A nucleic acid probe for isothermal recognition of double-stranded DNA and its application

Abstract

The present invention provides a nucleic acid probe for isothermal recognition of double-stranded DNA and its application. By designing a corresponding detection primer series for the sequence to be tested, the distinction and front-end amplification of highly homologous sequences are achieved in the T4DNA ligase amplification coupling system, and the purification is carried out by coupling with magnetic beads, and then the signal is amplified and read using Exo III exonuclease. The detection sensitivity of the technical solution of the present invention can reach 1amol / L, and the specificity can reach the recognition of nucleic acid fragments with differences in a single base. Without the need for complex and expensive temperature control equipment, the exponential amplification and specific and efficient identification of the object to be tested can be achieved in the same tube at the same time, and highly homologous genes can be detected and distinguished with high sensitivity and accuracy, and the test results can be obtained quickly. The present invention has universal applicability, and can achieve high sensitivity, high specificity, rapid and complete isothermal operation in a single tube, which is suitable for instant testing.

Description

Technical Field

[0001] The invention relates to the technical field of double-stranded DNA recognition, and in particular to a nucleic acid probe for isothermally recognizing double-stranded DNA and an application thereof. Background Art

[0002] As of September 8, 2022, the products based on monkeypox nucleic acid detection by relevant domestic and foreign biological companies are mainly concentrated on the research and development and supply of reverse transcription-polymerase chain reaction (RT-PCR) related reagents, and very few provide room temperature amplification enzymes such as Bst DNA polymerase.

[0003] It is true that the real-time fluorescence quantitative nucleic acid amplification detection system (qPCR) has always been the gold standard for the detection of various epidemic infectious viruses, but its high dependence on precise instrumentation and temperature control has greatly limited the widespread use of this detection method. For those backward areas, especially those with a high incidence of the disease, such as West Africa, it has become impractical to widely use qPCR to qualitatively detect viral DNA.

[0004] On the other hand, tracing the origin of epidemic infectious diseases has always been a major difficulty in disease control, which involves the comparison and differentiation of highly homologous sequences. In particular, monkeypox, a paper recently published in the journal Nature Medicine in 2022 conducted an evolutionary branch and pedigree analysis of the 2022 monkeypox outbreak, and found that the average difference between 2022MPXV and the related 2018-2019 virus was 50 single nucleotide polymorphisms (SNPs), which is more than expected. Considering previous estimates of the substitution rate of orthopoxviruses, this different branching may represent accelerated evolution of the virus. This study undoubtedly reveals the importance of single nucleotide polymorphism detection for studying the evolution and tracing of monkeypox viruses, which are not reflected in the currently published journal papers, products that have been launched and are about to be launched.

[0005] Therefore, this application will expand the rapid nucleic acid detection method, make up for the current detection deficiencies, address the problem of poor high-specificity discrimination of multiple highly homologous sequences, get rid of dependence on expensive detection instruments, and realize isothermal in vitro rapid detection. Summary of the invention

[0006] Purpose of the invention: In order to solve the high dependence of traditional detection of various epidemic infectious diseases, such as monkeypox or new coronavirus gene samples on PCR instruments, and to simplify the tracing of epidemic diseases and evolutionary tree analysis, and to solve the problems of complicated mutation frequency procedures, long detection time and high detection cost in the detection process, the present invention provides a method for quickly realizing isothermal amplification and realizing multiple detection of various highly homologous sequences with high sensitivity and specificity. It can quickly determine whether the DNA in the sample is the target gene, and distinguish highly homologous sequences, providing an accurate scientific basis for the doctor's diagnosis, reducing detection time and cost, and proposing a nucleic acid probe for isothermal recognition of double-stranded DNA and its application.

[0007] The technical solution of the present invention:

[0008] A nucleic acid probe for isothermal recognition of double-stranded DNA, comprising:

[0009] Detection system: The detection primers include detection primers and detection reagents; the detection primers are the front primers of the sequence to be detected (Fw probe), the purification primers of the sequence to be detected (BP probe) and the back-end amplification primers of the sequence to be detected (AP probe), and the detection reagents include T4DNA ligase, MgOAC, buffer and RPA dry powder;

[0010] Purification magnetic beads: the purification magnetic beads are streptavidin magnetic beads;

[0011] Secondary amplification system: The secondary amplification system includes ExoIII nuclease and a fluorescent reporter probe of the sequence to be detected.

[0012] In some embodiments, the front primer has a base length of 18 to 24, includes a G / C content of 40 to 60%, and a melting temperature of 50 to 60°C;

[0013] In some embodiments, the purification primer is located upstream of the rear-end amplification primer, and is connected to the rear-end amplification primer head to tail without any interval, the 5' end sequence of the purification primer is modified with a phosphate group, the 3' end sequence is modified with biotin and is complementary to the sequence template to be tested; the purification primer has a base length of 18 to 24, including a G / C content of 40 to 60%, and a melting temperature of 50 to 60°C;

[0014] In some embodiments, the rear end amplification primer has a complementary pairing segment and a non-complementary pairing segment; the complementary pairing segment is complementary to the detection site of the sequence to be tested, has a base length of 18 to 24, includes a G / C content of 40 to 60%, and a melting temperature of 50 to 60° C.; the non-complementary pairing segment has no GC sequence and is 18 to 27 bases in length;

[0015] In some embodiments, the fluorescent reporter probe is complementary to the back-end amplification primer and has a length of 18 nt; the 3' end is a fluorescent group, and the quenching group is separated by three or four bases.

[0016] In another aspect, the present invention also provides the use of the nucleic acid probe for isothermal recognition of double-stranded DNA as described above, comprising the following steps:

[0017] 1) Design front primers, purification primers, back-end amplification primers and fluorescent reporter probes according to the gene to be tested;

[0018] 2) The gene to be tested is configured into a test solution, and the test solution, the front primer of the test sequence, the purification primer of the test sequence, the back-end amplification primer of the test sequence, T4 DNA ligase, MgOAC, buffer and RPA dry powder are mixed evenly to perform an amplification reaction (i.e., T4 ligation isothermal amplification coupling reaction system);

[0019] 3) After the above reaction is completed, the reaction product is mixed with streptavidin magnetic beads for incubation, and after the incubation is completed, the magnetic beads are washed with incubation buffer for purification;

[0020] 4) Take out the streptavidin magnetic beads, add ExoIII exonuclease and fluorescent reporter probe directly to the streptavidin magnetic beads for secondary amplification reaction, and place under a microplate reader to obtain fluorescence readings.

[0021] In some embodiments, the concentration of the test solution is 1aM to 10nM; preferably, the test results are linearly divided, and the results when the concentration of the test solution is 100aM to 1pM are separately extracted, and it is found that the corresponding results have a linear relationship within this range.

[0022] In some embodiments, the concentration ratio of the test solution, the front primer, the purification primer, and the back-end amplification primer is 1-2: 1-2: 1-2: 1.25-2; the final concentration of T4 DNA ligase is 10-20U.

[0023] In some embodiments, the reaction temperature of the amplification reaction is 35-38° C., and the reaction time is 30-60 min.

[0024] In some embodiments, the streptavidin magnetic beads have a diameter of 1 to 10 μm and are modified with streptavidin.

[0025] In some embodiments, the incubation time is 15 to 30 minutes.

[0026] In some embodiments, the incubation buffer includes 1xPBST incubation buffer and 1xPBS incubation buffer; the 1xPBST incubation buffer includes 137mM NaCl, 2.7mM KCl, 4.3mM Na2HPO4, 1.47mM KH2PO4 and 0.05% v / v (volume ratio) Tween-20, and the pH is 7.4; the 1xPBS incubation buffer includes 137mM NaCl, 2.7mM KCl, 4.3mM Na2HPO4 and 1.47mM KH2PO4, and the pH is 7.4.

[0027] In some embodiments, the purification by washing the magnetic beads with an incubation buffer comprises washing twice with 50 to 100 μL 1x PBST and then washing once with 50 to 75 μL 1x PBS buffer.

[0028] In some embodiments, the final concentration of the ExoIII exonuclease is 10-20 U / μL; the final concentration of the fluorescent reporter probe is 400-600 nM.

[0029] In some embodiments, the reaction temperature of the secondary amplification reaction is 36-39° C., and the reaction time is 20-40 min.

[0030] In some embodiments, when the fluorescent group is a FAM fluorescent group, the corresponding excitation wavelength is 494±10nm and the emission wavelength is 518±10nm; when multiple detections are performed, fluorescent groups of different wavelengths can be intentionally selected, and when the emission wavelengths do not overlap, multiple analytes can be detected. When performing fluorescence readings, only the sequence to be tested that matches the primer will produce a fluorescence value higher than the negative control, otherwise the output fluorescence signal is less than or close to the negative control value, and the fluorescence degree is used to determine whether the sequence to be tested is the target sequence.

[0031] Beneficial effects:

[0032] The present invention achieves the distinction and front-end amplification of highly homologous sequences in the T4DNA ligase amplification coupling system by designing a series of detection primers corresponding to highly homologous sequences for the sequence to be tested. After coupling with magnetic beads, the sequence to be tested is directly purified, and then a signal reporter molecule is added to the detection system, and the characteristics of ExoIII exonuclease are used to release the signal reporter molecule to achieve signal amplification and reading, wherein the intensity of the signal is positively correlated with the concentration of the starting related sequence in the object to be tested. The detection sensitivity of the technical solution of the present invention can reach 1amol / L, that is, the single molecule level, and the specificity can reach the nucleic acid fragments that recognize the difference of a single base. In addition, the entire reaction can quickly read highly homologous sequences under the condition of about 37°C. The present invention does not require complex and expensive temperature control equipment, and can detect and distinguish highly homologous genes with high sensitivity and accuracy by comparing standard products, and can quickly obtain test results. Multiple detections are achieved according to different primer designs, and rapid in vitro nucleic acid multiple isothermal detection and epidemic tracing can be achieved. Since the front-end amplification process of the present invention, i.e., the T4 DNA ligase amplification coupling system, is completed in one tube, the exponential amplification and specific and efficient identification of the object to be tested are achieved in one tube at the same time. The single tube realizes high sensitivity and high specificity simultaneous detection and complete isothermal operation in a short time, making the system extremely suitable for point-of-care testing (POCT). The present invention has universal applicability and can perform multiple rapid isothermal detection for various types of nucleic acids, which is extremely clinical and practical. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0034] Figure 1 This is the electrophoresis diagram of the T4 ligation product-polyacrylamide of the new coronavirus Delta mutant strain in Example 1;

[0035] Figure 2 This is the purification result of the new coronavirus Delta mutant strain in Example 1; Figure 3 This is a schematic diagram of the fluorescence signal results of the secondary signal amplification assisted by Exo III exonuclease for 30 minutes in Example 1;

[0036] Figure 4 This is a schematic diagram of the fluorescence signal corresponding to the gradient concentration of the monkeypox B21 glycoprotein mononucleotide C2214 target in Example 2;

[0037] Figure 5 This is a schematic diagram of the overall detection process principle of the technical solution of the present invention;

[0038] Figure 6 This is a schematic diagram of the principle of identifying and distinguishing highly homologous sequences in the technical solution of the present invention;

[0039] Figure 7 This is a schematic diagram of the secondary signal amplification principle of ExoIII nuclease exonuclease in the technical solution of the present invention. DETAILED DESCRIPTION

[0040] The present invention will be described below in conjunction with specific embodiments. It should be noted that the following embodiments are examples of the present invention and are only used to illustrate the present invention, but not to limit the present invention. Other combinations and various modifications within the concept of the present invention may be performed without departing from the spirit or scope of the present invention.

[0041] Unless otherwise specified, the chemical reagents used in the examples of this application are all commercially available analytical grade. T4 DNA ligase in the examples of this application was purchased from Novozymes; RPA lyophilized powder and related buffers were from Twista's kit; the new crown-related primer sequences were synthesized in Shanghai Sangon Biotechnology; the original full-length sequence plasmid of the new crown was purchased from Jinweizhi, and ExoIII nuclease was purchased from Takara; the streptavidin magnetic beads used were Dynabeads TM MyOne TM Streptavidin C1 was purchased from ThermoFisheer, catalog number 65001, with a diameter of 1 μm; the new coronavirus plasmid used was purchased from Genewise, catalog number S-D614G, Q675H in pCDNA3.1(+).

[0042] Example 1

[0043] This example will combine two highly homologous sequences (Delta 157 / 158) from two common mutants of the new coronavirus (the sense chain corresponding to the original sequence S protein coding sequence and the sense chain corresponding to the Delta mutant strain S protein coding sequence) to illustrate the high specificity and sensitivity of the detection system of the present application.

[0044] (1) Primer design:

[0045] The primer sequences in the table below were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0046] Table 1 Primer sequence information whose target is the 6 nucleotides (AGTTCA) that differ between the original strain of COVID-19 and the Delta mutant strain of COVID-19

[0047]

[0048] (2) Detection:

[0049] S1: Add 50 μL of sterile deionized water to the dry powder of the SARS-CoV-2 plasmid (including the original sequence corresponding to SARS-CoV-2 and the full-length encoding sequence of Delta) purchased from GENEWIZ, measure the concentration using Nanodrop, and prepare the DNA solution to be tested through gradient dilution.

[0050] The full-length coding sequence of Delta is as follows:

[0051] 5'-ATATTCAAAAGTGCAATTATTCGCACTAGAATAAACTCCACTTTCCATCCAA CTTTTGTTGTTTTTGTGGTAATAAACATCCAA-3'

[0052] S2: Take the DNA solution to be tested prepared in S1, add T4 DNA ligase, Delta-Fw, Delta-BP, Delta-AP, MgOAC, RPA freeze-dried enzyme and buffer (Primer Free Rehydration buffer) to it and mix evenly, add ultrapure water to make up the total volume to 50 μL, and then add a tube of RPA dry powder in the Twista kit and place it at 37°C for 30 minutes for amplification reaction. The amplification reaction system is shown in Table 2:

[0053] Table 2 Delta amplification reaction system

[0054]

[0055]

[0056] S3: After the amplification reaction in step S2 is completed, the reaction product is directly incubated with streptavidin magnetic beads for 15 minutes, and then the magnetic beads are washed twice with 100 μL 1x PBST buffer, and then washed once with 50 μL 1x PBS buffer to achieve the purification effect. The buffer formula is shown in Table 3:

[0057] Table 3 Buffer formula

[0058]

[0059] (3) Secondary signal amplification:

[0060] Add 50 μL ExoIII exonuclease reaction mixture directly to the streptavidin magnetic beads coupled with the ligation product, and then set the parameters of the microplate reader to an excitation wavelength of 494 nanometers; an emission wavelength of 518 nanometers; and a reaction temperature of 37°C. Perform secondary signal amplification while obtaining fluorescence readings. During the reaction, record the fluorescence signal value at 518 nm every 2 minutes, and the reaction time is 20 minutes. The secondary signal amplification reaction system is shown in Table 4:

[0061] Table 4 Delta secondary signal amplification reaction system

[0062]

[0063] (4) Results:

[0064] Two highly homologous sequences (Delta 157 / 158) in two common mutants of the new coronavirus (the sense chain corresponding to the original sequence S protein coding sequence and the sense chain corresponding to the Delta mutant strain S protein coding sequence). The selected detection fragments of the new coronavirus original strain and the new coronavirus Delta mutant strain differ by only 6 nucleotides (AGTTCA).

[0065] In order to verify the high specificity brought by T4 ligase, DeltaDNA and original sequence of the same concentration (final concentration of 1 μM) were used as templates for ligation reaction verification. The verification system (1 μL of 10 μM Delta / original sequence single-stranded DNA, 1 μL of 10x buffer, 10U of T4 DNA ligase, 1 μL of 10 μM back-end amplification primer AP, 1 μL of 10 μM purified primer BP and 1 μL of 10 μM front-end primer Fw, and then ultrapure water was added to a total volume of 10 μL), reacted at 37°C for 1 hour, and then inactivated at 95°C for 5 minutes. The product was subjected to electrophoresis experiment, electrophoresis conditions: 15% urea polyacrylamide, nucleic acid dye: 1x SYBR Green I; pre-run at 80V for 30 minutes, and then run at a constant voltage of 120V for 80 minutes. The electrophoresis results are as follows: Figure 1 Then, the template in Table 5 was used to replace the DNA solution to be tested in the above verification system, and the other conditions remained unchanged to carry out the experiment.

[0066] Table 5 Lane template

[0067]

[0068] Depend on Figure 1 It can be seen that only when the new crown Delta mutant strain is used as a template, a new band appears in the Deltaligation track compared with the Originalligation track. And the brightness of the corresponding positions of AP and BP, which are the connection objects, fades, indicating that AP and BP are connected and become a new bright band. This phenomenon did not appear in the Original track, indicating that only when the new crown Delta mutant strain is used as a template can it be successfully connected by T4 DNA ligase. The feasibility of this method to identify highly homologous mutants is proved. There are only 6 different nucleotide differences between the original sequence and the corresponding sequence of the Delta mutant S protein, which means that this method has the potential to identify single nucleotide polymorphisms and multiple detection.

[0069] The current ligation product can identify highly homologous mutants, but the excess residual amplification primer (Delta AP) in the supernatant leads to high background noise, in other words, low specificity. Therefore, the ligation product is captured by magnetic beads to remove the redundant interfering sequences to achieve the purification effect. The reaction solution after the purification in step S3 is subjected to electrophoresis experiment, the electrophoresis conditions are as above, and the electrophoresis results are as follows: Figure 2 As shown. The electrophoresis results show that the purification is thorough, and even highly homologous sequences (original sequences) with only 6 nucleotide differences will not produce any interference signals, which means that the final signal amplification will have extremely low background noise. Judging from the fluorescence intensity of the Delta mutant and the original sequence template at a concentration of 1 μM, the effect of the efficient purification method is significant, and the final signals of the original and non-template negative control groups are almost the same, which fully demonstrates the low background noise and high specificity of the invention.

[0070] The results of secondary signal amplification assisted by Exo III exonuclease are shown in Figure 3 As shown. Figure 3 The results showed that the reaction system can detect 1amol / L of Delta sequence within 30 minutes to 1 hour, and can achieve accurate identification of highly homologous single nucleotides.

[0071] Example 2

[0072] The system uses the C2214 single nucleotide mutation site in the monkeypox sequence as a target for detection (this mutation site and the three mutation sites of D209N, M1721l jointly affect the structure of the monkeypox virus antigenic determinant cluster B21 glycoprotein, directly affecting the affinity and accuracy of related immune detection), and the double-stranded DNA template of the C2214 mutation site as a target to illustrate the universality of the system's detection range and the superiority of using double-stranded DNA as a detection target.

[0073] (1) Primer design:

[0074] The primer sequences in the table below were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0075] Table 6 Primer sequence information targeting the single nucleotide mutation site of monkeypox C2214

[0076]

[0077] (2) Detection:

[0078] S1: Add monkeypox plasmid to 50 μL sterile deionized water, measure the concentration using Nanodrop, and dilute it into a test DNA solution (from 10 nM to 1 aM, with a 10-fold dilution interval).

[0079] S2: Take the DNA solution to be tested prepared in S1, add T4 DNA ligase, MPXV-Fw, MPXV-BP, MPXV-AP, MgOAC, RPA freeze-dried enzyme and buffer (Primer Free Rehydration buffer) to mix evenly, add ultrapure water to make up to 50 μL total volume, and then add a tube of RPA dry powder in the Twista kit and place at 37°C for 30 minutes for amplification reaction. The amplification reaction system is shown in Table 7:

[0080] Table 7 MPXV amplification reaction system

[0081]

[0082] S3: After the amplification reaction in step S2 is completed, the reaction product is directly incubated with streptavidin magnetic beads for 15 minutes, and then the magnetic beads are washed twice with 100 μL 1x PBST buffer, and then washed once with 50 μL 1x PBS buffer to achieve a purification effect. The buffer formula is shown in Table 3.

[0083] (3) Secondary signal amplification:

[0084] Add 50 μL of ExoIII exonuclease reaction mixture directly to the streptavidin magnetic beads coupled with the ligation product, and then set the parameters of the microplate reader to an excitation wavelength of 494 nanometers; an emission wavelength of 518 nanometers; and a reaction temperature of 37°C. Perform secondary signal amplification while obtaining fluorescence readings. During the reaction, record the fluorescence signal value at 518 nm every 2 minutes, and the reaction time is 20 minutes. The secondary signal amplification reaction system is shown in Table 8:

[0085] Table 8 MPXV secondary signal amplification reaction system

[0086]

[0087]

[0088] (4) Results:

[0089] The fluorescence signal results corresponding to the gradient concentration of the monkeypox B21 glycoprotein mononucleotide C2214 target are as follows Figure 4 As shown. Figure 4 It can be seen that the detection range of the detection method described in this application can be from 1amol / L to 10nmol / L. Since 1amol / L and 10amol / L exceed the counting range of the amount of the substance, they are not within the linear range. Figure 4 It can also be seen that the detection system has a wide linear range, forming a concentration gradient from 100aM to 1pM. The wide linear range is extremely beneficial for the application of the system in subsequent protein detection.

[0090] Figure 5 The overall process schematic diagram of the invention is shown, and the whole system is simple and easy to operate. It is divided into three steps: (1) T4 DNA ligase amplification reaction occurs. With the help of recombinase and DNA single-strand binding protein, the purification primer and the amplification primer are loaded onto the corresponding template chain. Only when the two primers are completely matched with the template chain can they be successfully connected by T4 DNA ligase, thereby realizing the recognition and distinction of highly homologous sequences (even single nucleotide polymorphisms). At the same time, with the help of the front primer, DNA polymerase can also simultaneously undergo exponential amplification. That is, the whole system realizes an efficient reaction system that integrates the recognition of single nucleotide polymorphisms and exponential amplification at room temperature. (2) The ligation product is incubated and purified with magnetic beads. Only the ligation product will have both biotin labeling and amplification template sequence, because the ligation product can form high-strength hydrogen bonds with streptavidin-modified magnetic beads and be separated and purified. (3) Secondary signal amplification. When the ligation product is captured by the magnetic beads, the fluorescent molecular probe complements it to form a double chain, which is continuously digested by the nuclease exonuclease to release the fluorescent molecular group, thereby causing the fluorescent signal to be cumulatively amplified.

[0091] Figure 6 It demonstrates how the invention can identify and differentiate highly homologous sequences and even identify single nucleotide mutations. The principle is briefly described as follows: with the assistance of the recombinase, specially designed primer probes are loaded into the fragments corresponding to the complementary pairing with the template bases. Because of the targeted design of the primers, primer AP and primer BP will only be completely matched when they encounter the corresponding template, and then they will be recognized by the bound T4 DNA ligase to form new phosphodiester bonds between adjacent DNA fragments. T4 DNA ligase cannot connect two non-adjacent sequences, even if they only differ by one deoxynucleotide unit. With this characteristic of T4 DNA ligase, it is possible to distinguish highly homologous sequences. Figure 6 a shows the basic principle of T4 DNA ligase working with the help of recombinase. Figure 6 b shows the result of T4 DNA ligase recognizing and distinguishing the target sequence Delta and the highly homologous sequence - the original sequence: only when the template sequence Delta is used as a template, new ligation products will appear. No ligation products appear in the original sequence. Therefore, the newly appeared ligation products can be distinguished and further signal amplification can be achieved on this basis.

[0092] Figure 7The basic principle diagram of the secondary signal amplification of ExoIII exonuclease is shown. ExoIII exonuclease is a common exonuclease that digests nucleic acid sequences from the 3' end, and double-stranded DNA is its preferred substrate. Therefore, when the ligation product is successfully coupled to the magnetic beads, the sequence on it is completely complementary to the fluorescent probe in the solution, forming a double-stranded sequence, which becomes the substrate for ExoIII exonuclease. Therefore, under the action of ExoIII exonuclease, the fluorescent signal molecule is continuously digested by the enzyme, releasing the fluorescent group, and realizing the accumulation of fluorescent signals. Figure 7 The right picture shows that after the secondary signal amplification by ExoIII nuclease, the output signal intensity of the entire system is as low as 1aM (1amol / L), achieving single-molecule detection sensitivity.

[0093] The present invention achieves the distinction and front-end amplification of highly homologous sequences in the T4DNA ligase amplification coupling system by designing a series of detection primers corresponding to highly homologous sequences for the sequence to be tested. After coupling with magnetic beads, the sequence to be tested is directly purified, and then a signal reporter molecule is added to the detection system, and the characteristics of Exo III nuclease are used to release the signal reporter molecule to achieve signal amplification and reading, wherein the intensity of the signal is positively correlated with the concentration of the starting related sequence in the test object. The detection sensitivity of the technical solution of the present invention can reach 1amol / L, that is, the single molecule level, and the specificity can reach the nucleic acid fragments that recognize the difference of a single base. In addition, the entire reaction can quickly read highly homologous sequences under the condition of about 37°C. The present invention does not require complex and expensive temperature control equipment. By comparing standard products, highly homologous genes can be detected and distinguished with high sensitivity and accuracy, and the test results can be quickly obtained. Multiple detections are achieved according to different primer designs, and rapid in vitro nucleic acid multiple isothermal detection and epidemic tracing can be achieved. The present invention has universal applicability and can perform multiple rapid isothermal detection for various types of nucleic acids, which is extremely clinical and practical. In addition, since the front-end amplification process of the present invention, that is, the T4 DNA ligase amplification coupling system is completed in one tube, the exponential amplification and specific and efficient identification of the object to be tested are achieved in one tube, which is impossible for other methods. The single tube realizes high-sensitivity and high-specificity simultaneous detection and complete isothermal operation in a short time, making the system extremely suitable for point-of-care testing (POCT).

[0094] The present invention can also have many other embodiments. Without departing from the spirit and essence of the present invention, those skilled in the art can make various corresponding changes and modifications based on the present invention, but these corresponding changes and modifications should all fall within the scope of protection of the claims attached to the present invention.

Claims

1. A nucleic acid probe for isothermal recognition of double-stranded DNA, characterized in that: include: Detection system: The detection system includes detection primers and detection reagents; the detection primers are the front primers of the sequence to be detected, the purification primers of the sequence to be detected and the back primers of the sequence to be detected, and the detection reagents include T4 DNA ligase, MgOAC, buffer and RPA dry powder; Purification magnetic beads: the purification magnetic beads are streptavidin magnetic beads; Secondary amplification system: The secondary amplification system includes ExoIII exonuclease and a fluorescent reporter probe of the sequence to be detected; The front primer has a base length of 18 to 24, a G / C content of 40 to 60%, and a melting temperature of 50 to 60°C; The purification primer is located upstream of the rear-end amplification primer and is connected head-to-tail with the rear-end amplification primer without any interval. The 5' end sequence of the purification primer is modified with a phosphate group, and the 3' end sequence is modified with biotin and is complementary to the sequence template to be tested. The purification primer has a base length of 18 to 24, including a G / C content of 40 to 60%, and a melting temperature of 50 to 60°C. The rear end amplification primer has a complementary pairing segment and a non-complementary pairing segment; the complementary pairing segment is complementary to the detection site of the sequence to be tested, has a base length of 18 to 24, includes a G / C content of 40 to 60%, and a melting temperature of 50 to 60° C.; the non-complementary pairing segment has no GC sequence and is 18 to 27 bases in length; The fluorescent reporter probe is complementary to the rear end amplification primer and has a length of 18 nt; the 3' end is a fluorescent group, and the quenching group is located after an interval of three or four bases.

2. The use of the nucleic acid probe for isothermal recognition of double-stranded DNA according to claim 1, characterized in that: The steps include: 1) Design front-end primers, purification primers, back-end amplification primers and fluorescent reporter probes according to the gene to be tested; 2) The gene to be tested is prepared into a test solution, and the test solution, the front primer of the test sequence, the purification primer of the test sequence, the back-end amplification primer of the test sequence, T4 DNA ligase, MgOAC, buffer and RPA dry powder are mixed evenly to perform an amplification reaction; 3) After the amplification reaction is completed, the reaction product is mixed with streptavidin magnetic beads for incubation, and after the incubation is completed, the magnetic beads are washed with incubation buffer for purification; 4) Take out the streptavidin magnetic beads, add ExoIII exonuclease and fluorescent reporter probe directly to the streptavidin magnetic beads for secondary amplification reaction, and place under a microplate reader to obtain fluorescence readings.

3. The use of the nucleic acid probe for isothermal recognition of double-stranded DNA according to claim 2, characterized in that: The concentration of the solution to be tested is 1aM-10nM.

4. The use of the nucleic acid probe for isothermal recognition of double-stranded DNA according to claim 3, characterized in that: The concentration of the solution to be tested is 100aM to 1pM.

5. The use of the nucleic acid probe for isothermal recognition of double-stranded DNA according to claim 2, characterized in that: The concentration ratio of the test solution, the front primer, the purification primer and the back-end amplification primer is 1-2:1-2:1-2:1.25-2; the final concentration of T4 DNA ligase is 10-20U.

6. The use of the nucleic acid probe for isothermal recognition of double-stranded DNA according to claim 2, characterized in that: The streptavidin magnetic beads have a diameter of 1 to 10 μm and are modified with streptavidin.

7. The use of the nucleic acid probe for isothermal recognition of double-stranded DNA according to claim 2, characterized in that: The incubation buffer includes 1xPBST incubation buffer and 1xPBS incubation buffer; the 1xPBST incubation buffer includes 137mMNaCl, 2.7mM KCl, 4.3mM Na2HPO4, 1.47mM KH2PO4 and 0.05% v / v (volume ratio) Tween-20, and the pH is 7.4; the 1xPBS incubation buffer includes 137mM NaCl, 2.7mM KCl, 4.3mM Na2HPO4 and 1.47mM KH2PO4, and the pH is 7.

4.

8. The use of the nucleic acid probe for isothermal recognition of double-stranded DNA according to claim 2, characterized in that: The final concentration of the ExoIII exonuclease is 10-20 U; the final concentration of the fluorescent reporter probe is 400-600 nM.

9. The use of the nucleic acid probe for isothermal recognition of double-stranded DNA according to claim 2, characterized in that: The reaction temperature of the amplification reaction is 35-38° C., and the reaction time is 30-60 min; the reaction temperature of the secondary amplification reaction is 36-39° C., and the reaction time is 20-40 min.

10. The use of the nucleic acid probe for isothermal recognition of double-stranded DNA according to claim 2, characterized in that: Fluorescence readings are performed based on the excitation and emission wavelengths of the fluorescent groups in the fluorescent reporter probes to identify the sequence to be detected.

Images