A dsrna molecule for killing lasioderma serricorne
By using dsRNA molecules targeting the LsCarEB1 gene of the tobacco beetle and a synergist formulation, the problem of tobacco beetle control has been solved, enabling the application of highly efficient and environmentally friendly biological pesticides and significantly reducing the survival rate of the tobacco beetle.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANGHAI PLANT SCI BIOTECHNOLOGY LTD
- Filing Date
- 2021-10-13
- Publication Date
- 2026-05-19
AI Technical Summary
Existing technologies are insufficient to effectively control tobacco beetles, especially their damage to tobacco products in tobacco warehouses, and traditional pesticides may be harmful to the environment and health.
By using dsRNA molecules that target the LsCarEB1 gene of the tobacco beetle, RNA interference technology is used to inhibit its growth and reproduction. Combined with a specific liquid formulation to enhance the stability and activity of the dsRNA, a biopesticide is made for the control of the tobacco beetle.
It achieves a highly effective killing effect on tobacco beetle, with a mortality rate of over 60% within 5 days and over 80% within 10 days, and is also environmentally friendly.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biopesticide science and relates to a dsRNA molecule that targets the LsCarEB1 gene of tobacco beetle and its use in the control of tobacco beetle. Background Technology
[0002] The tobacco beetle (Lasioderma serricorne (Fabricius)) belongs to the family Lasiodermatidae in the order Coleoptera. It is a global storage pest with a complex diet. It can damage grains, beans, and oilseeds in granaries; and is particularly destructive to stored tobacco leaves, cigarettes, cigars, and other tobacco products in tobacco warehouses. Its larvae can bore into tobacco leaves during storage, causing mold and resulting in serious losses to the tobacco industry.
[0003] Because the tobacco beetle has a wide range of food sources, it damages tobacco, tea, cereals, beans, dried dates, oilseeds, animal and plant specimens, cocoa beans, leather, and rattan and bamboo products, with tobacco products being the most severely affected. This insect particularly favors maturing tobacco leaves and can enter the interior of cigarettes along with the processed tobacco, bore into the tobacco shreds, and even puncture the cigarette paper. The insect's carcasses and excrement contaminate tobacco leaves and tobacco products, seriously affecting the usability of tobacco leaves and the quality of cigarettes.
[0004] In the field of agricultural pest and disease control, a 2002 study found that silencing specific target genes could lead to abnormal insect development, embryonic malformations, and even death. This marked the beginning of the application of RNAi technology in entomological research and application. In 2007, reports confirmed that expressing insect dsRNA in transgenic plants could achieve insecticidal effects, providing strong evidence for the application of RNAi technology in pest control. Pesticides developed using this technology are called RNA biopesticides, also known as nucleic acid pesticides, RNA pesticides, or RNA interference agents. These are novel biopesticides developed based on RNA interference technology. Their core component is a polynucleotide that can specifically bind to the mRNA transcribed from the target gene in the target organism. RNA biopesticides can specifically silence the expression of target genes, exhibiting high efficiency and specificity. Their principle involves using specific fragments of endogenous functional genes from the organism, synthesizing them in vitro, and then introducing them into the target species to inhibit gene expression, thereby hindering gene function and ultimately affecting the growth and development of the target species, even leading to death. Due to its species specificity, ease of target development, and easy degradation, it possesses most of the functions required for green pesticides, attracting the attention of numerous scientists and pesticide companies, and is hailed as the third revolution in pesticide production history. For example, on June 15, 2017, the U.S. Environmental Protection Agency (EPA) approved the world's first insect-resistant corn variety, MON87411, expressing insect dsRNA. Currently, many international pesticide companies, such as Bayer-Monsanto, Dow AgroSciences, and Syngenta, are utilizing this technology, investing significant human and material resources in targeted insecticide research and development, and corresponding products are already on the market or about to be launched.
[0005] Years of research by the inventors have revealed that carboxylesterases (CEs) play a crucial role in the growth and metabolism of tobacco beta-lactamases. Carboxylesterases are members of the esterase family, responsible for hydrolyzing carboxylic esters into their corresponding alcohols and carboxylic acids. To date, no endogenous CE substrates have been identified; therefore, these proteins are considered a mechanism for the detoxification of ester-containing xenobiotics. Consequently, they are expressed in tissues potentially exposed to such agents (lung and intestinal epithelium, liver, kidneys, etc.). CEs exhibit very broad substrate specificity, hydrolyzing a variety of compounds, including cocaine, oseltamivir (Tamiflu), permethrin, and irinotecan. Furthermore, these enzymes are irreversibly inhibited by organophosphates such as sarin and tabrin. Carboxylesterases are widely distributed in nature, commonly found in the livers of mammals. Many participate in phase I metabolism of exogenous substances (such as toxins or drugs); the resulting carboxylates then bind to other enzymes to increase solubility and are ultimately excreted. Evolutionary-related proteins in the carboxylesterase family (those proteins that share a clear sequence homology with each other) include many proteins with different substrate specificities, such as acetylcholinesterase. Summary of the Invention
[0006] We have conducted research on the application of RNAi technology to the control of tobacco beetle for many years, and in particular, we have found that RNA interference with its carboxylesterase gene LsCarEB1 can achieve an effective lethal effect. The nucleotide sequence of the LsCarEB1 gene is SEQ ID NO:1. We designed more than 150 double-stranded dsRNA molecules using it as a target. After verification, some of these dsRNA molecules showed particularly outstanding RNAi effects in killing tobacco beetle. Therefore, this invention includes the following technical solution.
[0007] A dsRNA molecule targeting the tobacco methyl LsCarEB1 gene, the nucleotide sequence of its positive strand is selected from SEQ ID NOs:2-6.
[0008] Those skilled in the art will readily understand that each of the above-mentioned double-stranded dsRNA molecules also has an antisense strand complementary to SEQ ID NOs:2-6.
[0009] (SEQ ID NO:2);
[0010] UACAUGGCCGGAAGUGGACAUCAAUACGCUCGACCCACGCAUCUCAUGGAUCGCGACGUUAUAUUCGUCACAUUGAACAACAGACUUUCCGCUUUAGGGUUCUUAUGUCCCGACGAUCCAGACUUCUCCUGCAACAACGGCUUGAAGGAUCAGUCGUUAGCGUUAAAAUGGGUCCAAGACAACAUAAAAAGUUUCGGUGGAAAUCCGAACUCGGUCACUUUAACGGGAUUUUCGGCCGGAGGUUCUAGUGUUCAUUACCAUUACAUUUCGCCUCUUUCGAAAGGGUUAUUUCAUAGAGGUUUCUCCUACAGUGGCACGAUACUCAAUCCGUGGGCUUAUCAGGAGAACCCGAGUGAGAAAUUUUACACAUUGGCUUCUCUGGUCGGUUGCGAUGCGAAGAAAGGCAAAC(SEQ ID NO:3);
[0011] AUGCGAAGAAAGGCAAACACGCUGUAAAAUACCUCGUCGAAUGCCUUCGAACUAAAAGCGCUUAUUCCAUAGUAGAAAAAUACAAACUUUUCGAGGGACUAGUUAACGUAUUCCCUAUAGUGCCUUUCGGACCGCAUUCCGAGAAAGGGAAGAAGGGUGCCGCCGUGCCAGAUCAUCCAUAUAGAAUGCUCGAAGAAGGAAGAAUUAACGACGUACCUUGGAUUAAUUCCAUAACGUCGGAGGAGUCUUUGUUUUUCACUAUCGGGUUAAUUCCUUAUUUGAAGGUGGUUGACAAACAGUGGAGUCACCUGAUGCCGCACAUACUGGAUUACAAUUACACUUUGAGCGAAGAAGAGAAGCCAUUAAUUGCGAAGAAAAUAAGGGAUGUUUAUUUGGGAAAAGAUAAACUCACACGGGAUACGUUCUUAAAGUUCAGUGAAAUUGUUUCAGACAGGCUGUUCAACGUGGAUUCAAUAAAAGCGUCUAAGUUGCAGGCU(SEQ ID NO:4);
[0012] CGUGCCCAGAAGCAACCCGUCAGAAGCCGAGAGCCUCGAUGUCAUCGUCAACAUGCAUGCCGGCUGUUACAUGGCCGGAAGUGGACAUCAAUACGCUCGACCCACGCAUCUCAUGGAUCGCGACGUUAUAUUCGUCACAUUGAACAACAGACUUUCCGCUUUAGGGUUCUUAUGUCCCGACGAUCCAGACUUCUCCUGCAACAACGGCUUGAAGGAUCAGUCGUUAGCGUUAAAAUGGGUCCAAGACAACAUAAAAAGUUUCGGUGGAAAUCCGAACUCGGUCAC(SEQ ID NO:5);
[0013] GAGUCACCUGAUGCCGCACAUACUGGAUUACAAUUACACUUUGAGCGAAGAAGAGAAGCCAUUAAUUGCGAAGAAAAUAAGGGAUGUUUAUUUGGGAAAAGAUAAACUCACACGGGAUACGUUCUUAAAGUUCAGUGAAAUUGUUUCAGACAGGCUGUUCAACGUGGAUUCAAUAAAAGCGUCUAAGUUGCAGGCUAAAGUGGCACACUCGCCUGUUUACGACAUUUAUUUUAGUUACAAAGGUGAACACAGUGUUACCCAAGAUCUUUAUGACAAUUUCAAAGAAAUCUUAGGAGUUACUCACGGCGAUGAUACCCGUUACGCCUUCGUGGGAUUUUACGACCACAUCUUGAGCAAAUCCGACGUUCAAAUGAAGGACCUUUACCUAGACCUUUUCUCGUCUUUUACGAAAACGGGAAUUCCAAAAAUAGCGGGAGUCCAUUGGGAACCCGUUUCUCCGUACGACGAGGAUGAAUUUAAAUAUUUACACAUUUAUUCGCCGAAGAAAAUCGUAAUGGAGAAGAAGAACGAUUUGGUGCCCCAGAAAUUUUGGGA(SEQ ID NO:6).
[0014] Preferably, the nucleotide sequence of the sense strand of the above dsRNA is SEQ ID NO:2. For convenience of description, this double-stranded RNA molecule is referred to as dsLsCarEB1.
[0015] The aforementioned dsRNA molecules can be made into biological pesticides for the control of pests on crops such as tobacco.
[0016] An RNAi pesticide for controlling tobacco beetle, comprising the aforementioned dsRNA molecule.
[0017] In one embodiment, the aforementioned RNAi pesticide may further include a carrier or adjuvant that is beneficial to dsRNA molecules, said carrier and adjuvant being able to properly maintain the stability and activity of RNA molecules.
[0018] The aforementioned RNAi pesticides can be in the form of lyophilized powder, which can be prepared into a solution before use, or they can be in the form of a dilutable solution.
[0019] To enhance the RNAi effect of the aforementioned dsRNA in killing tobacco beetle and improve the efficiency of this RNAi pesticide in controlling pests, the inventors also provide a synergist that can be combined with the aforementioned dsRNA to jointly constitute an RNAi pesticide with improved control efficacy. Specifically, the aforementioned dsRNA is dissolved in a liquid formulation at a concentration of 10-500 mg / L. The liquid formulation may be the one reported in patent document CN113100235A, which comprises the following components by weight percentage: 1-3% potassium oleate; 0.1-0.5% geraniol; 0.005-0.05% synergistic ether; 0.05-0.3% diatomaceous earth; 0.005-0.03% xanthan gum; 0.5-2% SDS; 0.05-0.3% sodium lauroyl sarcosinate; 0.05-0.3% Triton X-100; 0.5-2% alkali metal chloride; 0.1-0.5% alkaline earth metal chloride; and the balance being water.
[0020] Preferably, the above liquid formulation comprises, by weight percentage, the following components: approximately 2% potassium oleate; approximately 0.3% geraniol; approximately 0.01% synergist ether; approximately 0.1% diatomaceous earth; approximately 0.01% xanthan gum; approximately 1% SDS; approximately 0.1% sodium lauroyl sarcosinate; approximately 0.1% Triton X-100; approximately 0.73% sodium chloride; approximately 0.223% potassium chloride; approximately 0.2% magnesium chloride; approximately 0.1% calcium chloride; and the balance being water.
[0021] Another aspect of this invention provides the application of the aforementioned dsRNA molecule or RNAi pesticide in the control of tobacco beetle. Specifically, the aforementioned RNAi pesticide is used to inhibit the growth and reproduction of the tobacco beetle, thereby killing it.
[0022] Specifically, the aforementioned RNAi pesticide is applied to crops on which tobacco beetle (Tobacco A) grows. For example, the aforementioned RNAi pesticide is applied to tobacco leaves.
[0023] Experiments show that spraying tobacco with an aqueous solution of the double-stranded RNA molecule dsLsCarEB1 provided by this invention can achieve a control effect of over 60% on tobacco beetle after 5 days and over 80% after 10 days, indicating promising prospects for widespread application. Attached Figure Description
[0024] Figure 1 This is a bar chart showing the mortality rate of tobacco beetle 5 days after spraying tobacco leaves with an aqueous solution of dsLsCarEB1.
[0025] Figure 2 These are phenotypic photographs of tobacco leaves treated with dsLsCarEB1 and the negative control dsGFP.
[0026] Figure 3 These are photos showing the survival and death of tobacco beetle larvae fed with tobacco leaves after treatment with dsLsCarEB1 and the negative control dsGFP. Detailed Implementation
[0027] This invention uses the carboxylesterase gene LsCarEB1 of tobacco beta as an RNA interference target, providing several dsRNA molecules that are lethal to tobacco beta. The nucleotide sequence of the target gene LsCarEB1 is SEQ ID NO:1.
[0028] Theoretically, dsRNA molecules designed targeting this gene (SEQ ID NO:1) should more or less have the biological function of inhibiting gene expression, thereby suppressing the growth and reproduction of tobacco beetle. However, after experiments, it was found that most of the more than 150 dsRNA molecules we designed did not have the expected function of killing tobacco beetle, and only a few had a lethal effect, including double-stranded dsRNA molecules with the positive strand nucleotide sequence of SEQ ID NOs:2-6, such as dsLsCarEB1 with the positive strand of SEQ ID NO:2.
[0029] In this article, the terms "dsRNA", "dsRNA molecule" or "double-stranded RNA molecule" are used interchangeably, and they all refer to double-stranded molecules formed by the annealing of the sense and antisense strands.
[0030] Double-stranded dsRNAs are large molecules and are easily degraded by nucleases RNase and DNase. To maintain their stability and activity in solution, the inventors used a formulation for improving the insecticidal effect of dsRNA previously reported in patent document CN113100235A for the protection of dsRNA molecules in this invention and found that this liquid formulation can also be used for RNAi schemes to kill tobacco beetle.
[0031] Preferably, the above liquid formulation comprises, by weight percentage, the following components: approximately 2% potassium oleate; approximately 0.3% geraniol; approximately 0.01% synergist ether; approximately 0.1% diatomaceous earth; approximately 0.01% xanthan gum; approximately 1% SDS; approximately 0.1% sodium lauroyl sarcosinate; approximately 0.1% Triton X-100; approximately 0.73% sodium chloride; approximately 0.223% potassium chloride; approximately 0.2% magnesium chloride; approximately 0.1% calcium chloride; and the balance being water.
[0032] It should be understood that in this article, when describing numerical characteristics, the terms "about" or "approximately" mean that the expressed number may have an error range or fluctuation range of ±10%, ±9%, ±8%, ±7%, ±6%, or ±5%.
[0033] dsLsCarEB1 can also be dissolved directly in water to prepare an RNA aqueous solution for the prevention and treatment of tobacco beetle.
[0034] The present invention will be further described below with reference to specific embodiments and accompanying drawings. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.
[0035] In embodiments of the present invention, unless otherwise specified, the experimental operating temperature generally refers to room temperature (10-30°C).
[0036] This article involves the addition amount, content and concentration of various substances. Unless otherwise specified, the percentage content mentioned refers to the weight percentage.
[0037] Example
[0038] Primer synthesis and RNA synthesis in this article were performed by PlatinumBio (Shanghai) Co., Ltd., and sequencing was performed by Shanghai Sunny Biotechnology Co., Ltd.
[0039] The molecular biology experiments described in this article, including plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. Specific experimental conditions could be determined through simple experiments when necessary.
[0040] PCR amplification experiments should be performed according to the reaction conditions or instructions provided by the plasmid or DNA template supplier. Adjustments can be made through simple experiments if necessary.
[0041] Example 1: Obtaining the target gene sequence
[0042] (1) Extraction of total RNA from tobacco A
[0043] Using tobacco acetate as material, the total RNA sample was extracted using the conventional Trizol method, purified using conventional methods, and treated with DNase to obtain a total RNA sample with a concentration ≥300 ng / μl, a total amount ≥6 μg, and an OD260 / 280 of 1.8–2.2.
[0044] (2) Isolation of mRNA and synthesis of cDNA
[0045] mRNA containing polyA was isolated using magnetic beads with oligo-dT, and then the first strand of cDNA was synthesized using random 6-mer and Invitrogen's Superscript II reverse transcriptase kit to obtain the LsCarEB1 gene, with the nucleotide sequence SEQ ID NO:1.
[0046] (3) Amplification and sequencing of the LsCarEB1 gene
[0047] Design the primers specific to the tobacco A LsCarEB1 gene shown in Table 1.
[0048] Table 1. Primer sequences used in this invention
[0049]
[0050]
[0051] Where F is the forward primer and R is the reverse primer.
[0052] The LsCarEB1 gene of tobacco beta was amplified using primers LsCarEB1-F / LsCarEB1-R in Table 1. The obtained gene fragment was purified, ligated into the PMD-18 vector (Takara), transformed into Escherichia coli Top10 strains, and screened by blue-white screening. Positive strains were sequenced to verify their correctness.
[0053] (4) dsRNA synthesis
[0054] A total of 158 dsRNA molecules were designed targeting the LsCarEB1 gene sequence. These molecules were synthesized using the Thermo Fisher dsRNA synthesis kit MEGAscript. TM Synthesis of T7 Transcription Kit (am1334) - please refer to the kit for detailed operating procedures.
[0055] For example, the primer sequences for amplifying dsLsCarEB1 are shown in Table 1 as dsLsCarEB1-F / dsLsCarEB1-R. The positive strand of the amplified dsRNA sequence is SEQ ID NO:2, and the double-stranded molecule is named dsLsCarEB1.
[0056] Following a similar method, the obtained dsRNA molecules include dsRNA molecules with positive strands of SEQ ID NOs:3-6.
[0057] In addition, a double-stranded RNA molecule, dsGFP, with the sense strand nucleotide sequence SEQ ID NO:7, was synthesized as a negative control for the comparative experiment. The primer sequences for amplifying dsGFP are shown in Table 1 as dsGFP-F / dsGFP-R.
[0058] Example 2: Investigation of RNAi pesticide control of tobacco beetle
[0059] The synthesized double-stranded RNA molecules (including dsLsCarEB1 and the negative control dsGFP) were dissolved in pure water at a concentration of 500 ng / μl (500 mg / L). The solution was sprayed evenly onto tobacco leaves using a sprayer. After drying, 10 larvae were inoculated onto each leaf, with each leaf treated 5 times. The survival rate of the larvae was recorded on days 5, 10, and 15 post-treatment. Results are shown below. Figure 1 , Figure 2 and Figure 3 .
[0060] Figure 1 The statistical results of the tobacco beetle mortality rate are shown. It can be seen that, compared with the control dsGFP treatment, the mortality rate of tobacco beetle larvae on tobacco leaves treated with dsLsCarEB1 reached over 60% after 5 days of feeding and over 80% after 10 days of feeding.
[0061] Figure 2 The phenotype of tobacco leaf beetle feeding on double-stranded RNA was shown, and the results indicated that tobacco leaves treated with dsLsCarEB1 were significantly less damaged than those treated with dsGFP.
[0062] Figure 3 Photographs of tobacco beetle larvae that survived and died after feeding on tobacco leaves treated with dsGFP and dsLsCarEB1 are shown, demonstrating that dsLsCarEB1 has a highly lethal effect on tobacco beetles.
[0063] Although the technical solution of the present invention has been described above using the double-stranded RNA molecule dsLsCarEB1 as an example, the RNAi pesticide of the present invention is also applicable to other RNA molecules, which is obvious to those skilled in the art. Therefore, without departing from the spirit of the present invention, those skilled in the art can make various modifications or alterations to the present invention, and equivalent forms of such modifications or alterations should also fall within the scope of the present invention. sequence list <110> Shanghai Zhisheng Yougu Biotechnology Co., Ltd. <120> A dsRNA molecule for killing tobacco beta <130> SHPI2110435 <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1873 <212> DNA <213> Lasioderma serricorne <400> 1 gtcgtttttc tgtttttcgc gcctcacttc taagccaaaa tggccatgat gatgccccct 60 ccccctgtct tccagtttct cggatgcctt ctcttccgtt ttgcttgttg ggggaacgat 120 catcccatcg tggatacacc tttgggccaa attagcggac attacaggtc ttcgtacgag 180 ggaaggaaat tctcagcctt cgagggaatc ccttatgcga aaccacctat cggagagctc 240 agatttaaag aaccacagcc cactgaagct tgggaaggcg tttttcaagc ggataaattg 300 catacatgca tacaatacaa cggattaaaa gatcaaataa caggctcgga ggattgtctc 360 tatttgaacg tttacgtgcc cagaagcaac ccgtcagaag ccgagagcct cgatgtcatc 420 gtcaacatgc atgccggctg ttacatggcc ggaagtggac atcaatacgc tcgacccacg 480 catctcatgg atcgcgacgt tatattcgtc acattgaaca acagactttc cgctttaggg 540 ttcttatgtc ccgacgatcc agacttctcc tgcaacaacg gcttgaagga tcagtcgtta 600 gcgttaaaat gggtccaaga caacataaaa agtttcggtg gaaatccgaa ctcggtcact 660 ttaacgggat tttcggccgg aggttctagt gttcattacc attacatttc gcctctttcg 720 aaagggttat ttcatagagg tttctcctac agtggcacga tactcaatcc gtgggcttat 780 caggagaacc cgagtgagaa attttacaca ttggcttctc tggtcggttg cgatgcgaag 840 aaaggcaaac acgctgtaaa atacctcgtc gaatgccttc gaactaaaag cgcttattcc 900 atatgaaa aatacaaact tttcgaggga ctagttaacg tattccctat agtgcctttc 960 ggaccgcatt ccgagaaagg gaagaagggt gccgccgtgc cagatcatcc atatagatatg 1020 ctcgaagaag gaaattaa cgacgtacct tggattaatt ccataacgtc ggaggagtct 1080 ttgtttttca ctatcgggtt aattccttat ttgaaggtgg ttgacaaaca gtggagtcac ctgatgccgc acatactgga ttacaattac actttgagcg aagaaga gccattaatt gcgaagaaaa taagggatgt ttatttgggga aaagataaac tcacacgggga tacgttctta aagttcagtg aaattgtttc agacaggctg ttcaacgtgg attcaataaa agcgtctaag ttgcaggcta aagtggcaca ctcgcctgtt tacgacattt attttagtta caaaggtgaa cacagtgtta cccaagatct ttatgacaat ttcaaagaaa tcttaggagt tactcacggc gatgataccc gttacgcctt cgtgggattt tacgaccaca tcttgagcaa atccgacgtt 1560. acctttacct agaccttttc tcgtctttta cgaaacggg aattccaaaa atagcgggag tccattggga acccgtttct ccgtacgacg aggtgaatt taaatattta cacatttatt cgccgaaga aatcgtaatg gagaagaga acgatttggt gccccagaaa ttttgggatt cgttgccgtt taaagaaaac gagaatttgg tacacactat aaagtgaaat aattattagg tttttatat gtatgtaaac agtagtagt aggaagtttt catataaaat gagttcgttc attttgataa caacgagaag ttcatttttc gattattaaa ccgttttaat 1860 tcgcagttca agg 1873 <210> 2 <211> 545 <212> RNA <213> Artificial sequence() <400> 2 uacgcucgac ccacgcaucu cauggaucgc gacguuauau ucgucacauu gaacaacaga 60 cuuuccgcuu uaggguucuu augucccgac gauccagacu ucuccugcaa caacggcuug 120 aaggaucagu cguuagcguu aaaauggguc caagacaaca uaaaaaguuu cgguggaaau 180 ccgaacucgg ucacuuuaac gggauuuucg gccggagguu cuaguguuca uuaccauuac 240 auuucgccuc uuucgaaagg guuauuucau agagguuucu ccuacagugg cacgauacuc 300 aauccguggg cuuaucagga gaacccgagu gagaaauuuu acacauuggc uucucugguc 360 gguugcgaug cgaagaaagg caaacacgcu guaaaauacc ucgucgaaug ccuucgaacu 420 aaaagcgcuu auuccauagu agaaaaauac aaacuuuucg agggacuagu uaacguauuc 480 ccuauagugc cuuucggacc gcauuccgag aaagggaaga agggugccgc cgugccagau 540 caucc 545 <210> 3 <211> 409 <212> RNA <213> Artificial sequence () <400> 3 uacauggccg gaaguggaca ucaauacgcu cgacccacgc aucucaugga ucgcgacguu 60 auauucguca cauugaacaa cagacuuucc gcuuuagggu ucuuaugucc cgacgaucca 120 gacuucuccu gcaacaacgg cuugaaggau cagucguuag cguuaaaaug gguccaagac 180 aacauaaaaa guuucggugg aaauccgaac ucggucacuu uaacgggauu uucggccgga 240 gguucuagug uucauuacca uuacauuucg ccucuuucga aaggguuauu ucauagaggu 300 uucuccuaca guggcacgau acucaauccg ugggcuuauc aggagaaccc gagugagaaa 360 uuuuacacau uggcuucucu ggucgguugc gaugcgaaga aaggcaaac 409 <210> 4 <211> 497 <212> RNA <213> Artificial sequence () <400> 4 augcgaagaa aggcaaacac gcuguaaaau accucgucga augccuucga acuaaaagcg 60 cuuauuccau aguagaaaaa uacaaacuuu ucgagggacu aguuaacgua uucccuauag 120 ugccuuucgg accgcauucc gagaaaggga agaagggugc cgccgugcca gaucauccau 180 auagaaugcu cgaagaagga agaauuaacg acguaccuug gauuaauucc auaacgucgg 240 aggagucuuu guuuuucacu aucggguuaa uuccuuauuu gaaggugguu gacaaacagu 300 ggagucaccu gaugccgcac auacuggauu acaauuacac uuugagcgaa gaagagaagc 360 cauuaauugc gaagaaaaua agggauguuu auuugggaaa agauaaacuc acacgggaua 420 cguucuuaaa guucagugaa auuguuucag acaggcuguu caacguggau ucaauaaaag 480 cgucuaaguu gcaggcu 497 <210> 5 <211> 285 <212> RNA <213> Artificial sequence () <400> 5 cgugcccaga agcaacccgu cagaagccga gagccucgau gucaucguca acaugcaugc 60 cggcuguuac auggccggaa guggacauca auacgcucga cccacgcauc ucauggaucg 120 cgacguuaua uucgucacau ugaacaacag acuuuccgcu uuaggguucu uaugucccga 180 cgauccagac uucuccugca acaacggcuu gaaggaucag ucguuagcgu uaaaaugggu 240 ccaagacaac auaaaaaguu ucgguggaaa uccgaacucg gucac 285 <210> 6 <211> 555 <212> RNA <213> Artificial sequence () <400> 6 gagucaccug augccgcaca uacuggauua caauuacacu uugagcgaag aagagaagcc 60 auuaauugcg aagaaaauaa gggauguuua uuugggaaaa gauaaacuca cacgggauac 120 guucuuaaag uucagugaaa uuguuucaga caggcuguuc aacguggauu caauaaaagc 180 gucuaaguug caggcuaaag uggcacacuc gccuguuuac gacauuuauu uuaguuacaa 240 aggugaacac aguguuaccc aagaucuuua ugacaauuuc aaagaaaucu uaggaguuac 300 ucacggcgau gauacccguu acgccuucgu gggauuuuac gaccacaucu ugagcaaauc 360 cgacguucaa augaaggacc uuuaccuaga ccuuuucucg ucuuuuacga aaacgggaau 420 uccaaaaaua gcgggagucc auugggaacc cguuucuccg uacgacgagg augaauuuaa 480 auauuuacac auuuauucgc cgaagaaaau cguaauggag aagaagaacg auuuggugcc 540 ccagaaauuu uggga 555 <210> 7 <211> 368 <212> RNA <213> Artificial sequence () <400> 7 aggacgacgg caacuacaag acccgcgccg aggugaaguu cgagggcgac acccugguga 60 accgcaucga gcugaagggc aucgacuuca aggaggacgg caacauccug gggcacaagc 120 uggaguacaa cuacaacagc cacaacgucu auauacuggc cgacaagcag aagaacggca 180 ucaaggugaa cuucaagauc cgccacaaca ucgaggacgg cagcgugcag cucgccgacc 240 acuaccagca gaacaccccc aucggcgacg gccccgugcu gguccccgac aaccacuacc 300 ugagcaccca guccgcccug agcaaagacc ccaacgagaa gcgcgaucac augguccugc 360 uggaguuc 368
Claims
1. A dsRNA molecule targeting the tobacco methyl LsCarEB1 gene, the nucleotide sequence of its positive strand is SEQ ID NO:
2.
2. An RNAi pesticide for controlling tobacco beetle, characterized in that, Includes the dsRNA molecule as described in claim 1.
3. The RNAi pesticide as described in claim 2, characterized in that, It also includes vectors or adjuvants that maintain the stability of dsRNA molecules.
4. The RNAi pesticide as described in claim 2, characterized in that, Its dosage form is lyophilized powder or solution.
5. The RNAi pesticide as described in claim 4, characterized in that, dsRNA is dissolved in a liquid formulation at a concentration of 10-400 mg / mL, wherein the liquid formulation comprises, by weight percentage: 1-3% potassium oleate; 0.1-0.5% geraniol; 0.005-0.05% synergistic ether; 0.05-0.3% diatomaceous earth; 0.005-0.03% xanthan gum; 0.5-2% SDS; 0.05-0.3% sodium lauroyl sarcosinate; 0.05-0.3% Triton X-100; 0.5-2% alkali metal chloride; 0.1-0.5% alkaline earth metal chloride; balance water.
6. The RNAi pesticide as described in claim 5, characterized in that, The liquid formulation consists of the following components by weight percentage: 2% potassium oleate; 0.3% geraniol; 0.01% synergist ether; 0.1% diatomaceous earth; 0.01% xanthan gum; 1% SDS; 0.1% sodium lauroyl sarcosinate; 0.1% Triton X-100; 0.73% sodium chloride; 0.223% potassium chloride; 0.2% magnesium chloride; 0.1% calcium chloride; balance water.
7. The application of the dsRNA molecule as described in claim 1 or the RNAi pesticide as described in any one of claims 2-6 for the control of tobacco beetle.
8. The application as described in claim 7, wherein the RNAi pesticide is applied to crops on which tobacco A grows.
9. The application as described in claim 8, wherein the RNAi pesticide is applied to tobacco leaves.