Method for identifying the number of spikelets per ear in wheat based on the A2173T SNP locus in the TaHDA9-D gene
By detecting the A2173T SNP site of the wheat TaHDA9-D gene and combining PCR amplification and enzyme cutting technology, the number of spikelets per ear of wheat can be accurately screened or assisted in screening, which solves the problem of low screening efficiency in existing technologies and improves the effect of wheat breeding.
Patent Information
- Application Number
- CN202111184362.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-10-11
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2041-10-11
AI Technical Summary
Existing technologies make it difficult to effectively use SNP sites to screen or assist in screening the number of spikelets per ear of wheat, resulting in poor repeatability of QTLs between different years and environments, making it difficult to apply them to wheat genetic improvement.
By detecting the A2173T SNP site of the wheat TaHDA9-D gene and combining PCR amplification with restriction endonuclease BglII digestion, the wheat genotype can be determined to be AA homozygous (genotype I) or TT homozygous (genotype II), thereby screening or assisting in the screening of wheat with different spikelet numbers per ear.
Accurate screening or assisted screening based on the TaHDA9-D genotype was achieved, which improved the screening efficiency of the number of spikelets per ear of wheat and has important breeding application value.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and in particular relates to a method for identifying the number of spikelets per spike of wheat based on the A2173T SNP site in the TaHDA9-D gene. The A2173T SNP site is the 2173rd nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome. Background Art
[0002] Wheat (Triticum aestivum L.) is one of my country's most important grain crops. Increasing wheat yield per unit area is a key approach to meeting the ever-increasing demand for food. Grain number per spikelet is one of the three major components of wheat yield per plant, and spikelet number per spikelet is a key factor influencing grain number per spikelet. Therefore, identifying superior allelic variants regulating spikelet number per spikelet and developing functional markers have important applications in improving wheat grain number per spikelet and breeding for high-yield wheat varieties.
[0003] At present, researchers have located a large number of QTLs regulating the number of spikelets per panicle: Sourdille et al. detected QTLs for the number of spikelets per panicle on 2AS, 5AL and 2BS of hexaploid wheat; Kato et al. detected four QTLs for the number of spikelets per panicle on chromosome 5A, of which the QTL with the largest effect was in the vernalization gene Vrn-A1 region; Liu et al. detected QTLs for the number of spikelets per panicle on 1D, 2D, 3D, 5A, 5B and 5D using near-isogenic lines; Li et al. detected a QTL with a contribution rate of 0.05 on chromosome 5D using the "Chuang35050×Shangnong483" RIL population. Up to 51.79% of QTLs controlling the number of spikelets per panicle are major. Wu Bingjin et al. used a recombinant inbred line population constructed from Zhou 8425B / Xiaoyan 81 and combined it with a 90K microarray to establish a high-density genetic map and conduct linkage analysis, resulting in the mapping of a total of 12 QTLs controlling the number of spikelets per panicle. Manickavelu used a recombinant inbred line population to detect three, two, and one QTL controlling the number of spikelets per panicle on chromosomes 2A, 2B, and 4D, respectively. Li et al. used a biparental population (F6) constructed from the Chinese landrace Banmangzi and Jimai 22 to identify five QTLs controlling the number of spikelets per panicle. Although a large number of QTLs associated with the number of spikelets per panicle in wheat have been mapped, the vast majority of these QTLs have low phenotypic contributions and poor reproducibility across years and environments, making them difficult to apply to genetic improvement of the number of spikelets per panicle in wheat.
[0004] CAPS markers, also known as PCR-RFLP (polymerase chain reaction restriction fragment length polymorphism), are a type of PCR-based co-dominant molecular marker that reveals information about restriction fragment length variation in specific PCR fragments. The basic principle is to amplify the target DNA using PCR, then digest the amplified product with specific endonucleases to cut it into fragments of varying sizes, which are then resolved directly on gel electrophoresis. Different alleles have different distributions of restriction enzyme sites, resulting in DNA fragment bands of varying lengths. The advantage is that it avoids the cumbersome transfer and hybridization steps of RFLP analysis while maintaining the accuracy of RFLP analysis. However, SNPs rarely occur at restriction enzyme sites. Therefore, the dCAPS marker was proposed. This marker, based on the CAPS marker, introduces mismatched bases into the amplification primers, combining them with the SNP site to introduce new restriction enzyme sites, resulting in polymorphisms similar to the CAPS marker. Summary of the Invention
[0005] The purpose of the present invention is to screen or assist in screening wheat with different numbers of spikelets per ear.
[0006] The present invention firstly protects a method for screening or assisting in screening wheat with different numbers of spikelets per ear.
[0007] The method for screening or assisting in screening wheat with different numbers of spikelets per ear protected by the present invention may specifically be method 1, which may include the following steps: detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-D gene, and the number of spikelets per ear of genotype I wheat is greater than the number of spikelets per ear of genotype II wheat;
[0008] The wheat of genotype I is a wheat having a genotype of AA homozygous based on the A2173T SNP site;
[0009] The wheat of genotype II is a wheat having a genotype of TT homozygous based on the A2173T SNP site;
[0010] The A2173T SNP site is the 2173rd nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome.
[0011] The method for screening or assisting in screening wheat with different numbers of spikelets per ear protected by the present invention may specifically be method 2, which may include the following steps in sequence:
[0012] (A1) using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1;
[0013] (A2) using the PCR amplification product P1 as a template, performing PCR amplification with primer pair B consisting of primer F2 and primer R2 to obtain a PCR amplification product P2;
[0014] (A3) digesting the PCR amplification product P2 with restriction endonuclease BglII to obtain digestion products; and then performing the following evaluation: if the digestion product is a single DNA fragment, the genotype of the wheat to be tested based on the TaHDA9-D gene is genotype I; if the digestion product is two DNA fragments, the genotype of the wheat to be tested based on the TaHDA9-D gene is genotype II;
[0015] The number of spikelets per ear of wheat of genotype I was greater than that of wheat of genotype II;
[0016] The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4;
[0017] The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5;
[0018] The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6;
[0019] The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:7.
[0020] The method for screening or assisting in screening wheat with different numbers of spikelets per ear protected by the present invention may specifically be method three, which may include the following steps in sequence:
[0021] (B1) using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1;
[0022] (B2) using the PCR amplification product P1 as a template, performing PCR amplification on primer pair B consisting of primer F2 and primer R2 to obtain a PCR amplification product P2;
[0023] (B3) digesting the PCR amplification product P2 with restriction endonuclease BglII to obtain a digestion product; then performing the following evaluation: if the digestion product contains only a 100 bp DNA fragment, the genotype of the wheat to be tested based on the TaHDA9-D gene is genotype I; if the digestion product contains only a 79 bp DNA fragment and a 21 bp DNA fragment, the genotype of the wheat to be tested based on the TaHDA9-D gene is genotype II;
[0024] The number of spikelets per ear of wheat of genotype I was greater than that of wheat of genotype II;
[0025] The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4;
[0026] The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5;
[0027] The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6;
[0028] The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:7.
[0029] The method for screening or assisting in screening wheat with different numbers of spikelets per ear protected by the present invention may specifically be method 4, which may include the following steps in sequence:
[0030] (C1) using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain a PCR amplification product P1;
[0031] The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4;
[0032] The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5;
[0033] (C2) Sequencing the PCR amplification product P1 and then performing the following evaluation:
[0034] If the nucleotide sequence of the PCR amplification product P1 is as shown in SEQ ID NO: 2, positions 1777 to 2577 from the 5' end, the genotype of the wheat to be tested based on the TaHDA9-D gene is genotype I;
[0035] If the nucleotide sequence of the PCR amplification product P1 is as shown in SEQ ID NO: 3, positions 1777 to 2577 from the 5' end, the genotype of the wheat to be tested based on the TaHDA9-D gene is genotype II;
[0036] The number of spikelets per ear of wheat of genotype I is greater than that of wheat of genotype II.
[0037] The present invention also protects a kit for identifying or assisting in identifying the number of spikelets per ear of wheat. The kit may include a substance for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-D gene;
[0038] The genotype I is the TaHDA9-D gene with the genotype of AA homozygous based on the A2173T SNP site;
[0039] The genotype II is a TaHDA9-D gene with a TT homozygous genotype based on the A2173T SNP site;
[0040] The A2173T SNP site is the 2173rd nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome.
[0041] The kit may specifically be composed of substances for detecting whether the genotype of the wheat to be tested based on the TaHDA9-D gene is genotype I or genotype II.
[0042] Any of the above-mentioned substances for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-D gene may include a primer pair A consisting of primer F1 and primer R1 and / or a primer pair B consisting of primer F2 and primer R2;
[0043] The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4;
[0044] The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5;
[0045] The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6;
[0046] The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:7.
[0047] Any of the above-mentioned materials for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-D gene can specifically be composed of the primer pair A and the primer pair B.
[0048] Any of the above-mentioned materials for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-D gene can specifically be composed of the primer pair A.
[0049] Any of the above-mentioned substances for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-D gene may further include a restriction endonuclease BglII.
[0050] Any of the above-mentioned materials for detecting whether the genotype of the wheat to be tested is genotype I or genotype II based on the TaHDA9-D gene can specifically be composed of the primer pair A, the primer pair B and the restriction endonuclease BglII.
[0051] The present invention also protects the use of any of the above-mentioned kits, which may be at least one of (z1) to (z4):
[0052] (z1) screening or assisting in screening wheat with different numbers of spikelets per ear;
[0053] (z2) Identify or assist in identifying the number of spikelets per ear of wheat;
[0054] (z3) identifying or assisting in identifying the genotype of the wheat TaHDA9-D gene;
[0055] (z4) Wheat breeding.
[0056] The present invention also protects the molecular marker shown in SEQ ID NO: 1.
[0057] The present invention also protects the use of the molecular marker represented by SEQ ID NO: 1, which can be at least one of (z1) to (z4):
[0058] (z1) screening or assisting in screening wheat with different numbers of spikelets per ear;
[0059] (z2) Identify or assist in identifying the number of spikelets per ear of wheat;
[0060] (z3) identifying or assisting in identifying the genotype of the wheat TaHDA9-D gene;
[0061] (z4) Wheat breeding.
[0062] In the above text, when the genotype at the A2173T site in the molecular marker is homozygous for AA, the wheat is identified as genotype I; when the genotype at the A2173T site in the molecular marker is homozygous for TT, the wheat is identified as genotype II. The A2173T SNP site is the 2173rd nucleotide from the 5' end of SEQ ID NO:1 in the wheat genome. The number of spikelets per ear in wheat of genotype I is greater than the number of spikelets per ear in wheat of genotype II.
[0063] In the above, the > may specifically be a statistical >.
[0064] Experiments have shown that the method provided by the present invention can be used to detect the genotype of the wheat to be tested based on the TaHDA9-D gene, and can screen or assist in screening the number of spikelets per ear of wheat. The present invention has important application value in the process of molecular marker-assisted breeding of wheat. BRIEF DESCRIPTION OF THE DRAWINGS
[0065] Figure 1 These are the genotype detection results of the TaHDA9-D gene in some wheat varieties in natural populations. DETAILED DESCRIPTION
[0066] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0067] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0068] The wheat materials used in the following examples were all from the National Crop Germplasm Bank (website: http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm). Material information can be found on the China Crop Germplasm Information Network (website: http: / / icgr.caas.net.cn). Since the wheat materials are all cultivated varieties, they are usually assumed to be highly homozygous plant materials with homozygous genotypes.
[0069] Example 1. Discovery of the A2173T SNP in the wheat TaHDA9-D gene and establishment of a wheat genotyping method based on the TaHDA9-D gene
[0070] 1. Discovery of the A2173T SNP in the TaHDA9-D gene in wheat
[0071] After extensive experiments, the inventors discovered a single nucleotide polymorphism (SNP) in the wheat TaHDA9-D gene (nucleotide sequence shown in SEQ ID NO:1), designated A2173T SNP. The A2173T SNP is located at position 2173 from the 5' end of SEQ ID NO:1, and the genotypes are AA homozygous and TT homozygous. Because genomic DNA is a double-stranded DNA molecule composed of two reverse-complementary single-stranded DNA molecules, protein-encoding DNA molecules are generally designated as sense DNA molecules, while the reverse-complementary DNA molecules of sense DNA molecules are designated as antisense DNA molecules. The genotypes associated with the A2173T SNP are all sense DNA genotypes. The nucleotide sequence shown in SEQ ID NO:1 is a reference sequence downloaded from http: / / plants.ensembl.org / index.html, with the Gene ID TraesCS2D02G291000.
[0072] Wheat is divided into two genotypes based on the differences in the TaHDA9-D gene: TaHDA9-DA (hereinafter referred to as genotype I) and TaHDA9-DT (hereinafter referred to as genotype II). The nucleotide sequence of the TaHDA9-D gene in genotype I wheat is shown in SEQ ID NO:2. The nucleotide sequence of the TaHDA9-D gene in genotype II wheat is shown in SEQ ID NO:3.
[0073] 2. Synthesis of Primer Pair A and Primer Pair B for Amplification of Target Sequences Including the A2173T SNP
[0074] Primer pair A and primer pair B were designed and synthesized for amplifying a target sequence including the A2173T SNP. Primer pair A consisted of primer F1 and primer R1. Primer pair B consisted of primer F2 and primer R2.
[0075] The nucleotide sequences of each primer are as follows:
[0076] Primer F1: 5′-GCTTCTTTCTGTTTTGTGATCTCTCTAAGC-3′ (SEQ ID NO: 4)
[0077] Primer R1: 5′-CCCATTGTAACTCAGTTTTGTAAATGTCTC-3′ (SEQ ID NO: 5)
[0078] Primer F2: 5′-CCATATATTCAGTTTAGTTGAGATC-3′ (SEQ ID NO: 6)
[0079] Primer R2: 5′-TAAAGGCTCTCGAAGAGACAGCGAC-3′ (SEQ ID NO: 7)
[0080] The target sequence amplified by primer pair A is shown in SEQ ID NO: 1 at positions 1777 to 2577 from the 5' end.
[0081] 3. Establishment of a wheat genotyping method based on the TaHDA9-D gene
[0082] 1. Extract the genomic DNA of the wheat to be tested.
[0083] 2. Using the genomic DNA of the wheat to be tested in step 1 as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1.
[0084] The reaction system was 10 μL, consisting of 3.6 μL ddH2O, 5 μL 2×Taq enzyme Mix, 0.2 μL primer F1 aqueous solution (concentration of 10 μmol / L), 0.2 μL primer R1 aqueous solution (concentration of 10 μmol / L) and 1 μL genomic DNA of the wheat to be tested (concentration of 20 ng / μL).
[0085] 2×Taq enzyme Mix was a product of Nanjing Novozymes Co., Ltd., with the product catalog number being P131.
[0086] The reaction conditions were as follows: 95°C for 3 min; 95°C for 15 s, 61°C for 15 s, 72°C for 15 s, 32 cycles; 72°C for 10 min; and storage at 16°C.
[0087] 3. After completing step 2, PCR amplification is performed using a dilution of PCR amplification product P1 (a mixture of 1 part by volume of PCR amplification product P1 and 9 parts by volume of water) as a template and primer pair B consisting of primers F2 and R2 to obtain PCR amplification product P2.
[0088] The reaction system was 10 μL, consisting of 3.6 μL ddH2O, 5 μL 2×Taq enzyme Mix, 0.2 μL primer F2 aqueous solution (concentration of 10 μmol / L), 0.2 μL primer R2 aqueous solution (concentration of 10 μmol / L) and 1 μL dilution of PCR amplification product P1.
[0089] The reaction conditions were as follows: 95°C for 3 min; 95°C for 15 s, 61°C for 15 s, 72°C for 10 s, 32 cycles; 72°C for 10 min; and storage at 16°C.
[0090] 4. The PCR amplification product P2 obtained in step 3 was digested with restriction endonuclease BglII to obtain a digestion product; the digestion product was subjected to 4% agarose gel electrophoresis and the following judgment was made: if the digestion product was band type A (displaying one band of 100 bp), the wheat A2173T SNP to be tested was AA homozygous, that is, the genotype of the wheat to be tested based on the TaHDA9-D gene was genotype I; if the digestion product was band type B (displaying two bands of 79 bp and 21 bp, respectively), the wheat A2173T SNP to be tested was TT homozygous, that is, the genotype of the wheat to be tested based on the TaHDA9-D gene was genotype II.
[0091] Example 2: Association analysis and verification between the genotype of the wheat TaHDA9-D gene and the number of spikelets per ear
[0092] 1. Genotyping of individual wheat TaHDA9-D genes in natural populations
[0093] Genotyping of each wheat variety in a natural population was performed using the method of step 3 in Example 1. The natural population consisted of 296 wheat varieties (all hexaploid). The wheat variety names are detailed in Table 1.
[0094] Some test results can be found in Figure 1 (M is a DNA marker, and the other lanes represent different wheat varieties; T is a wheat variety of genotype II, and A is a wheat variety of genotype I).
[0095] The genotypes of 296 wheat varieties based on the TaHDA9-D gene are shown in Table 1: the genotypes of 208 wheat varieties based on the TaHDA9-D gene are genotype II, and the genotypes of 88 wheat varieties based on the TaHDA9-D gene are genotype I.
[0096] Table 1
[0097]
[0098]
[0099]
[0100]
[0101] Note: I is genotype I, II is genotype II.
[0102] 2. Detection of the number of spikelets per ear
[0103] 296 wheat varieties were planted in nine environments, and the average number of spikelets per ear of two genotypes of wheat under different planting conditions was counted.
[0104] The statistical results are shown in Table 2.
[0105] Table 2
[0106]
[0107] Note: P value is the significance level of the association analysis. * " indicates P < 0.05," ** ” indicates P < 0.01.
[0108] 3. Correlation Analysis
[0109] Tassel2.1 software was used to select the single linear model + population structure (GLM + Q) method to conduct an association analysis between the genotype of the wheat TaHDA9-D gene and the number of spikelets per ear in the natural population. The results are shown in Table 2.
[0110] The results showed that, in a natural population of 296 wheat varieties, the number of spikelets per ear for genotype I wheat was greater than that for genotype II wheat; the ">" represents a statistically significant difference. Studies of natural populations have shown that genotype I is an excellent genotype for increasing the number of spikelets per ear in wheat.
[0111] The above results indicate that the genotype of the wheat to be tested based on the TaHDA9-D gene can be used to screen or assist in screening the number of spikelets per ear of wheat, which has important application value in the process of wheat molecular marker-assisted breeding.
[0112] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims. <110> Hebei Normal University <120> Method for identifying the number of spikelets per ear in wheat based on the A2173T SNP locus in the TaHDA9-D gene <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 5861 <212> DNA <213> Triticum aestivum L. <220> <221> <222> (2173)…(2173) <223> k is a or t <400> 1 gatcctgactgtccatgccggtccagaacgttccccagagccatcgcctcgctcggtttt 60 ccccttcctcctcacgcacgaccgccccaactttcgccgccgcctccgccgtcgcgaact 120 cgctgtcggcttccccggccgcctccattcggcgccgcctccgcctgtagaggcaggcgg 180 ccgctcgagagcgaggtcatgttggagaaagacaggatatcctatttctacgatggtatg 240 ttccctatgccccctcttctccactgcacccccccaaatcccccaaccaaccaccgttcat 300 acctagttctctcctagtcgcaagtcgctacccttacctctcctagctgtctcatctcgc 360 aatttcgatagtagggggaaatactgtgtgggtatagtggtgtgttgtgcttgtttcgcc 420 gatttgtagtagcaaggcgtcagcatgggtcattgcggtcgaagcctgtgctatggctat 480 acgacgaaggaaaatttcttgatgctatgtgccatcgggatctgttcaactagaattggt 540 gtgaccctgttatttggcctactatttccttgagttgttcaacctagcagtcagtgcgtt 600 gtaaaattgcgttagtgtatgcttcattctaggtcagataaggaagtcaaatggtaaaaa 660 ttgctgcgctgtttatttgatttggttctcatgactagttccttaactgtgttgtttgta 720 gaaaatccacacaccttcaacactatataagttttttcgctgttcaaccttttatggttg 780 cttacttggttacttttctgtgaccgaacatctcaggggatgttggcaatgtgtactttg 840 ggccaaatcatccgatgaaaccgcatcgcctttgcatgacacatcatctcgtgttatcat 900 atgatcttcacaagaaaatggagatatatgtcggtattgaattatgttcatcccctttct 960 ttgtacttatgaattgtttaaatgtgtcttttaccttattttgctcccattggattttgc 1020 agagaccccacaaagcatatccaacagagcttgcgcagttccattctgctgattatgtgg 1080 aattcttgcaccgaataactcctgatacccagcacttgtatgcaagtgaattaactagat 1140 gtatgattatgacatctttttcttttacaaagtactctcacaggctttgctattttcaca 1200 ataaaatacatgccgcatgtattactttcttatatttagctgtaaaaatcatgtcaaaac 1260 ttggttagaacatgtgtatgacgagtggaccatgtgcctaagaatttgtggctcgccaca 1320 gttgtttatatgaaccaaacgccagcagcatttgttcaaacttgcgtaacttcagagtga 1380 caccgaaccaaaaactccgaaaatgatttacctgaatcttaggtagtgctatattatctt 1440 aggtcttcggatgtatatacttaaaatagaagcggaacacattaagatggtctgatctct 1500 caacaaattgttgtatgcaaatggaagcttagctgtttgtacttaaataaagaactgtct 1560 gctatactttccacaatatgcctgtcgcactaaatggaattgctataaatcatgtctcca 1620 tgtattttgggttttcttatatttaacttatctgacttcttcattgtattcattgtccca 1680 gacaaccttggagaggactgcccagtctttgatgattgtttgagttctgccaaatctat 1740 gctggaggaactctaggtaataggaaaaattgccaatgcttctttctgttttgtgatctct 1800 ctaagctttttttttttgttcagatgcggctcgaagactaaatcataaaacatgtgat 1860 attgctattaattgggctggtgggctgcatcatgcaaagaagtgtgaggcgtcaggcttc 1920 tgctacattaatgacctagttttgggaattctcgagcttctcaagtatcatgctagggtt 1980 ctctatattgacattgatgtccatcatggagatggagttgaagaagccttctatttcact 2040 gacaggttcatgcttttgtggataataatacatgactgtaattgtcgataggatgtgt 2100 ctcactgatcttcagagcctccatagacgcctattcttttgttgtcaccatatattcagt 2160 ttagttgctatckcaggcttccgtcttctaagatgggtagtgtgaggttgatgtatagta 2220 atgtcgctgtctcttcgagagcctttagatttccatctgattttgtctctatacatatttgt 2280 agggtaatgactgtaagtttccacaagtatggtgacatgttctttcctggcacaggtgat 2340 attaaggtaatgtccactgacaagctttatgaatatacattttatgtagttcctttactt 2400 aattttcgcagtagttcatcgctattattttcagttgtatcttagtttgtgctcaatatt 2460 gggcatgagttgtatgatgtttgttgtctcctatttgcttatgtcaattaaagttggaat 2520 gtgaactctcaattatatgaaacagaagagacatttacaaaactgagttacaatgggttt 2580 tggcattacattactcaaagttgatggtactggagttaatcaatagttctaggaaccatt 2640 gcgacatccttcagtttcttctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2700 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2760 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2820 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2880 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2940 nnnnnnnnnnnnnnncatgtaaatatgcaacttttatcattgaactcttgtctccattac 3000 tggcccggtattctatccaaatagccagcatcatatttgggaatagtggaggtttatgat 3060 ctatatttgataaagggtggtgctaaaagtgatgttcttcattctgatgcatgtattatc 3120 atctgagctgacaagaatagaagctgtcaactgaccaacacaactcttgcggtcatgctt 3180 gaatcatcacttgaagattcacttcatcgtttttgtaatgggtttacttttgccgataat 3240 gctattttggcacgtgttttatgcatgtgtctgcatgagtggaagttttttttttatgca 3300 attgtctttgattgagctgcgagttctccaatcaaaaccatcccgtcaactagattttgt 3360 aactcacatactagaggaaaggcaaggttcgatatgagcagaaatgtgtgcctttctgtt 3420 tattaacatgttgaaaaaaattggcacttacagagcttgcattgtgctttgcttttaaat 3480 agttgaatgtcacgtgctgttaagtaatgatgatgagggcttttaaaaatttagcttcat 3540 ttaagacggatgtgctcttcatattggtttacctggctgtcattttgaaggatataggag 3600 acagggaaggaaaatattatgccatcaacatcccacttaaagatggcatagacgacacca 3660 gctttactcggctttttaaaacggtaaaagtcaatgtgcattactttatgtttattcatg 3720 ttcttgttctctagtcttattgaggtatgtaatgctgcttatcatgtagattattgccaa 3780 agttgttgagacatatctgccaggtgctattgttcttcaatgtggggctgattcattggc 3840 gcgagaccgcctagggtgtttcaatctttcaattgaaggtgctgtctaaaacttgatatt 3900 aagtgccactatagatttggccaaacatccagatgtgtaaactaaccgtgtttaaccttg 3960 tctccactgttgaaattgtgtattcttggaattttcttgcgttgatggtatttggggtcc 4020 tttggactttaagtttcattgagctaaactcacttgagtaatctattattatacttactt 4080 gatctgtttccataaacaggccatgctgaatgtgtaaagtttgttaagaaatttaaaatt 4140 cctctgctggtaagggagaaaactgtcatcgtatgataaattttgctcgttctaggatat 4200 tcacgtattttcaaacatgcaggtgacaggaggtggtgggtacaccaaagagaatgtagc 4260 acgctgctgggctgttgaaactggggttcttctagacacagagctcccaaatggtatctc 4320 atttgtttgttctgctcccctcaaccttcttggtttgagtgacagtaactactccctccg 4380 tcccaaaatataagaatgtttttgacactatgatagtataaaaaacgttcttatattttg 4440 ggacagagggagtagtaatctttcaatatagcaacgtttttcttgtattatttcttcttg 4500 ttttcttgatcttttaaggtgaaaagtgaaaataaatccaactatgtcctaatactcttc 4560 ctttatagtactaccttttgtaagcaattctttcttagtggttatccatcggcgggagtt 4620 ttacatggcattttctttgcagagatccctgacaatgaatacattgagtacttcggtcca 4680 gattatacattgaaagtaccgaatctgaacatggtatgaaccttttctgattgaactatc 4740 taattctatgcctgcctggtgttatggaaaacatttaactgctgtttggtgcatcatgctt 4800 tttatatattggctaccacctagaacatccttttgtttctttagagatgtgtagatgtgc 4860 taatgatatttgtcttcctattgatgaatggaccaggacaacttgaatagtaagacgtat 4920 ctcagttcaatcaaagtgcaagtaatggagagtttgcgggccatacaacatgcacctggc 4980 gttcagatgcaagaggttagtttgtattccattcgcatgttgattgttgaaacatcccaa 5040 ttgaaaccggggatggataccatgtgaagactggaatatgcctttacatcttttgtgtct 5100 ttatttttcttgcttccgccaggatagtgtagtttgttgtttctgagcagagatcggata 5160 cacaatgagtttattttgcaggttccacccgatttctatgtcccggattttgatgaagac 5220 gagctggatcctgatgaacgtgttgatcgtaagtgaaataaatacctctggcatgtctta 5280 cagtgctcgtatggacgagtaaaaacttgatgatttctccgtgcaaactcgccattgtcc 5340 tctcgaagcatatgcgcgccacataatgagaaatttgccctgaaatgaaataaatgtgat 5400 ccattttgttatctatttattcttaaattggttgtattcttcttcattcagccagttcct 5460 tgcttggtattttctccagtccttttgaactgggtcatcatttttttttcttacagaagt 5520 gtgtatgtcatgcagagcatacccaagacaagcaggttcatcgtgacgacgagtactatg 5580 aaggcgacaacgacaatgatcacgatgacggcggacattgagatcggcatcttggcgatg 5640 tatgtaggtggaagctcaaagtctttcccgcagcagctgctttttcagtttaacatcgtg 5700 ggatgggaaatacatagttggctgattgacattttaggatctgacgctagggctggaaag 5760 cattgtgggagaatgtaacacttgccgacttgtacatcattgtacgatttcacattcgta 5820 cttaaaatacaatcttttcagtacgtacgtgcttttttat t 5861 <210> 2 <211> 5861 <212> DNA <213> Triticumaestivum L. <400> 2 gatcctgactgtccatgccggtccagaacgttccccagagccatcgcctcgctcggtttt 60 ccccttcctcctcacgcacgaccgccccaactttcgccgccgcctccgccgtcgcgaact 120 cgctgtcggcttccccggccgcctccattcggcgccgcctccgcctgtagaggcaggcgg 180 ccgctcgagagcgaggtcatgttggagaaagacaggatatcctatttctacgatggtatg 240 ttccctatgccccctcttctccactgcaccccccaaatcccccaaccaaccaccgttcat 300 acctagttctctcctagtcgcaagtcgctacccttacctctcctagctgtctcatctcgc 360 aatttcgatagtagggggaaatactgtgtgggtatagtggtgtgttgtgcttgtttcgcc 420 gatttgtagtagcaaggcgtcagcatgggtcattgcggtcgaagcctgtgctatggctat 480 acgacgaaggaaaatttcttgatgctatgtgccatcgggatctgttcaactagaattggt 540 gtgaccctgttatttggcctactatttccttgagttgttcaacctagcagtcagtgcgtt 600 gtaaattgcgttagtgtatgcttcattctaggtcagataaggaagtcaaatggtaaaaa 660 ttgctgcgctgtttatttgatttggttctcatgactagttccttaactgtgttgtttgta 720 gaaaatccacacaccttcaacactatataagttttttcgctgttcaaccttttatggttg 780 cttacttggttacttttctgtgaccgaacatctcaggggatgttggcaatgtgtactttg 840 ggccaaatcatccgatgaaaccgcatcgcctttgcatgacacatcatctcgtgttatcat 900 atgatcttcacaagaaaatggagatatatgtcggtattgaattatgttcatcccctttct 960 ttgtacttatgaattgtttaaatgtgtcttttaccttattttgctcccattggattttgc 1020 agagaccccacaaagcatatccaacagagcttgcgcagttccattctgctgattatgtgg 1080 aattcttgcaccgaataactcctgatacccagcacttgtatgcaagtgaattaactagat 1140 gtatgattatgacatctttttcttttacaaagtactctcacaggctttgctattttcaca 1200 ataaaatacatgccgcatgtattactttcttatatttagctgtaaaaatcatgtcaaaac 1260 ttggttagaacatgtgtatgacgagtggaccatgtgcctaagaatttgtggctcgccaca 1320 gttgtttatatgaaccaaacgccagcagcatttgttcaaacttgcgtaacttcagagtga 1380 caccgaaccaaaaactccgaaaatgatttacctgaatcttaggtagtgctatattatctt 1440 aggtcttcggatgtatatacttaaaatagaagcggaacacattaagatggtctgatctct 1500 caacaaattgttgtatgcaaatggaagcttagctgtttgtacttaaataaagaactgtct 1560 gctatactttccacaatatgcctgtcgcactaaatggaattgctataaatcatgtctcca 1620 tgtattttgggttttcttatatttaacttatctgacttcttcattgtattcattgtccca 1680 gacaaccttggagaggactgcccagtctttgatgattgtttgagttctgccaaatctat 1740 gctggaggaactctaggtaataggaaaaattgccaatgcttctttctgttttgtgatctct 1800 ctaagctttttttttttgttcagatgcggctcgaagactaaatcataaaacatgtgat 1860 attgctattaattgggctggtgggctgcatcatgcaaagaagtgtgaggcgtcaggcttc 1920 tgctacattaatgacctagttttgggaattctcgagcttctcaagtatcatgctagggtt 1980 ctctatattgacattgatgtccatcatggagatggagttgaagaagccttctatttcact 2040 gacaggttcatgcttttgtggataataatacatgactgtaattgtcgataggatgtgt 2100 ctcactgatcttcagagcctccatagacgcctattcttttgttgtcaccatatattcagt 2160 ttagttgctatcacaggcttccgtcttctaagatgggtagtgtgaggttgatgtatagta 2220 atgtcgctgtctcttcgagagcctttagatttccatctgattttgtctctatacatatttgt 2280 agggtaatgactgtaagtttccacaagtatggtgacatgttctttcctggcacaggtgat 2340 attaaggtaatgtccactgacaagctttatgaatatacattttatgtagttcctttactt 2400 aattttcgcagtagttcatcgctattattttcagttgtatcttagtttgtgctcaatatt 2460 gggcatgagttgtatgatgtttgttgtctcctatttgcttatgtcaattaaagttggaat 2520 gtgaactctcaattatatgaaacagaagagacatttacaaaactgagttacaatgggttt 2580 tggcattacattactcaaagttgatggtactggagttaaatcaatagttctaggaaccatt 2640 gcgacatccttcagtttcttctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2700 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2760 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2820 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2880 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2940 nnnnnnnnnnnnnnncatgtaaatatgcaacttttatcattgaactcttgtctccattac 3000 tggcccggtattctatccaaatagccagcatcatatttgggaatagtggaggtttatgat 3060 ctatatttgataaagggtggtgctaaaagtgatgttcttcattctgatgcatgtattatc 3120 atctgagctgacaagaatagaagctgtcaactgaccaacacaactcttgcggtcatgctt 3180 gaatcatcacttgaagattcacttcatcgtttttgtaatgggtttacttttgccgataat 3240 gctattttggcacgtgttttatgcatgtgtctgcatgagtggaagttttttttttatgca 3300 attgtctttgattgagctgcgagttctccaatcaaaaccatcccgtcaactagattttgt 3360 aactcacatactagaggaaaggcaaggttcgatatgagcagaaatgtgtgcctttctgtt 3420 tattaacatgttgaaaaaaattggcacttacagagcttgcattgtgctttgcttttaaat 3480 agttgaatgtcacgtgctgttaagtaatgatgatgagggcttttaaaaatttagcttcat 3540 ttaagacggatgtgctcttcatattggtttacctggctgtcattttgaaggatataggag 3600 acagggaaggaaaatattatgccatcaacatcccacttaaagatggcatagacgacacca 3660 gctttactcggctttttaaaacggtaaaagtcaatgtgcattactttatgtttattcatg 3720 ttcttgttctctagtcttattgaggtatgtaatgctgcttatcatgtagattattgccaa 3780 agttgttgagacatatctgccaggtgctattgttcttcaatgtggggctgattcattggc 3840 gcgagaccgcctagggtgtttcaatctttcaattgaaggtgctgtctaaaacttgatatt 3900 aagtgccactatagatttggccaaacatccagatgtgtaaactaaccgtgtttaaccttg 3960 tctccactgttgaaattgtgtattcttggaattttcttgcgttgatggtatttggggtcc 4020 tttggactttaagtttcattgagctaaactcacttgagtaatctattattatacttactt 4080 gatctgtttccataaacaggccatgctgaatgtgtaaagtttgttaagaaatttaaaatt 4140 cctctgctggtaagggagaaaactgtcatcgtatgataaattttgctcgttctaggatat 4200 tcacgtattttcaaacatgcaggtgacaggaggtggtgggtacaccaaagagaatgtagc 4260 acgctgctgggctgttgaaactggggttcttctagacacagagctcccaaatggtatctc 4320 atttgtttgttctgctcccctcaaccttcttggtttgagtgacagtaactactccctccg 4380 tcccaaaatataagaatgtttttgacactatgatagtataaaaaacgttcttatattttg 4440 ggacagagggagtagtaatctttcaatatagcaacgtttttcttgtattatttcttcttg 4500 ttttcttgatcttttaaggtgaaaagtgaaaataaatccaactatgtcctaatactcttc 4560 ctttatagtactaccttttgtaagcaattctttcttagtggttatccatcggcgggagtt 4620 ttacatggcattttctttgcagagatccctgacaatgaatacattgagtacttcggtcca 4680 gattatacattgaaagtaccgaatctgaacatggtatgaaccttttctgattgaactatc 4740 taattctatgcctgcctggtgttatggaaaacatttaactgctgtttggtgcatcatgctt 4800 tttatatattggctaccacctagaacatccttttgtttctttagagatgtgtagatgtgc 4860 taatgatatttgtcttcctattgatgaatggaccaggacaacttgaatagtaagacgtat 4920 ctcagttcaatcaaagtgcaagtaatggagagtttgcgggccatacaacatgcacctggc 4980 gttcagatgcaagaggttagtttgtattccattcgcatgttgattgttgaaacatcccaa 5040 ttgaaaccggggatggataccatgtgaagactggaatatgcctttacatcttttgtgtct 5100 ttatttttcttgcttccgccaggatagtgtagtttgttgtttctgagcagagatcggata 5160 cacaatgagtttattttgcaggttccacccgatttctatgtcccggattttgatgaagac 5220 gagctggatcctgatgaacgtgttgatcgtaagtgaaataaatacctctggcatgtctta 5280 cagtgctcgtatggacgagtaaaaacttgatgatttctccgtgcaaactcgccattgtcc 5340 tctcgaagcatatgcgcgccacataatgagaaatttgccctgaaatgaaataaatgtgat 5400 ccattttgttatctatttattcttaaattggttgtattcttcttcattcagccagttcct 5460 tgcttggtattttctccagtccttttgaactgggtcatcatttttttttcttacagaagt 5520 gtgtatgtcatgcagagcatacccaagacaagcaggttcatcgtgacgacgagtactatg 5580 aaggcgacaacgacaatgatcacgatgacggcggacattgagatcggcatcttggcgatg 5640 tatgtaggtggaagctcaaagtctttcccgcagcagctgctttttcagtttaacatcgtg 5700 ggatgggaaatacatagttggctgattgacattttaggatctgacgctagggctggaaag 5760 cattgtgggagaatgtaacacttgccgacttgtacatcattgtacgatttcacattcgta 5820 cttaaaatacaatcttttcagtacgtacgtgcttttttat t 5861 <210> 3 <211> 5861 <212> DNA <213>Triticumaestivum L. <400> 3 gatcctgactgtccatgccggtccagaacgttccccagagccatcgcctcgctcggtttt 60 ccccttcctcctcacgcacgaccgccccaactttcgccgccgcctccgccgtcgcgaact 120 cgctgtcggcttccccggccgcctccattcggcgccgcctccgcctgtagaggcaggcgg 180 ccgctcgagagcgaggtcatgttggagaaagacaggatatcctatttctacgatggtatg 240 ttccctatgccccctcttctccactgcaccccccaaatcccccaaccaaccaccgttcat 300 acctagttctctcctagtcgcaagtcgctacccttacctctcctagctgtctcatctcgc 360 aatttcgatagtagggggaaatactgtgtgggtatagtggtgtgttgtgcttgtttcgcc 420 gatttgtagtagcaaggcgtcagcatgggtcattgcggtcgaagcctgtgctatggctat 480 acgacgaaggaaaatttcttgatgctatgtgccatcgggatctgttcaactagaattggt 540 gtgaccctgttatttggcctactatttccttgagttgttcaacctagcagtcagtgcgtt 600 gtaaaattgcgttagtgtatgcttcattctaggtcagataaggaagtcaaatggtaaaaa 660 ttgctgcgctgtttatttgatttggttctcatgactagttccttaactgtgttgtttgta 720 gaaaatccacacaccttcaacactatataagttttttcgctgttcaaccttttatggttg 780 cttacttggttacttttctgtgaccgaacatctcaggggatgttggcaatgtgtactttg 840 ggccaaatcatccgatgaaaccgcatcgcctttgcatgacacatcatctcgtgttatcat 900 atgatcttcacaagaaaatggagatatatgtcggtattgaattatgttcatcccctttct 960 ttgtacttatgaattgtttaaatgtgtcttttaccttattttgctcccattggattttgc 1020 agagaccccacaaagcatatccaacagagcttgcgcagttccattctgctgattatgtgg 1080 aattcttgcaccgaataactcctgatacccagcacttgtatgcaagtgaattaactagat 1140 gtatgattatgacatctttttcttttacaaagtactctcacaggctttgctattttcaca 1200 ataaaatacatgccgcatgtattactttcttatatttagctgtaaaaatcatgtcaaaac 1260 ttggttagaacatgtgtatgacgagtggaccatgtgcctaagaatttgtggctcgccaca 1320 gttgtttatatgaaccaaacgccagcagcatttgttcaaacttgcgtaacttcagagtga 1380 caccgaaccaaaaactccgaaaatgatttacctgaatcttaggtagtgctatattatctt 1440 aggtcttcggatgtatatacttaaaatagaagcggaacacattaagatggtctgatctct 1500 caacaaattgttgtatgcaaatggaagcttagctgtttgtacttaaataaagaactgtct 1560 gctatactttccacaatatgcctgtcgcactaaatggaattgctataaatcatgtctcca 1620 tgtattttgggttttcttatatttaacttatctgacttcttcattgtattcattgtccca 1680 gacaaccttggagaggactgcccagtctttgatgattgtttgagttctgccaaatctat 1740 gctggaggaactctaggtaataggaaaaattgccaatgcttctttctgttttgtgatctct 1800 ctaagctttttttttttgttcagatgcggctcgaagactaaatcataaaacatgtgat 1860 attgctattaattgggctggtgggctgcatcatgcaaagaagtgtgaggcgtcaggcttc 1920 tgctacattaatgacctagttttgggaattctcgagcttctcaagtatcatgctagggtt 1980 ctctatattgacattgatgtccatcatggagatggagttgaagaagccttctatttcact 2040 gacaggttcatgcttttgtggataataaaatacatgactgtaattgtcgataggatgtgt 2100 ctcactgatcttcagagcctccatagacgcctattcttttgttgtcaccatatattcagt 2160 ttagttgctatctcaggcttccgtcttctaagatgggtagtgtgaggttgatgtatagta 2220 atgtcgctgtctcttcgagagcctttagatttccatctgattttgtctatacatatttgt 2280 agggtaatgactgtaagtttccacaagtatggtgacatgttctttcctggcacaggtgat 2340 attaaggtaatgtccactgacaagctttatgaatatacattttatgtagttcctttactt 2400 aattttcgcagtagttcatcgctattattttcagttgtatcttagtttgtgctcaatatt 2460 gggcatgagttgtatgatgtttgttgtctcctatttgcttatgtcaattaaagttggaat 2520 gtgaactctcaattatatgaaacagaagagacatttacaaaactgagttacaatgggttt 2580 tggcattacattactcaaagttgatggtactggagttaatcaatagttctaggaaccatt 2640 gcgacatccttcagtttcttctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2700 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2760 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2820 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2880 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 2940 nnnnnnnnnnnnnnncatgtaaatatgcaacttttatcattgaactcttgtctccattac 3000 tggcccggtattctatccaaatagccagcatcatatttgggaatagtggaggtttatgat 3060 ctatatttgataaagggtggtgctaaaagtgatgttcttcattctgatgcatgtattatc 3120 atctgagctgacaagaatagaagctgtcaactgaccaacacaactcttgcggtcatgctt 3180 gaatcatcacttgaagattcacttcatcgtttttgtaatgggtttacttttgccgataat 3240 gctattttggcacgtgttttatgcatgtgtctgcatgagtggaagttttttttttatgca 3300 attgtctttgattgagctgcgagttctccaatcaaaaccatcccgtcaactagattttgt 3360 aactcacatactagaggaaaggcaaggttcgatatgagcagaaatgtgtgcctttctgtt 3420 tattaacatgttgaaaaaaattggcacttacagagcttgcattgtgctttgcttttaaat 3480 agttgaatgtcacgtgctgttaagtaatgatgatgagggcttttaaaaatttagcttcat 3540 ttaagacggatgtgctcttcatattggtttacctggctgtcattttgaaggatataggag 3600 acagggaaggaaaatattatgccatcaacatcccacttaaagatggcatagacgacacca 3660 gctttactcggctttttaaaacggtaaaagtcaatgtgcattactttatgtttattcatg 3720 ttcttgttctctagtcttattgaggtatgtaatgctgcttatcatgtagattattgccaa 3780 agttgttgagacatatctgccaggtgctattgttcttcaatgtggggctgattcattggc 3840 gcgagaccgcctagggtgtttcaatctttcaattgaaggtgctgtctaaaacttgatatt 3900 aagtgccactatagatttggccaaacatccagatgtgtaaactaaccgtgtttaaccttg 3960 tctccactgttgaaattgtgtattcttggaattttcttgcgttgatggtatttggggtcc 4020 tttggactttaagtttcattgagctaaactcacttgagtaatctattattatacttactt 4080 gatctgtttccataaacaggccatgctgaatgtgtaaagtttgttaagaaatttaaaatt 4140 cctctgctggtaagggagaaaactgtcatcgtatgataaattttgctcgttctaggatat 4200 tcacgtattttcaaacatgcaggtgacaggaggtggtgggtacaccaaagagaatgtagc 4260 acgctgctgggctgttgaaactggggttcttctagacacagagctcccaaatggtatctc 4320 atttgtttgttctgctcccctcaaccttcttggtttgagtgacagtaactactccctccg 4380 tcccaaaatataagaatgtttttgacactatgatagtataaaaaacgttcttatattttg 4440 ggacagagggagtagtaatctttcaatatagcaacgtttttcttgtattatttcttcttg 4500 ttttcttgatcttttaaggtgaaaagtgaaaataaatccaactatgtcctaatactcttc 4560 ctttatagtactaccttttgtaagcaattctttcttagtggttatccatcggcgggagtt 4620 ttacatggcattttctttgcagagatccctgacaatgaatacattgagtacttcggtcca 4680 gattatacattgaaagtaccgaatctgaacatggtatgaaccttttctgattgaactatc 4740 taattctatgcctgcctggtgttatggaaaacatttaactgctgtttggtgcatcatgctt 4800 tttatatattggctaccacctagaacatccttttgtttctttagagatgtgtagatgtgc 4860 taatgatatttgtcttcctattgatgaatggaccaggacaacttgaatagtaagacgtat 4920 ctcagttcaatcaaagtgcaagtaatggagagtttgcgggccatacaacatgcacctggc 4980 gttcagatgcaagaggttagtttgtattccattcgcatgttgattgttgaaacatcccaa 5040 ttgaaaccggggatggataccatgtgaagactggaatatgcctttacatcttttgtgtct 5100 ttatttttcttgcttccgccaggatagtgtagtttgttgtttctgagcagagatcggata 5160 cacaatgagtttattttgcaggttccacccgatttctatgtcccggattttgatgaagac 5220 gagctggatcctgatgaacgtgttgatcgtaagtgaaataaatacctctggcatgtctta 5280 cagtgctcgtatggacgagtaaaaacttgatgatttctccgtgcaaactcgccattgtcc 5340 tctcgaagcatatgcgcgccacataatgagaaatttgccctgaaatgaaataaatgtgat 5400 ccattttgttatctatttattcttaaattggttgtattcttcttcattcagccagttcct 5460 tgcttggtattttctccagtccttttgaactgggtcatcatttttttttcttacagaagt 5520 gtgtatgtcatgcagagcatacccaagacaagcaggttcatcgtgacgacgagtactatg 5580 aaggcgacaacgacaatgatcacgatgacggcggacattgagatcggcatcttggcgatg 5640 tatgtaggtggaagctcaaagtctttcccgcagcagctgctttttcagtttaacatcgtg 5700 ggatgggaaatacatagttggctgattgacattttaggatctgacgctagggctggaaag 5760 cattgtgggagaatgtaacacttgccgacttgtacatcattgtacgatttcacattcgta 5820 cttaaaatacaatcttttcagtacgtacgtgcttttttat t 5861 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <400> 4 gcttctttctgttttgtgatctctctaagc 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <400> 5 cccattgtaactcagttttgtaaatgtctc 30 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <400> 6 ccatatattcagtttagttgagatc 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <400> 7 taaaggctctcgaagagacagcgac 25
Claims
1. A method for screening or assisting in screening wheat with different spikelet numbers per ear, comprising the following steps: detecting the wheat to be tested based on TaHDA9-D Whether the genotype of the gene is genotype I or genotype II, the number of spikelets per ear of genotype I wheat is greater than the number of spikelets per ear of genotype II wheat; The wheat of genotype I is a wheat having a genotype of AA homozygous based on the A2173T SNP site; The wheat of genotype II is a wheat having a genotype of TT homozygous based on the A2173T SNP site; The A2173T SNP site is the 2173rd nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome.
2. A method for screening or assisting in screening wheat with different numbers of spikelets per ear, comprising the following steps in sequence: (A1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1; (A2) using the PCR amplification product P1 as a template, performing PCR amplification on primer pair B consisting of primer F2 and primer R2 to obtain a PCR amplification product P2; (A3) The PCR amplification product P2 is digested with restriction endonuclease BglII to obtain a digestion product; and then the following evaluation is performed: if the digestion product is a DNA fragment, the wheat to be tested is based on TaHDA9-D The genotype of the gene is genotype I; if the enzyme cleavage product is two DNA fragments, the wheat to be tested is based on TaHDA9-D The genotype of the gene is genotype II; The number of spikelets per ear of wheat of genotype I was greater than that of wheat of genotype II; The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4; The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5; The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6; The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:
7.
3. A method for screening or assisting in screening wheat with different numbers of spikelets per ear, comprising the following steps in sequence: (B1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1; (B2) using the PCR amplification product P1 as a template, performing PCR amplification on primer pair B consisting of primer F2 and primer R2 to obtain a PCR amplification product P2; (B3) The PCR amplification product P2 is digested with restriction endonuclease BglII to obtain a digestion product; and then the following evaluation is performed: if the digestion product contains only a 100 bp DNA fragment, the wheat to be tested is TaHDA9-D The genotype of the gene is genotype I; if the enzyme digestion product contains only a 79 bp DNA fragment and a 21 bp DNA fragment, the wheat to be tested is based on TaHDA9-D The genotype of the gene is genotype II; The number of spikelets per ear of wheat of genotype I was greater than that of wheat of genotype II; The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4; The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5; The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6; The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:
7.
4. A method for screening or assisting in screening wheat with different numbers of spikelets per ear, comprising the following steps in sequence: (C1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1; The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4; The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5; (C2) Sequencing the PCR amplification product P1 and then performing the following evaluation: If the nucleotide sequence of the PCR amplification product P1 is as shown in SEQ ID NO: 2 from the 1777th to the 2577th position from the 5' end, the wheat to be tested is based on TaHDA9-D The genotype of the gene is genotype I; If the nucleotide sequence of the PCR amplification product P1 is as shown in SEQ ID NO:3 from the 1777th to the 2577th position from the 5' end, the wheat to be tested is based on TaHDA9-D The genotype of the gene is genotype II; The number of spikelets per ear of wheat of genotype I is greater than that of wheat of genotype II.
5. Detection of wheat based on TaHDA9-D The application of the substance for genes of genotype I or genotype II is at least one of (z1) to (z3): (z1) Screening or assisting in the screening of wheat with different numbers of spikelets per ear; (z2) Identify or assist in identifying the number of spikelets per ear of wheat; (z3) Identification or auxiliary identification of wheat TaHDA9-D the genotype of a gene; The genotype I is based on the genotype of the A2173T SNP site, which is AA homozygous. TaHDA9-D Gene; The genotype II is based on the genotype of the A2173T SNP site, which is TT homozygous. TaHDA9-D Gene; The A2173T SNP site is the 2173rd nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome.
6. The use according to claim 5, characterized in that: The detection of wheat to be tested is based on TaHDA9-D The material for determining whether the genotype of the gene is genotype I or genotype II includes a primer pair A consisting of primer F1 and primer R1 and / or a primer pair B consisting of primer F2 and primer R2; The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4; The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5; The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6; The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:
7.
7. The use according to claim 6, characterized in that: The detection of wheat to be tested is based on TaHDA9-D The substance for determining whether the genotype of a gene is genotype I or genotype II also includes the restriction endonuclease BglII.
8. The use of the molecular marker represented by SEQ ID NO: 1, which is at least one of (z1)-(z3): (z1) Screening or assisting in the screening of wheat with different numbers of spikelets per ear; (z2) Identify or assist in identifying the number of spikelets per ear of wheat; (z3) Identification or auxiliary identification of wheat TaHDA9-D the genotype of a gene; The application is achieved through the A2173T SNP site; the A2173T SNP site is the 2173rd nucleotide from the 5' end of the molecular marker shown in SEQ ID NO: 1 in the wheat genome; If the genotype based on the A2173T SNP site is AA homozygous, then TaHDA9-D The genotype of the gene is genotype I; If the genotype based on the A2173T SNP site is TT homozygous, then TaHDA9-D The genotype of the gene is genotype II; The number of spikelets per ear of genotype I wheat was greater than that of genotype II wheat.