antimicrobial infection drugs, wherein the microorganism is one or more of Escherichia coli, Staphylococcus aureus, or Klebsiella pneumoniae.

6. The application according to claim 5, characterized in that: The antimicrobial infection drug described herein has inhibitory or bactericidal effects against Escherichia coli, Staphylococcus aureus, or Klebsiella pneumoniae.

7. An antimicrobial infection drug, characterized in that: The drug is a drug composition containing Hydrostatin-AMP2, the antimicrobial peptide of the blue-ringed sea snake as described in claim 1, as the sole active ingredient, or a drug composition containing Hydrostatin-AMP2, the antimicrobial peptide of the blue-ringed sea snake as described in claim 1.

8. The antimicrobial infection drug according to claim 7, characterized in that: The drug is formulated into a pharmaceutical preparation using conventional pharmaceutical excipients.

9. The antimicrobial infection drug according to claim 8, characterized in that: The pharmaceutical preparation is a tablet, granule, capsule, drop pill, injection, powder for injection, or aerosol.

Images