A Cas9 mutant for improving gene editing efficiency and its application

Abstract

The present invention discloses a Cas9 mutant for improving gene editing efficiency and its application, relating to the field of gene editing technology. The amino acid sequence of the Cas9 mutant is shown in SEQ ID NO.17. This method can be used not only for gene editing in Saccharomyces cerevisiae, but also for other microorganisms that use this gene editing principle. The present invention can not only be used to study the function and metabolic mechanism of yeast genes, but also the mutant strains obtained do not contain any residual foreign genes and can be safely used in industrial production.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and particularly to a Cas9 mutant for improving gene editing efficiency and its application. Background Art

[0002] Saccharomyces cerevisiae is one of the most important hosts for metabolic engineering. Compared to ZFNs and TALENs, gene editing technologies based on the CRISPR-Cas system offer advantages such as relatively simple structure and ease of construction. They have been applied to the design and construction of Saccharomyces cerevisiae cell factories. Among the many naturally occurring CRISPR-Cas systems, the Cas9 nuclease became the first Cas effector used for genome editing. Cas9 possesses numerous features that enable precise and efficient editing. Cas9 specifically recognizes crRNA and its interaction with the transactivating crRNA (tracrRNA), ensuring that Cas9 binds only to its corresponding guide RNA. The crRNA and tracrRNA can be fused into a single guide RNA (sgRNA). Finally, Cas9 requires binding to a DNA fragment adjacent to a specific PAM sequence to trigger its double-stranded DNA cleavage. Scientists worldwide have chosen Cas9 as a gene editing tool precisely because of the controllable nature of this nuclease and the ease with which the Cas9 cleavage site can be altered by modifying the sgRNA target.

[0003] The CRISPR-Cas system enables multiplex genome editing by delivering the Cas9 protein and guide RNA (gRNA) to a functional gene (Jakounas T, Sonde I, Herrgard M, et al. Multiplex metabolic pathway engineering using CRISPR / Cas9 in Saccharomyces cerevisiae. Metabolic Engineering, 2015, 28: 213-222). Cas9 is a modular platform, with its DNA binding and nuclease activities separated into distinct modules. By introducing mutations in the Cas9 nuclease domain, catalytically inactive Cas9 (dCas9) can be generated. This dCas9 serves as a scaffold for protein recruitment, allowing for the disruption of transcription at specific loci without permanently affecting DNA. Using dCas9 has revolutionized functional genetic screening, enabling rapid, specific, and high-throughput gene knockdown in a variety of cell types.

[0004] Chinese patent document CN103725712B discloses a species-free intermediate vector for conditional gene knockout, as well as its preparation method and use. This method can overcome species restrictions and obtain target gene-edited cells. However, this method is relatively cumbersome and relies on the CRISPR / Cas9 system. Although CRISPR / Cas9 technology is efficient, fast, simple and economical, its system has low specificity and a higher probability of off-target effects, making it less stable and mature than traditional gene editing technologies.

[0005] Before realizing the full potential of the CRISPR-Cas system in Saccharomyces cerevisiae, we need to overcome some challenges. One of these challenges is that the editing efficiency of the Cas9 protein in the CRISPR-Cas system in the Saccharomyces cerevisiae genome is not very high. Therefore, constructing a Cas9 protein mutant to improve gene editing efficiency is of great significance to the improvement of gene editing technology. Summary of the Invention

[0006] The purpose of the present invention is to provide a Cas9 mutant and its application that improve the gene editing efficiency of Saccharomyces cerevisiae by CRISPR-Cas9, which has low gene editing efficiency, inconvenience in multi-gene editing research, and difficulty in dual-plasmid construction and transformation.

[0007] A Cas9 mutant that improves gene editing efficiency is obtained by mutating a wild-type Cas9 protein from Streptococcus pyogenes. The amino acid sequence of the wild-type Cas9 protein is shown in SEQ ID NO. 18. The specific mutation is that the 147th amino acid is mutated from aspartic acid to tyrosine, and the 411th amino acid is mutated from proline to threonine. The specific amino acid sequence of the Cas9 mutant is shown in SEQ ID NO. 17.

[0008] The present invention also provides the use of the above-mentioned Cas9 mutant in gene editing.

[0009] The present invention also provides a gene encoding the above-mentioned Cas9 mutant. The gene sequence encoding the Cas9 mutant is shown in SEQ ID NO.5.

[0010] The present invention also provides the use of the above-mentioned gene in gene editing.

[0011] The present invention also provides a recombinant expression plasmid comprising the gene.

[0012] The present invention also provides a genetically engineered bacterium comprising the recombinant expression plasmid.

[0013] The present invention also provides the use of the above-mentioned genetically engineered bacteria in gene editing.

[0014] The present invention also provides a gene editing method, comprising the following steps:

[0015] (1) Design sgRNA for the target gene sequence to be edited;

[0016] (2) constructing a gene editing vector containing the coding gene sequence of the sgRNA and the above-mentioned gene;

[0017] (3) Introducing the gene editing vector described in step (2) into the recipient cells to be gene-edited, and screening to obtain the gene-edited transgenic cells.

[0018] The gene editing vector described in step (2) further comprises a PAM sequence.

[0019] The receptor cells in step (3) include eukaryotic receptor cells and prokaryotic receptor cells. Further, the receptor cells in step (3) include animal cells, plant cells and microbial cells.

[0020] Beneficial effects of the present invention:

[0021] The present invention provides a method for improving the efficiency of gene editing in Saccharomyces cerevisiae based on Cas9 mutants. This method can be used not only for gene editing in Saccharomyces cerevisiae but also for other microorganisms that share the same gene editing principles. This method can be used to study the functions and metabolic mechanisms of yeast genes, and the resulting mutants are free of any residual foreign genes, making them safe for industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Diagram of the construction process of pCRCT-SpiCas9 vector plasmid.

[0023] Figure 2 Diagram of the construction process of pCRCT-SpiCas9-HDR-AGG PAM sgRNA vector plasmid.

[0024] Figure 3 Map of the vector plasmid pCRCT-SpiCas9-HDR-A GG PAM sgRNA for editing the ADE2 gene in Saccharomyces cerevisiae.

[0025] Figure 4 Figure 2 shows the results of colony PCR identification of the inserted HDR-AGG PAM sgRNA.

[0026] Figure 5 Diagram of the NGG (N represents A, G, C, T) PAM site selection process for knocking out the ADE2 gene.

[0027] Figure 6 Map of the AGG PAM sites selected for knockout of the ADE2 gene.

[0028] Figure 7 This is a homologous recombination-mediated ADE2 gene knockout method.

[0029] Figure 8 The results of knocking out the ADE2 gene using pCRCT-SpiCas9-HDR-AGG PAM sgRNA and pCRCT-SpCas9-HDR-AGG PAM sgRNA vector plasmids. DETAILED DESCRIPTION

[0030] Example 1

[0031] DNA polymerase (KOD (Toyobo Biotechnology Co., Ltd.)), Seamless Cloning Kit (Biyuntian Biotechnology Co., Ltd.), PCR product purification kit (Shanghai Biotechnology Co., Ltd.), DpnI enzyme (Baoriyi Biotechnology (Beijing) Co., Ltd.) and other related materials are all commercially available products.

[0032] (1) First, primers were designed using SnapGene 4.3.6 software. The primer sequences were synthesized by Qingke Biogene Co., Ltd. The sequences are as follows:

[0033] D147Y-S: agtagaatctaccaatttttttcgca;

[0034] D147Y-A:aaaaattggtagattctacttataaagcggatttgcgctta;

[0035] P411T-S:aatagagccgttgtcaaaggt;

[0036] P411T-A:acctttgacaacggctctattacccatcaaattcacttgggtga.

[0037] (2) Figure 1 The iCas9 vector was constructed to introduce two mutation sites, D147P (gat-tat) and P411T (ccc-acc). The gene encoding the original Cas9 protein (amino acid sequence shown in SEQ ID NO. 18) was used as the vector template. The gene encoding the original Cas9 protein (amino acid sequence shown in SEQ ID NO. 7) was used as the vector template. PCR was performed using primers D147Y-S and P411T-A to amplify the linear vector template to be connected.

[0038] PCR reaction system (total volume 50 μL): 10× KOD Plus Neo Buffer 5 μL, dNTP 5 μL, MgSO4 3 μL, primer D147Y-S 1.5 μL, primer P411T-A 1.5 μL, Cas9 template 50 ng / 50 μL, KOD Neo 1 μL, and make up to 50 μL with sterile ddH2O.

[0039] PCR amplification reaction program: ① 94℃ for 5 min; ② 98℃ for 10 s; ③ 54℃ for 30 s; ④ 68℃ for 5 min 20 s; ⑤ 68℃ for 10 min; ⑥ 12℃ storage; the number of cycles from ② to ④ was 30 times.

[0040] The target fragment to be connected was amplified by PCR using D147Y-A and P411T-S as primers.

[0041] PCR reaction system (total volume 50 μL): 10× KOD Plus Neo Buffer 5 μL, dNTP 5 μL, MgSO4 3 μL, primer D147Y-A 1.5 μL, primer P411T-S 1.5 μL, Cas9 template 50 ng / 50 μL, KOD Neo 1 μL, and make up to 50 μL with sterile ddH2O.

[0042] PCR amplification reaction procedure: ① 94℃ for 5 min; ② 98℃ for 10 s; ③ 55℃ for 30 s; ④ 68℃ for 30 s; ⑤ 68℃ for 10 min; ⑥ 12℃ storage; the number of cycles from ② to ④ was 30.

[0043] (3) The PCR product of step (2) was recovered using a PCR product purification kit. The recovered template to be ligated was then digested with DpnI enzyme. The digestion reaction system (total volume 50 μL) was as follows: 10× QuickCut Buffer 5 μL, PCR purified product 20 μL, QuickCut DpnI 1 μL, and sterile ddH2O was added to make up to 50 μL.

[0044] Digestion reaction procedure: 37℃ for 1 hour; 75℃ for 10 minutes, and store at 4℃. After the digestion reaction, use the PCR product purification kit to recover the product.

[0045] (4) Use the Seamless Cloning Kit to ligate the linear vector of the digestion recovery product with the target fragment to be ligated in (2) at a molar ratio of 1:3 (ligation system 20 μL): 50-100 ng of the linear vector to be ligated, 10-100 ng of the purified PCR fragment, 10 μL of 2×Seamless Cloning Mix, and fill to 20 μL with sterile ddH2O.

[0046] Ligation reaction procedure: 50°C for 30 min, store at 4°C.

[0047] (5) Operations after the ligation reaction: the volume ratio of the ligation product to the competent E. coli should not exceed 1:10; the ice bath should be kept for 30 minutes; the heat shock time after the ice bath should be 1 minute; the ice bath should be kept for 3 minutes after the heat shock.

[0048] (6) Insert fragment colony PCR system (200 μL): Green Mix 100 μL; sterile ddH2O 84 μL; D147Y+P411T JD-S primer 8 μL; D147Y+P411T JD-A primer 8 μL; aliquot 15 μL for each identified single colony. The identification primers were designed by Qingke Biogene Co., Ltd. and the sequences are as follows:

[0049] D147Y+P411T JD-S primer: agaaggtatacacgtcggaag;

[0050] D147Y+P411T JD-A primer: ttcaataaatgattgagctgaagcac.

[0051] (7) Insert fragment colony PCR program: ①94℃5min; ②98℃10s; ③56℃30s; ④68℃1min20s; ⑤68℃10min; ⑥12℃ storage; the number of cycles from ② to ④ is 30.

[0052] (8) The positive clone transformants were extracted using a plasmid extraction kit and sent to Jinweizhi Biotechnology Co., Ltd. for Snager sequencing to further confirm the correctness of the connected target fragment.

[0053] The pCRCT-SpiCas9 plasmid was verified.

[0054] Example 2

[0055] Restriction endonucleases, kit reagents and other related materials are all commercially available.

[0056] pCRCT-SpiCas9-HDR-AGG PAM sgRNA vector (map as shown Figure 3 As shown) with pCRCT-SpiCas9 plasmid (map as shown) Figure 1As shown in the figure, the starting plasmid was used, and the ADE2 gene of Saccharomyces cerevisiae BY4741 was used as the knockout gene. The ADE2 gene sequence is shown in SEQ ID NO. 8. A 100 bp HR donor was used and the gRNA of the ADE2 gene was designed using the online tool "http: / / crispr.dbcls.jp / " (the map is shown in the figure). Figure 5 As shown). Paste the ADE2 gene sequence into the box, select NGG (N represents A, T, C, G bases), select the budding yeast S288C genome as the reference template, and click design. In the design results, the green-marked gRNA indicates high specificity and low off-target rate. Select the green 20mer+PAM and 12mer+PAM, both of which are 1, and click gRNA. The 20bp upstream of NGG PAM is the gRNA sequence. Select the gRNA with AGG PAM and the 50bp donor DNA on the left and right sides of which 8bp is deleted near AGG PAM (see the map). Figure 7 The combination is as shown in FIG6 ), namely: HDR-AGG PAM sgRNA (nucleotide sequence shown in SEQ ID NO. 6), HDR-AGG PAM sequence with protective bases 5'-CTTT-3' at both ends, BsaI restriction site is GGTCTCN (N represents A, T, C, G bases), the process and results of knocking out the selected AGG PAM site of ADE2 gene are shown in FIG6 . Figure 5 and Figure 6 As shown in Figure 2, the construction process of the pCRCT-SpiCas9-HDR-AGG PAM sgRNA vector plasmid is as follows: Figure 2 As shown,

[0057] The specific construction method is as follows:

[0058] (1) Golden Gate reaction system (total volume 10 μL): pCRCT-SpiCas9 plasmid 50 ng, target fragment 15 ng, T4 DNA ligase buffer (NEB) 1 μL, BsaI enzyme (NEB) 0.8 μL, T4 DNA ligase (NEB) 0.5 μL.

[0059] (2) The reaction procedure of the Golden Gate method is as follows: ①37℃10min; ②37℃10min; ③16℃5min; ④16℃30min; ⑤37℃30min; ⑥80℃6min; ⑦12℃ storage; the number of cycles from ② to ③ is 20.

[0060] (3) Golden Gate reaction product digestion system: add 0.25 μL Plasmid-safe nuclease (epicentre) and 0.5 μL ATP (25 mM) to the product after the Golden Gate reaction.

[0061] (4) Golden Gate reaction product digestion process conditions: 37℃ for 15 min; 75℃ for 10 min; maintain at 4℃.

[0062] (5) Golden Gate reaction product post-digestion transformation system and post-transformation operation: the volume ratio of digestion product to competent E. coli should not exceed 1:10; ice bath time should be 30 min; heat shock time after ice bath should be 1 min; ice bath standing time after heat shock should be 3 min.

[0063] (6) Insert fragment colony PCR system (200 μL): Green Mix 100 μL; sterile ddH2O 84 μL; JD Primer-A 8 μL; JD Primer-S 8 μL; aliquot 15 μL for each identified single colony.

[0064] (7) Insert fragment colony PCR program: ① 94℃ for 5 min; ② 98℃ for 10 s; ③ 55℃ for 30 s; ④ 68℃ for 2 min; ⑤ 68℃ for 10 min; ⑥ 12℃ storage; the number of cycles from ② to ④ is 30.

[0065] The identification primers were designed by Qingke Bio-Gene Co., Ltd. and the sequences are as follows:

[0066] JD primer-S: cagtatagaaccgtggatgatgtc;

[0067] JD Primer-A: gctgtctctccactgtcaaat.

[0068] The constructed gene editing vector pCRCT-SpiCas9-HDR-AGG PAM sgRNA vector consists of a promoter sequence A, a donor DNA sequence B, a 20bp guide sequence C, a promoter sequence D, a Cas9 protein coding gene sequence E, and a resistance screening reporter gene sequence. The donor DNA sequence B and the 20bp guide sequence C are the aforementioned HDR-AGG PAM sequence.

[0069] The nucleotide sequence of the promoter sequence A is shown in SEQ ID No. 1; the nucleotide sequence of the donor DNA sequence B is shown in SEQ ID No. 2; the nucleotide sequence of the 20 bp guide sequence C is shown in SEQ ID No. 3 and Figure 5The nucleotide sequence of the promoter sequence D is shown in SEQ ID No. 4; the coding gene sequence E of the Cas9 protein is the coding gene sequence after two new mutation sites (D147Y, P411T) are introduced into the SF370 Cas9 protein of Streptococcus pyogenes, the nucleotide sequence is shown in SEQ ID No. 5, and the amino acid sequence of the mutated Cas9 protein is shown in SEQ ID No. 17.

[0070] The resistance screening reporter gene is any one or a combination of any two of the following: URA nutritional screening marker gene, ADE nutritional screening marker gene, HIS nutritional screening marker gene, TRP nutritional screening marker gene, LEU nutritional screening marker gene, G418 resistance screening marker gene, KanMX resistance screening marker gene, Amp resistance screening marker gene, hygromycin resistance screening marker gene Hygr, glyphosate resistance screening marker gene Bar, natMX resistance screening marker gene, or bleomycin resistance screening marker gene Bleomycin. The ADE2 gene selected in this example encodes phosphoribosylaminoimidazole carboxylase, which is required for adenine biosynthesis. When adenine is absent from the culture medium, the red pigment accumulates in nonsense mutant cells, facilitating subsequent analysis of editing efficiency.

[0071] The results of colony PCR identification of the inserted HDR-AGG PAM sgRNA are as follows Figure 4 As shown, the target band size is about 1350bp. The correct positive clone transformant was sent to Jinweizhi Biotechnology Co., Ltd. for Snager sequencing to further confirm the correctness of the inserted target fragment.

[0072] The pCRCT-SpiCas9-HDR-AGG PAM sgRNA plasmid was obtained. At the same time, the construction of the pCRCT-SpCas9-HDR-AGG PAMsgRNA plasmid was consistent with that of the pCRCT-SpiCas9-HDR-AGG PAM sgRNA.

[0073] Example 3

[0074] Lithium acetate conversion test of Saccharomyces cerevisiae.

[0075] (1) Streak the starting strain of Saccharomyces cerevisiae on YPD solid agar medium and culture in a constant temperature incubator at 30°C. Pick a single colony and inoculate it into 10 mL of YPD liquid medium and culture it at 220 rpm and 30°C overnight.

[0076] (2) Take out a small amount of cultured bacteria and check under a microscope to see if there is any contamination. If there is no contamination, control the starting OD 600=0.2-0.3, and then take a small amount of bacteria and transfer it to fresh 50mL YPD liquid medium and culture it at 250rpm and 30℃ for 6h until the OD 600 When the concentration reaches about 1.0, the culture can be stopped.

[0077] (3) Pour the cultured cells into a sterile centrifuge tube and centrifuge at 4000 rpm for 10 min. Resuspend the cells twice in sterile water and remove excess culture medium. Finally, resuspend the cells in 1 mL of 100 mM lithium acetate, transfer the cells to a 1.5 mL sterile EP tube, and centrifuge at 10000 rpm for 1 min.

[0078] (4) Remove the supernatant according to the amount of bacteria. Normally, remove 0.5 mL. Resuspend the remaining supernatant and transfer 100 μL of the supernatant to a 1.5 mL sterile EP tube. Centrifuge at 10,000 rpm for 1 min.

[0079] (5) After removing the supernatant again, the following components were added in sequence: 240 μL of PEG 3350 solution (50%, sterile), 50 μL of ssDNA (boiled); 36 μL of 1 M lithium acetate; 1000 ng each of plasmids (pCRCT-SpCas9-HDR-AGG PAM sgRNA and pCRCT-SpiCas9-HDR-AGG PAM sgRNA) and 34 μL of ddH2O.

[0080] (6) After addition, resuspend and mix, and oscillate on a shaker at medium speed for 1 min, followed by heat shock at 42°C for 60 min.

[0081] (7) After the heat shock, centrifuge at 5000 rpm for 2 min and remove the supernatant. Resuspend the yeast pellet with an appropriate amount of sterile water and centrifuge at 5000 rpm for 2 min. Remove the supernatant. Resuspend the pellet with 1 mL of SC-URA liquid medium and transfer it to a 100 mL baffled shake flask pre-filled with 9 mL of SD-URA liquid medium. Incubate the flask at 30°C and 250 rpm for 4 days.

[0082] (8) After the culture was completed, the strain was diluted to 10 4 After the CFU, 200 μL was plated on SC-URA fixed agar plate and cultured for 4 days. The ADE2 gene editing status was counted. The results are as follows: Figure 8 The ADE2 gene editing efficiency of SpiCas9 shown is close to 100%, while the ADE2 gene editing efficiency of SpCas9 under the same experimental conditions is only about 70%. Therefore, it is believed that the editing efficiency of the SpiCas9 mutant is higher than that of SpCas9.

Claims

1. A Cas9 mutant for improving gene editing efficiency, characterized in that: It is derived from Streptococcus pyogenes ( Streptococcus pyogenes ) is obtained by mutating the wild-type Cas9 protein, the amino acid sequence of which is shown in SEQ ID NO.18, wherein the mutation is that the 147th amino acid is mutated from aspartic acid to tyrosine, and the 411th amino acid is mutated from proline to threonine.

2. Use of the Cas9 mutant as described in claim 1 in gene editing.

3. A gene encoding the Cas9 mutant as claimed in claim 1.

4. The gene according to claim 3, wherein The coding gene sequence of the Cas9 mutant is shown in SEQ ID NO.

5.

5. Use of the gene as claimed in claim 3 in gene editing.

6. A recombinant expression plasmid comprising the gene according to claim 3.

7. A genetically engineered bacterium comprising the recombinant expression plasmid according to claim 6.

8. Use of the genetically engineered bacteria as claimed in claim 7 in gene editing.

9. A gene editing method, characterized in that: The following steps are involved: (1) Design sgRNA for the target gene sequence to be edited; (2) constructing a gene editing vector comprising a gene sequence encoding an sgRNA and the gene described in claim 3 or 4; (3) Introducing the gene editing vector described in step (2) into the recipient cells to be gene-edited, and screening to obtain gene-edited transgenic cells.

Images