A black sea porgy cirbp gene dsRNA and its preparation method and application

Abstract

The present invention is applicable to the field of molecular biology, and provides a black porgy cirbp gene dsRNA and a preparation method and application thereof, wherein the cDNA nucleotide sequence of the black porgy cirbp gene is shown in SEQ ID NO.1; the black porgy cirbp gene dsRNA is obtained by in vitro transcription using the cirbp interference gene fragment of the black porgy as a template; the nucleotide sequence of the cirbp interference gene fragment of the black porgy is shown in SEQ ID NO.3. The black porgy cirbp gene dsRNA can effectively interfere with the cell apoptosis of the black porgy under low temperature stress.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a black sea porgy cirbp gene dsRNA and a preparation method and application thereof. Background Art

[0002] As an important marine economic fish in my country's coastal areas, the research progress on the functional genes of black sea porgy is slow, mainly due to the lack of in vivo RNA interference silencing technology with efficient interference effect suitable for long-term animal research. At present, the commonly used small RNA (si RNA) interference technology is difficult to maintain a high interference efficiency on living fish due to its limited transfection efficiency, and the amount of siRNA required in animal experiments is large and the cost is high. The phenomenon that exogenous or endogenous RNA (double-stranded RNA, dsRNA) induces the inhibition of gene expression of homologous sequences in cells is called RNA interference. At present, dsRNA interference technology has been widely used in the study of gene function of species such as plants, bacteria, insects, shrimps and crabs, and has achieved a series of research results. In recent years, this technology has begun to be used in the study of gene function of zebrafish embryos. However, there are few inventions on its use in living fish.

[0003] Cold-inducible RNA-binding protein (CIRBP) is the first cold-inducible binding protein discovered in mammals. This protein is widely expressed in various tissues and organs in the body, and is widely involved in multiple biological processes under normal physiological conditions or stress conditions, such as cell proliferation, development, apoptosis, differentiation and biological rhythm regulation. With the deepening of research, it is found that CIRBP has some new functions, such as promoting the occurrence of some inflammations and tumors and acting as a new generation of proto-oncogenes. Cold stress can cause apoptosis in multicellular organisms, regulating and removing unnecessary or damaged cells. This phenomenon is regulated by the organism itself to adapt to the environment. Under stress conditions, especially low temperature induction, overexpression of CIRBP in cells can play an anti-apoptotic role. At present, the intrinsic mitochondrial pathway in the apoptosis pathway is a relatively precise pathway studied at home and abroad. This pathway is triggered by the release of cytochrome c (Cyto-c) in mitochondria. In this pathway, the apoptotic protease activating factor-1 gene (apaf-1 gene) is an apoptotic enzyme activating factor that can activate apoptosis-related enzymes; the pro-apoptotic bcl-associated x gene (bax gene) and the anti-apoptotic b-cell lymphoma-2 gene (bcl-2 gene) can regulate the release of apoptotic factors such as Cyt oc in mitochondria and participate in the apoptotic pathway. Smac / Diablo proteins are localized in mitochondria and, after binding to the linked apoptosis inhibitory protein family, inhibit anti-apoptotic activity to enhance apoptosis; the cysteinyl aspartate specific proteinase-3 gene (capase-3 gene) is an apoptotic gene that performs the last step in the mitochondrial apoptosis pathway. The cysteinyl aspartate specific proteinase-1 gene (capase-1 gene) is the main gene that mediates inflammatory responses. It recruits apoptosis-related speck-like proteins to bind to the Capase-1 precursor protein to form an inflammasome complex and activate cellular inflammatory responses. These genes are important genes involved in the apoptotic pathway, and the dynamic changes in their expression levels can indicate whether apoptosis occurs in the body.

[0004] There are few reports on the research content of CIRBP gene in fish. In-depth study of the relevant mechanism of action of CIRBP will help to further explore the cell apoptosis mechanism of liver in black sea porgy under low temperature. Summary of the invention

[0005] The purpose of the embodiment of the present invention is to provide a black sea porgy cirbp gene dsRNA, aiming to solve the problems raised in the background technology.

[0006] The embodiment of the present invention is implemented as follows: a black sea bream cirbp gene dsRNA, whose cDNA nucleotide sequence is shown in SEQ ID NO.1; the black sea bream cirbp gene dsRNA is obtained by in vitro transcription using the cirbp interference gene fragment of black sea bream as a template; the nucleotide sequence of the cirbp interference gene fragment of black sea bream is shown in SEQ ID NO.3.

[0007] Another object of the embodiment of the present invention is to provide a cold-induced RNA binding protein, which is encoded by the above-mentioned black sea bream cirbp gene dsRNA, and its amino acid sequence is shown in SEQ ID NO.2.

[0008] Another object of the present invention is to provide a method for preparing the above-mentioned black sea porgy cirbp gene dsRNA, which comprises the following steps:

[0009] Using the cDNA of the black porgy cirbp gene as a template, specific primers are used to perform PCR amplification to obtain a target fragment;

[0010] The target fragment is used as a template to synthesize the black sea porgy cirbp gene dsRNA.

[0011] As a preferred solution of the embodiment of the present invention, the specific primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO.4 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.5.

[0012] Another object of an embodiment of the present invention is to provide a black sea bream cirbp interference gene fragment, the above-mentioned black sea bream cirbp gene dsRNA or the above-mentioned cold-induced RNA binding protein for preparing a biological inhibitory preparation or kit for interfering with cell apoptosis-related genes in the liver of black sea bream under low temperature stress.

[0013] Another object of an embodiment of the present invention is to provide a black sea bream cirbp interference gene fragment, the above-mentioned black sea bream cirbp gene dsRNA or the above-mentioned cold-induced RNA binding protein for the preparation of a biological inhibitory preparation or kit for inhibiting the transcriptional expression of the cirbp gene.

[0014] Another object of the embodiments of the present invention is to provide a black sea bream cirbp interference gene fragment, the above-mentioned black sea bream cirbp gene dsRNA or the above-mentioned cold-induced RNA binding protein for use in black sea bream breeding.

[0015] Another object of an embodiment of the present invention is to provide a biological inhibitory preparation for inhibiting the transcriptional expression of the cirbp gene or interfering with the cell apoptosis-related genes in the liver of black sea bream under low temperature stress, which includes the above-mentioned black sea bream cirbp gene dsRNA or the above-mentioned cold-induced RNA binding protein.

[0016] Another object of an embodiment of the present invention is to provide a kit for inhibiting the transcriptional expression of the cirbp gene or interfering with apoptosis-related genes in the liver of black sea bream under low temperature stress, which includes the above-mentioned black sea bream cirbp gene dsRNA, the above-mentioned cold-induced RNA binding protein or the above-mentioned biological inhibitory agent.

[0017] The embodiment of the present invention provides a black porgy cirbp gene dsRNA, which has a high interference efficiency for RNA in vivo interference and can effectively achieve the interference effect of the target gene. The black porgy cirbp gene dsRNA can effectively interfere with the cell apoptosis of black porgy under low temperature stress, and can be used for the cultivation of black porgy and the preparation of products that inhibit the transcriptional expression of the cirbp gene and interfere with the cell apoptosis mechanism of the liver of black porgy under low temperature. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a graph showing the effect of injecting dsRNA composed of different primer combinations on the expression of cirbp gene in the liver of black sea porgy.

[0019] Figure 2 This is a graph showing the effects of two groups of dsRNA with higher inhibition rates on the expression of cirbp gene in the liver of black sea bream under cold stress.

[0020] Figure 3 This is a graph showing the effect of cirbp-dsRNA injection on the expression of apoptosis-related genes in the liver of black sea bream.

[0021] Figure 4 Schematic diagram of the genes affected in the mitochondrial apoptosis pathway in liver cells of black sea porgy after injection of cirbp-dsRNA. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0023] In one embodiment of the present invention, a black sea bream cirbp gene dsRNA is provided, and its cDNA nucleotide sequence is shown in SEQ ID NO.1; the black sea bream cirbp gene dsRNA is obtained by in vitro transcription using the cirbp interference gene fragment of black sea bream as a template; the nucleotide sequence of the cirbp interference gene fragment of black sea bream is shown in SEQ ID NO.3.

[0024] In another embodiment of the present invention, a cold-induced RNA binding protein is provided, which is encoded by the above-mentioned black sea bream cirbp gene dsRNA, and its amino acid sequence is shown in SEQ ID NO.2.

[0025] Among them, the cirbp gene of black sea porgy or the cold-induced RNA binding protein of black sea porgy can be used as target sequences to interfere with apoptosis-related genes in the liver of black sea porgy under low temperature.

[0026] In another embodiment of the present invention, a method for preparing the above-mentioned black sea porgy cirbp gene dsRNA is also provided, which comprises the following steps:

[0027] Using the cDNA of the black porgy cirbp gene as a template, specific primers are used to perform PCR amplification to obtain a target fragment;

[0028] The target fragment is used as a template to synthesize the black sea porgy cirbp gene dsRNA.

[0029] Specifically, the specific primer includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.4 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.5; specifically, the sequence of the forward primer is: 5'- TAATACGACTCAC TATAGGG GGCTATGCTGCACACGAGTA-3'; the sequence of the reverse primer is: 5'- TAATACGACTCACTATAGGG TGGACAGTAAGTCGACAGCG-3'; the underlined part is the T7 promoter sequence.

[0030] In another embodiment of the present invention, there is also provided a black sea bream cirbp interference gene fragment, the above-mentioned black sea bream cirbp gene dsRNA or the above-mentioned cold-induced RNA binding protein for preparing a biological inhibitory preparation or kit for interfering with apoptosis-related genes in the liver of black sea bream under low temperature stress.

[0031] In another embodiment of the present invention, a black sea bream cirbp interference gene fragment, the above-mentioned black sea bream cirbp gene dsRNA or the above-mentioned cold-induced RNA binding protein is provided for the preparation of a biological inhibitory preparation or kit for inhibiting the transcriptional expression of the cirbp gene.

[0032] In practical applications, the cirbp gene dsRNA or biological inhibitory agents of black sea bream can be injected into the abdominal cavity of living black sea bream to inhibit the cirbp gene or interfere with the apoptosis-related genes in the liver of black sea bream under low temperature stress; wherein, the injection dose of the cirbp gene dsRNA or biological agents of black sea bream is 2-8 μg / g.

[0033] The black porgy cirbp gene dsRNA provided above has a high interference efficiency for RNA in vivo interference, and can effectively achieve the interference effect of the target gene. The RNA interference efficiency detection method is as follows: the liver tissue of the black porgy is collected at 1h, 12h, 24h, 36h, and 48h after the dsRNA intraperitoneal injection, and the expression level of the cirbp gene is detected by real-time fluorescence quantitative method, the interference efficiency is detected, and it is determined that the dsRNA prepared with the cirbp gene as the target gene has the function of regulating the apoptosis of the liver cells of the black porgy at low temperature.

[0034] In another embodiment of the present invention, a black sea bream cirbp interference gene fragment, the above-mentioned black sea bream cirbp gene dsRNA or the above-mentioned cold-induced RNA binding protein in black sea bream breeding is provided.

[0035] Specifically, the breeding method of black sea bream fry is as follows: the black sea bream fry are raised in a recirculating aquaculture system, fed with carp compound feed, fed 3 times a day, the water volume is changed by 1 / 2, and oxygenated continuously for 24 hours; live injection of dsRNA: the experimental group is injected intraperitoneally with a concentration of 2-8 μg / g / fish body weight to interfere with the black sea bream, and the control group is injected with an equal amount of DEPC water.

[0036] In another embodiment of the present invention, a biological inhibitory agent for inhibiting the transcriptional expression of the cirbp gene or interfering with apoptosis-related genes in the liver of black sea porgy under low temperature stress is provided, which includes the above-mentioned black sea porgy cirbp gene dsRNA or the above-mentioned cold-induced RNA binding protein. It should be noted that the biological inhibitory agent may also include a biologically acceptable carrier.

[0037] In another embodiment of the present invention, a kit for inhibiting the transcriptional expression of cirbp gene or interfering with apoptosis-related genes in liver of black porgy under low temperature stress is provided, which includes the above-mentioned black porgy cirbp gene dsRNA, the above-mentioned cold-induced RNA binding protein or the above-mentioned biological inhibitory agent. It should be noted that the kit may also include other reagents and equipment instruments for interfering with apoptosis-related genes in liver of black porgy under low temperature stress.

[0038] The technical solution of the present invention is further described below in conjunction with specific embodiments and experiments, but does not constitute a limitation of the present invention.

[0039] Example 1

[0040] This embodiment provides a method for preparing dsRNA of the cirbp gene of black porgy, which is to prepare dsRNA using the nucleic acid sequence of the cirbp gene of black porgy, and specifically comprises the following steps:

[0041] S1. RNA extraction from liver tissue of black sea bream: Liver tissue of black sea bream was collected and RNA was extracted according to the instructions of total RNA extraction kit of Shanghai Bioengineering Co., Ltd. The RNA quality was tested by 1.2% agarose gel electrophoresis and the RNA concentration was determined by ultra-micro spectrophotometer. The tissue was stored at -80°C for future use.

[0042] S2. Preparation of dsRNA of cirbp gene of black porgy: A total of three pairs of specific primers for preparing dsRNA were designed according to the cDNA sequence of cirbp gene of black porgy (as shown in SEQ ID NO.1). The sequences of specific primers, amplification conditions and target fragment sizes are shown in Table 1. The three pairs of primers were used to obtain the target fragment by PCR amplification using cDNA synthesized by reverse transcription of total RNA of liver of black porgy as a template, and then the fragment was used as a template to synthesize dsRNA of cirbp gene of black porgy using T7 RNAi Transcription Kit.

[0043] Table 1 Primers used for dsRNA synthesis

[0044]

[0045]

[0046] In Table 1, the underlined portion of the sequence is the T7 promoter sequence.

[0047] Example 2

[0048] This embodiment provides a method for using the black porgy cirbp gene dsRNA synthesized in the above embodiment 1 for in vivo interference of the black porgy, which specifically comprises the following steps:

[0049] S1. Rearing of black sea bream: One-year-old black sea bream (average body weight: 151.3±1.3 g) was reared in a recirculating aquaculture system with a foam box of 90 cm in length, 80 cm in height and 50 cm in width; the water temperature was 22°C and natural light was used; an appropriate amount of bait was fed every day and oxygen was provided throughout the day.

[0050] S2. In vivo injection of black sea porgy cirbp gene dsRNA:

[0051] Screening of the best primers: The synthesized black sea porgy cirbp gene dsRNA was diluted to 150 μg / mL and injected intraperitoneally into the living black sea porgy at an injection dose of 5 μg / g (concentration / fish weight). The experiment was divided into 4 groups (n=10): CIR-dsRNA-1 group, CIR-dsRNA-2 group, CIR-dsRNA-3 group and control group, with 3 replicates in each group. The mortality rate and interference efficiency were detected 1h, 12h, 24h, 36h and 48h after injection. Primer CIR-dsRNA-1 was excluded, and the inhibition efficiency of primers CIR-dsRNA-2 and CIR-dsRNA-3 under low temperature was combined to determine that the best primer sequence was the CIR-dsRNA-3 primer set.

[0052] S3. Effect of RNA interference with cirbp gene on apoptosis pathway in liver tissue of black sea porgy: According to the above primer screening results, the experiment was divided into two groups (n=20). The experimental group was injected with the best primer, and the control group was injected with an equal amount of DEPC water, and cold stress experiments were performed separately. After 24 hours at three temperature points of 15℃, 10℃, and 5℃, liver samples were taken (n=3). Through RNA extraction and RT-qPCR detection, it was determined that this primer still had an inhibitory effect at low temperature, and had a significant effect on the key genes of the apoptosis pathway.

[0053] Experimental results: Compared with the control group, the expression of the target gene in the experimental group was significantly lower than that in the control group. Within 48 hours after the intraperitoneal injection of black porgy cirbp gene dsRNA, the inhibition rate of the mRNA expression of the cirbp gene was as high as 93.54% (48 hours after the injection of dsRNA in black porgy, the expression of cirbp gene in the liver of the control group was 1, and the relative expression of cirbp gene in the experimental group was 0.0642). The RNA in vivo interference performed by this method has a high interference efficiency and can effectively achieve the interference effect of the target gene.

[0054] Example 3

[0055] This embodiment provides a specific preparation method of black porgy cirbp gene dsRNA and an interference experimental method of black porgy cirbp gene dsRNA, which specifically includes the following steps:

[0056] S1. RNA extraction from liver tissue of black sea bream: liver tissue of black sea bream was collected and RNA was extracted using the instructions of the animal tissue total RNA extraction kit of Shanghai Bioengineering Co., Ltd. The RNA quality was tested by 1.2% agarose gel electrophoresis and the RNA concentration was determined by an ultra-micro spectrophotometer. The RNA was stored at -80°C for future use.

[0057] S2. dsRNA primer design: The cDNA sequence of the black sea bream cirbp gene was provided, and the online software SnapDragon-dsRNA Design (https: / / www.flyrnai.org / snapdragon) was used to design specific primers for preparing double-stranded RNA (dsRNA). A T7 promoter sequence was added to the 5' end of each pair of primers: TAATACGACTCACTATAGGG.

[0058] S3. Synthesis of dsRNA of cirbp gene of black sea bream:

[0059] The designed synthetic dsRNA primers were used, and the cDNA of black sea porgy liver was used as a template. According to the instructions of the T7 RNAi Transcription Kit, PCR amplification was performed using the primer sequences in Table 1 above to prepare a high-purity synthetic template. The product was sent to Shanghai Bioengineering Co., Ltd. for sequencing to ensure that its sequence was correct. Then, the fragment was used as a template to synthesize dsRNA using the commercially available T7 RNAi Transcription Kit. The specific reaction system is shown in Table 2:

[0060] Table 2 Reaction system

[0061] Components volume NTPMix 8μL 10×TranscriptionBuffer 2μL T7EnzymeMix 2μL DNA template 4μL <![CDATA[RNase-freeH2O]]> Up to 20 μL

[0062] The PCR reaction conditions were as follows: 37°C for 2 h.

[0063] S4. dsRNA purification:

[0064] Add 80 μL of RNA Clean Beads to the above synthesized product, mix thoroughly and let stand for 8 minutes. Place the PCR tube containing the above mixture on a magnetic rack for 5 minutes. After the solution is clarified, carefully remove the supernatant. Add 200 μL of freshly prepared 80% ethanol to the magnetic rack, incubate at room temperature for 30 seconds, and carefully remove the supernatant. After repeating this step once, open the lid and dry the magnetic beads for 5-10 minutes. Remove the PCR tube from the magnetic rack. Add 40 μL of RNase-free H2O, mix thoroughly, and incubate at room temperature for 3 minutes. Place the PCR tube on a magnetic rack, wait for the solution to clarify, and carefully transfer the supernatant to a new RNase-free EP tube. Detect the A260 absorbance of the product, determine its concentration, and store the purified product at -20°C.

[0065] S5. In vivo injection of dsRNA:

[0066] Screening for the best primer: The dsRNA synthesized with different primer sequences was diluted to the required concentration and injected intraperitoneally at a dose concentration of 5 μg / g (concentration / fish weight). The experiment was divided into 4 groups (n=10): CIR-dsRNA-1 group, CIR-dsRNA-2 group, CIR-dsRNA-3 group and control group, with 3 replicates in each group. The interference efficiency of black sea porgy was detected 1h, 12h, 24h, 36h and 48h after injection.

[0067] S6. Fluorescence quantitative PCR to verify the cirbp gene interference efficiency:

[0068] (1) Tissue RNA extraction and cDNA synthesis

[0069] Liver tissues of black sea porgy were collected from the experimental group and the control group, and RNA was extracted from the samples using a total RNA extraction and purification kit and an RNase-Free DNA cleanup kit. The quality of RNA extraction was tested using a Nano-drop 2000 nucleic acid analyzer (Thermo Fisher) and agarose gel electrophoresis. The total RNA was reverse transcribed to form the first chain of cDNA using the M-MuLV first-strand cDNA synthesis kit (Sangon Biotechnology).

[0070] (2) Real-time fluorescence quantitative PCR detection

[0071] The SuperReal PreMix Plus (SYBR Green) kit produced by TIANGEN was used for real-time fluorescence quantitative PCR, and the black sea bream β-actin gene was used as an internal reference to detect the interference efficiency of cirbp gene expression. The PCR reaction conditions are shown in Table 3 below:

[0072] Table 3 Fluorescence quantitative PCR reaction procedure

[0073]

[0074] The experimental results are based on 2 -ΔΔCT Calculate the relative gene expression.

[0075] S7. Cold stress experiment was performed on the CIR-dsRNA-2 group, CIR-dsRNA-3 group and control group:

[0076] The temperature was lowered from 22°C at a rate of 2°C / h. The temperature was lowered to 15°C, 10°C and 5°C respectively. After maintaining each temperature for 24 hours, samples were taken. Based on the inhibition efficiency of primers CIR-dsRNA-2 and CIR-dsRNA-3 at low temperatures, the optimal primer was determined to be CIR-dsRNA-3.

[0077] S8. Effects of cirbp-dsRNA injection on the expression of genes related to apoptosis pathway in the liver:

[0078] Fluorescence quantitative detection of the expression of the cirbp gene and apoptosis-related genes in black porgy is the same as step S6. The primers used for fluorescence quantitative PCR are shown in Table 4:

[0079] Table 4 Fluorescence quantitative primer information

[0080]

[0081]

[0082] The above experimental results are as follows Figure 1-Figure 4 As shown; specifically, Figure 1 As shown, at 22°C, after intraperitoneal injection of cirbp-dsRNA at a dose of 5 μg / g for 24 hours, no experimental fish died in either the experimental or control group. In the liver tissue of black sea bream, the expression level of cirbp gene in the experimental group was significantly lower than that in the control group (p<0.05), and the expression levels of CIR-RNAi-1 and CIR-RNAi-3 groups dropped to less than 40% of that in the control group after 24 hours. After 36 hours, the expression level of CIR-RNAi-2 group dropped to less than 40% of that in the control group. After 48 hours, the expression levels of cirbp gene in CIR-RNAi-2 and CIR-RNAi-3 groups dropped to less than 20% of that in the control group. The above results show that 36 hours after dsRNA injection, the dsRNA produced by the CIR-RNAi-1 group, CIR-RNAi-2 group and CIR-RNAi-3 group all produced significant inhibition on the expression of cirbp gene in the liver of black sea bream at room temperature (p<0.05). The inhibition rate produced by the dsRNA produced by the CIR-RNAi-2 group and CIR-RNAi-3 group was higher than that of the CIR-RNAi-1 group, so the CIR-RNAi-1 primer group can be ruled out.

[0083] like Figure 2As shown in the figure, the black sea bream in the CIR-RNAi-2 group and the CIR-RNAi-3 group were subjected to cold stress for 24 hours. The expression of the cirbp gene mRNA in the liver of the black sea bream in the primer 2 group was significantly inhibited at 10℃ and 5℃ (p<0.05), but there was no inhibitory effect at 15℃ (p>0.05). The expression of the cirbp gene in the CIR-RNAi-3 group was significantly inhibited at 15℃, 10℃, and 5℃ (p<0.05). Combined with the interference effect of low temperature stress on different primer groups, it was found through comparison that after 24 hours, the expression level of the CIR-RNAi-3 group was the lowest, falling to less than 10% of the control group, and the interference effect on the gene was relatively the best. Therefore, the primers in the CIR-RNAi-3 group were determined to be the best primers for interfering with the cirbp gene.

[0084] like Figure 3 , Figure 4 As shown in the figure, compared with the control group, the expression of bax in the liver of black porgy after RNA interference did not change significantly under low temperature stress. In the 10℃ group, the bcl-2, capase-3, and diablo genes were inhibited compared with the control group during acute low temperature stress. In the 5℃ group, the expression of capase-3 and capase-1 genes increased significantly, and the expression of bcl-2 gene decreased significantly. After RNA interference with the cirbp gene, the expression of apoptosis-related genes in the liver cells of black porgy was significantly affected, that is, the mitochondrial apoptosis mechanism in the liver cells of black porgy was regulated under low temperature. Therefore, the dsRNA biological preparation with the cirbp gene as the target gene can significantly affect the apoptosis-related mechanism in the liver of living black porgy under low temperature stress.

[0085] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A black sea porgy cirbp gene dsRNA, characterized in that: The cDNA nucleotide sequence of the black porgy cirbp gene is shown in SEQ ID NO.1; the black porgy cirbp gene dsRNA is obtained by in vitro transcription using the cirbp interference gene fragment of the black porgy as a template; the nucleotide sequence of the cirbp interference gene fragment of the black porgy is shown in SEQ ID NO.3; The method for preparing the black sea bream cirbp gene dsRNA comprises the following steps: Using the cDNA of the black porgy cirbp gene as a template, specific primers are used to perform PCR amplification to obtain a target fragment; the target fragment is a cirbp interference gene fragment of the black porgy; Using the target fragment as a template, synthesizing the black sea bream cirbp gene dsRNA; The specific primers include a forward primer whose nucleotide sequence is shown as SEQ ID NO.4 and a reverse primer whose nucleotide sequence is shown as SEQ ID NO.

5.

2. Use of the black sea porgy cirbp gene dsRNA as claimed in claim 1 in the preparation of a biological inhibitory preparation or kit for inhibiting the transcriptional expression of the cirbp gene.

3. A kit for inhibiting the transcriptional expression of cirbp gene, characterized in that: It comprises a bio-inhibitory preparation; the bio-inhibitory preparation comprises the black sea porgy cirbp gene dsRNA according to claim 1.

Images