A monoclonal antibody against monkeypox virus A29L protein and its use

By developing monoclonal antibodies against monkeypoxvirus A29L protein, the shortcomings in monkeypoxvirus detection and treatment were solved, and rapid and accurate detection and effective treatment methods were achieved, supporting the prevention and improvement of monkeypoxvirus infection.

CN115975012BActive Publication Date: 2025-08-29SURE BIOTECH (HANGZHOU) LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310132024.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-06
Publication Date
2025-08-29
Estimated Expiration
2043-02-06

AI Technical Summary

Technical Problem

Currently, effective monkeypox virus detection methods and therapeutic drugs are lacking, and the mutation of monkeypox virus has enhanced its transmission and adaptability. The susceptible population of global immunity has been increasing, and there is a risk of monkeypox virus import and spread.

Method used

Monoclonal antibodies against monkeypox virus A29L protein were developed, and high-purity, high sensitivity and high specific monoclonal antibodies were prepared through hybridoma technology for immunoassay and treatment, combined with nucleic acid molecule coding sequences, and prepared detection kits and compositions.

Benefits of technology

Provides fast and accurate monkeypox virus detection methods and supports the development of products to prevent, treat or improve monkeypox virus infection. Monoclonal antibodies are characterized by high purity, high sensitivity and high specificity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004084368700000111
    Figure BDA0004084368700000111
  • Figure BDA0004084368700000131
    Figure BDA0004084368700000131
  • Figure BDA0004084368700000132
    Figure BDA0004084368700000132
Patent Text Reader

Abstract

The embodiments of this specification provide a monoclonal antibody against the monkeypox virus A29L protein. The heavy chain variable region of the monoclonal antibody comprises CDRH1, CDRH2, and CDRH3 as shown in the amino acid sequences of SEQ ID NOs: 3-5; the light chain variable region of the monoclonal antibody comprises CDRL1 as shown in SEQ ID NO: 6, CDRL2 with the sequence KVS, and CDRL3 with the sequence shown in SEQ ID NO: 8. The embodiments of this specification also provide nucleic acid molecules encoding the monoclonal antibody, compositions comprising the monoclonal antibody, detection kits comprising the monoclonal antibody, and uses of the monoclonal antibody in the preparation of products for preventing, treating, or ameliorating monkeypox virus infection or for detecting the monkeypox virus A29L protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This specification relates to the field of biomedicine, and in particular to a monoclonal antibody against monkeypox virus A29L protein and its use. Background Art

[0002] Monkeypox virus (MPXV) is a poxvirus belonging to the same genus as the smallpox virus, Orthopoxvirus. Monkeypox (MPX), caused by infection with the monkeypox virus, is a zoonosis that can be transmitted across species and between humans. Infected individuals typically experience symptoms similar to those of smallpox infection, which last for two to four weeks and have a mortality rate of 3% to 6%. The smallpox vaccine can induce cross-protection against monkeypox, giving recipients approximately 85% immunity to the monkeypox virus. However, with the declaration of smallpox eradication in the latter half of the last century, smallpox vaccinations have been significantly reduced worldwide, leading to a growing number of susceptible individuals with reduced or no immunity to the monkeypox virus.

[0003] Compared to the African strain of monkeypox virus circulating from 2018 to 2019, the currently circulating monkeypox virus has been found to have 94 nucleotide changes and 51 amino acid changes. Three of the key amino acid changes (D209N, P722S, and M1741I) are located in the immunogenic surface glycoprotein B21, implicating several important immunodominant epitopes. These mutations further enhance the virus's transmissibility and adaptability. Given the current lack of effective anti-monkeypox virus treatments, and the current global risk of monkeypox virus importation and spread, developing new, accurate, and rapid methods for detecting monkeypox virus, exploring vaccines to prevent infection, and antiviral drugs to treat or ameliorate monkeypox virus infection will be effective means of addressing this public health risk. Summary of the Invention

[0004] One or more embodiments of the present disclosure provide a monoclonal antibody against the monkeypox virus A29L protein. The monoclonal antibody comprises a heavy chain variable region and a light chain variable region. The heavy chain variable region comprises CDRH1, CDRH2, and CDRH3 with amino acid sequences set forth in SEQ ID NOs: 3-5. The light chain variable region comprises CDRL1 with an amino acid sequence set forth in SEQ ID NO: 6, CDRL2 with a sequence of KVS, and CDRL3 with a sequence set forth in SEQ ID NO: 8.

[0005] In some embodiments, the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 2.

[0006] In some embodiments, the monoclonal antibody is a murine antibody, a rabbit antibody, or a humanized antibody.

[0007] In some embodiments, the monoclonal antibody is an IgG antibody.

[0008] One or more embodiments of this specification further provide a nucleic acid molecule encoding the monoclonal antibody as described above.

[0009] In some embodiments, the nucleic acid molecule comprises a heavy chain coding sequence encoding the heavy chain variable region of the monoclonal antibody and a light chain coding sequence encoding the light chain variable region of the monoclonal antibody. The heavy chain coding sequence comprises the sequences encoding CDRH1, CDRH2, and CDRH3 of the heavy chain variable region as shown in SEQ ID NOs: 11-13. The light chain coding sequence comprises the sequence encoding CDRL1 of the light chain variable region as shown in SEQ ID NO: 14, the sequence encoding CDRL2 of the light chain variable region as AAAGT TTCC, and the sequence encoding CDRL3 of the light chain variable region as shown in SEQ ID NO: 16.

[0010] In some embodiments, the heavy chain encoding sequence is as shown in SEQ ID NO:9, and the light chain encoding sequence is as shown in SEQ ID NO:10.

[0011] One or more embodiments of this specification also provide a detection kit comprising the monoclonal antibody described above.

[0012] One or more embodiments of this specification also provide a composition for preventing, treating, or ameliorating monkeypox virus infection, wherein the composition comprises the monoclonal antibody, or an antibody combination thereof, or an antibody-drug conjugate thereof as described above.

[0013] One or more embodiments of this specification also provide the use of the monoclonal antibody as described above in preparing a product for detecting monkeypox virus A29L protein.

[0014] One or more embodiments of this specification also provide the use of the monoclonal antibody as described above in the preparation of a product for preventing, treating or ameliorating monkeypox virus infection. DETAILED DESCRIPTION

[0015] As used in this specification and claims, unless the context clearly indicates otherwise, the words "a," "an," "an," and / or "the" do not refer to the singular but also include the plural. Generally speaking, the terms "comprises" and "include" only indicate the inclusion of the steps and elements specifically identified, and these steps and elements do not constitute an exclusive list. A method or apparatus may also include other steps or elements.

[0016] Terminology used in this article

[0017] As used herein, the term "antibody" refers to an immunoglobulin produced by the body in response to antigen stimulation and capable of specifically binding to the corresponding antigen. Antibodies are generally composed of two heavy chains (HC) and two light chains (LC). Each heavy chain may include a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain variable region has three complementary determining regions (CDRs) and four framework regions (FRs), wherein the three complementary determining regions of the heavy chain are CDRH1, CDRH2, and CDRH3, respectively. Depending on the antigenicity of the heavy chain constant region, antibodies can be divided into Ig M, IgG, IgA, IgD, and IgE. Each light chain may include a light chain variable region (VL) and a light chain constant region (CL). The light chain variable region has three complementary determining regions and four framework regions, wherein the three complementary determining regions of the light chain are CDRL1, CDRL2, and CDRL3, respectively.

[0018] As used herein, the term "heavy chain variable region" or "VH" refers to the region of an antibody heavy chain near the N-terminus where the amino acid sequence and composition vary greatly.

[0019] As used herein, the term "light chain variable region" or "VL" refers to the region of the antibody light chain near the N-terminus where the amino acid sequence and composition vary greatly.

[0020] As used herein, the term "CDR" or "complementarity determining region" refers to the region of an antibody that specifically recognizes an antigen. There are three CDRs in each of the heavy and light chain variable regions of an antibody.

[0021] As used herein, the term "monoclonal antibody" or "mAb" refers to an antibody produced by a single B cell that recognizes only a single antigenic epitope. There are various methods for preparing monoclonal antibodies. In some embodiments, monoclonal antibodies can be prepared by hybridoma technology. In other embodiments, monoclonal antibodies can be prepared by genetic engineering antibody technology, such as ribosome display technology, RNA-peptide fusion technology, phage display technology, yeast display technology, transgenic animal technology, chimeric monoclonal antibody technology, etc. In some embodiments, the monoclonal antibody can be a full-length monoclonal antibody. In other embodiments, the monoclonal antibody can be an antibody fragment, such as an antigen-binding fragment (Fab) antibody, an Fv antibody, a single-chain antibody (scFv), a single-domain antibody fragment (vhh), a bispecific antibody (BsAb), etc.

[0022] As used herein, the term "humanized antibody" is a non-human antibody that has been genetically engineered, and its amino acid sequence has been modified to increase the homology with the sequence of a human antibody. Exemplary, DNA recombination technology and protein engineering technology can be used to humanize mouse antibodies, replacing the minor amino acids in the framework region and variable region of the mouse antibody with human sequences, and retaining the part of the mouse antibody that effectively binds to the antigen (such as some amino acids corresponding to the core regions of CDR1 and CDR3). The term "humanized antibody" is not limited to a specific antibody production method. For example, it can include chimeric antibodies, reshaped antibodies (also known as CDR-implanted antibodies), surface reshaped antibodies, fully humanized antibodies, etc.

[0023] Monkeypox virus (MPXV) exhibits a typical orthopoxvirus morphology, with two virion forms: intracellular mature virions (IMV) and extracellular enveloped virions (EEV), each with distinct structural and biological properties. Recent proteomic analyses have revealed that in the blood of monkeypox virus-infected individuals, early-stage human IgM antibodies primarily recognize the EEV proteins F13L, A35R, and B6R, as well as an unidentified protein, A44R. In contrast, in the blood of monkeypox virus-infected individuals, late-stage human IgG antibodies primarily recognize the EEV proteins F13L, A35R, and B6R, as well as the IMV proteins D8L, A29L, and H3L, and the core protein A4L. The A29L protein is highly homologous to the vaccinia virus (VACV) envelope protein A27. The A27 protein has multiple functions and is conserved within the Orthopoxvirus genus of the Poxviridae family. The A27 protein binds to cell surface heparan sulfate, providing an anchor for the A26 protein to be packaged into mature virions and is essential for the egress of mature MV from infected cells.

[0024] This specification proposes that monoclonal antibodies against monkeypox virus can be designed using the A29L protein as a target. Specifically, Balb / c mice can be immunized with the prokaryotically expressed A29L antigen protein of the monkeypox virus, and the mouse spleen cells can be fused with myeloma cells. Hybridoma cells with high specificity can be obtained through specific high-throughput screening. A large amount of mouse ascites can be obtained through culture and re-immunization. After multi-step separation and purification, high-purity, high-sensitivity and high-specificity monoclonal antibodies against the monkeypox virus A29L protein can be obtained. On the one hand, the specific binding ability of the monoclonal antibody to the monkeypox virus A29L protein enables it to be used in various immunological tests, such as enzyme-linked immunosorbent assay (ELISA), immunochromatography (such as colloidal gold immunochromatography, latex microsphere immunochromatography, etc.), immunoblotting (IBT), immunofluorescence (such as direct immunofluorescence and indirect immunofluorescence), chemiluminescence immunoassay (CLIA), etc. The monoclonal antibodies provided in this specification can provide raw materials for the development of immunoassay reagents for detecting monkeypox virus, for example, as antibodies against monkeypox virus in colloidal gold immunochromatography test strips. On the other hand, the specific binding ability of this monoclonal antibody to the monkeypox virus A29L protein can provide support for the development of products to prevent, treat or improve monkeypox virus infection.

[0025] According to one aspect of the present disclosure, a monoclonal antibody against monkeypox virus A29L protein is provided. The monoclonal antibody comprises a heavy chain variable region and a light chain variable region.

[0026] The heavy chain variable region may comprise a CDR sequence selected from at least one of the following: a CDRH1 having an amino acid sequence at least 95%, 96%, 97%, 98% or 99% similar to SEQ ID NO: 3; a CDRH2 having an amino acid sequence at least 95%, 96%, 97%, 98% or 99% similar to SEQ ID NO: 4; a CDRH3 having an amino acid sequence at least 95%, 96%, 97%, 98% or 99% similar to SEQ ID NO: 5;

[0027] The light chain variable region may comprise a CDR sequence selected from at least one of the following: CDRL1 having an amino acid sequence at least 95%, 96%, 97%, 98% or 99% similar to SEQ ID NO: 6; CDRL2 having an amino acid sequence at least 95%, 96%, 97%, 98% or 99% similar to the sequence KVS; CDRL3 having an amino acid sequence at least 95%, 96%, 97%, 98% or 99% similar to SEQ ID NO: 8.

[0028] Preferably, the heavy chain variable region comprises CDRH1 with an amino acid sequence as shown in SEQ ID NO: 3, CDRH2 with an amino acid sequence as shown in SEQ ID NO: 4, and CDRH3 with an amino acid sequence as shown in SEQ ID NO: 5; the light chain variable region comprises CDRL1 with an amino acid sequence as shown in SEQ ID NO: 6, CDRL2 with an amino acid sequence of KVS, and CDRL3 with an amino acid sequence as shown in SEQ ID NO: 8.

[0029] In some embodiments, the amino acid sequence of the monoclonal antibody heavy chain variable region is at least 95%, 96%, 97%, 98%, or 99% similar to SEQ ID NO: 1. Preferably, the amino acid sequence of the monoclonal antibody heavy chain variable region is as set forth in SEQ ID NO: 1. In some embodiments, the amino acid sequence of the monoclonal antibody light chain variable region is at least 95%, 96%, 97%, 98%, or 99% similar to SEQ ID NO: 2. Preferably, the amino acid sequence of the monoclonal antibody light chain variable region is as set forth in SEQ ID NO: 2.

[0030] In some embodiments, the monoclonal antibody is a mouse antibody, a rabbit antibody, or a humanized antibody. In some embodiments, the monoclonal antibody is an IgG antibody. Preferably, the monoclonal antibody is a mouse IgG antibody.

[0031] The monoclonal antibodies against the monkeypox virus A29L protein provided in some embodiments of this specification exhibit excellent sensitivity and specific binding ability in antigen detection. On one hand, these monoclonal antibodies against the monkeypox virus A29L protein can provide reliable raw materials for monkeypox virus immunoassays, for example, as labeled antibodies for use in immunochromatographic kits for monkeypox virus detection. On the other hand, these monoclonal antibodies against the monkeypox virus A29L protein can support the development of products to prevent, treat, or ameliorate monkeypox virus infection, for example, as carriers for use in antibody-drug conjugates for the treatment of monkeypox virus infection.

[0032] Another aspect of the present disclosure provides a nucleic acid molecule. The nucleic acid molecule may include a nucleotide sequence encoding the aforementioned monoclonal antibody against monkeypox virus A29L protein. In some embodiments, the nucleic acid molecule may include a nucleotide sequence encoding a heavy chain variable region and a nucleotide sequence encoding a light chain variable region.

[0033] In some embodiments, the nucleotide sequence encoding the heavy chain variable region may comprise a CDR encoding sequence selected from at least one of the following: a nucleotide sequence encoding a heavy chain variable region CDRH1 that is at least 95%, 96%, 97%, 98%, or 99% similar to SEQ ID NO: 11; a nucleotide sequence encoding a heavy chain variable region CDRH2 that is at least 95%, 96%, 97%, 98%, or 99% similar to SEQ ID NO: 12; and a nucleotide sequence encoding a heavy chain variable region CDRH3 that is at least 95%, 96%, 97%, 98%, or 99% similar to SEQ ID NO: 13. Preferably, the nucleotide sequence encoding the heavy chain variable region may comprise the nucleotide sequence encoding the heavy chain variable region CDRH1 as set forth in SEQ ID NO: 11, the nucleotide sequence encoding the heavy chain variable region CDRH2 as set forth in SEQ ID NO: 12, and the nucleotide sequence encoding the heavy chain variable region CDRH3 as set forth in SEQ ID NO: 13.

[0034] In some embodiments, the nucleotide sequence encoding the light chain variable region may comprise a CDR encoding sequence selected from at least one of the following: a nucleotide sequence encoding CDRL1 of a light chain variable region, which has at least 95%, 96%, 97%, 98%, or 99% similarity to SEQ ID NO: 14; a nucleotide sequence encoding CDRL2 of a light chain variable region, which has at least 95%, 96%, 97%, 98%, or 99% similarity to the sequence AAAGTTTCC; and a nucleotide sequence encoding CDRL3 of a light chain variable region, which has at least 95%, 96%, 97%, 98%, or 99% similarity to SEQ ID NO: 16. Preferably, the nucleotide sequence encoding the light chain variable region may comprise a nucleotide sequence encoding CDR H1 of a light chain variable region as set forth in SEQ ID NO: 14, a nucleotide sequence encoding CDRH2 of a light chain variable region as set forth in SEQ ID NO: 16, and a nucleotide sequence encoding CDRH3 of a light chain variable region as set forth in SEQ ID NO: 16.

[0035] In some embodiments, the nucleotide sequence encoding the heavy chain variable region may be a nucleotide sequence having at least 95%, 96%, 97%, 98%, or 99% similarity to SEQ ID NO: 9. Preferably, the nucleotide sequence encoding the heavy chain variable region may be as shown in SEQ ID NO: 9. In some embodiments, the nucleotide sequence encoding the light chain variable region may be a nucleotide sequence having at least 95%, 96%, 97%, 98%, or 99% similarity to SEQ ID NO: 10. Preferably, the nucleotide sequence encoding the light chain variable region may be as shown in SEQ ID NO: 10.

[0036] In another aspect of the present specification, a detection kit is provided for detecting monkeypox virus. The detection kit may contain the above-mentioned monoclonal antibody against monkeypox virus A29L protein. In some embodiments, the detection kit is an immunochromatography kit, and the monoclonal antibody can be used as an antibody with a detectable label for coating the label pad of a chromatography test paper. In some embodiments, the detection kit is an ELISA kit, and the monoclonal antibody can be used as a coating antibody or an enzyme-labeled antibody. It is understood that in other embodiments, the detection kit can be used to implement other immunoassay methods for detecting monkeypox virus, such as immunofluorescence kits, immunohistochemistry kits, etc., which are not limited here.

[0037] In some embodiments of this specification, the monoclonal antibody against the monkeypox virus A29L protein as described above is used to prepare a detection kit, which can provide a rapid, efficient and accurate solution for the antigen detection of monkeypox virus.

[0038] Another aspect of this specification also provides a composition for preventing, treating or improving monkeypox virus infection. The composition comprises a monoclonal antibody against monkeypox virus A29L protein as described above, or an antibody combination thereof, or an antibody drug conjugate thereof. In some embodiments, the antibody combination may include a monoclonal antibody against monkeypox virus A29L protein as described above, and antibodies against other targets of monkeypox virus (such as A35R protein, H3L protein, etc.) or antibodies against targets of other viruses (such as orthopoxviruses, including smallpox, variola, cowpox, etc.). In some embodiments, the antibody drug conjugate may include a monoclonal antibody against monkeypox virus A29L protein as described above and a small molecule drug coupled thereto, such as the antiviral drug cidofovir, tecovirimat, etc.

[0039] In some embodiments, the composition may further comprise other active pharmaceutical ingredients, such as various biomacromolecule drugs such as polypeptides, proteins, and nucleic acid drugs, as well as various small molecule drugs such as enzyme inhibitors, transcription factor inhibitors, metabolic pathway inhibitors, proton pump inhibitors, and ion channel blockers. In some embodiments, the composition may further comprise a pharmaceutically acceptable carrier, such as various excipients, diluents, and buffers. In some embodiments, the composition may be formulated in the form of tablets, capsules, granules, powders, liquids, suspensions, creams, foams, gels, lotions, pastes, or ointments.

[0040] In another aspect of the present specification, there is provided a use of the monoclonal antibody against monkeypox virus A29L protein as described above in preparing a product for detecting monkeypox virus, and in preparing a product for preventing, treating or ameliorating monkeypox virus infection.

[0041] The monoclonal antibody against the monkeypox virus A29L protein disclosed in some embodiments of this specification has beneficial effects including but not limited to: (1) the monoclonal antibody has the characteristics of high purity, high sensitivity and high specificity, and can provide a reliable raw material for the immunoassay of monkeypox virus; (2) the monoclonal antibody's specific binding ability to the surface envelope protein A29L of the intracellular mature virion (IMV) of monkeypox virus can provide support for the development of vaccines against monkeypox virus and various anti-monkeypox virus drugs. It should be noted that different embodiments may produce different beneficial effects. In different embodiments, the beneficial effects that may be produced may be any one or a combination of the above, or any other possible beneficial effects.

[0042] The experimental methods in the following examples, unless otherwise specified, are all conventional methods. The experimental materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent companies. The quantitative experiments in the following examples were all repeated three times, and the results were averaged.

[0043] Example

[0044] Construction of recombinant vector pcDNA3.1-HIS-A29L

[0045] The A29L protein coding sequence was artificially synthesized (by Shanghai Sangon Biotechnology Co., Ltd.) based on the sequence of the monkeypox virus A29L protein (Genebank accession number: QJQ40281.1). The EcoRI restriction site GAATTC was added upstream, and the BamHI restriction site GGATC C was added downstream. The synthesized product was double-digested with BamHI and EcoRI to recover a 330-bp fragment of the A29L protein coding sequence. The eukaryotic expression vector pcDNA3.1 / HIS A was double-digested with BamHI and EcoRI, and the recovered A29L protein coding sequence fragment was ligated to generate the recombinant vector pcDNA3.1-HIS-A29L.

[0046] Expression of monkeypox virus A29L protein

[0047] Escherichia coli was transformed with the recombinant vector pcDNA3.1-HIS-A29L. After plasmid amplification, the plasmid was extracted and endotoxin removed using an endotoxin-free plasmid extraction kit (TaKaRa, Cat. No. 9783). Following the instructions for the Lipofectamine transfection kit, the extracted plasmid was prepared into a DNA-liposome mixture and added to DMEM medium containing HEK293F cells. The mixture was incubated at 37°C for 2 hours. The DMEM medium was then replaced with DMEM supplemented with 10% BSF and cultured for another 48 hours. FA supplement (Hangzhou Peiding Biological Company, Cat. No. PDF01-1000) was added every other day. Seven days after transfection, the cell suspension expressing the HEK293F cells was centrifuged and the supernatant collected.

[0048] According to the instructions of Glutathione Ni Sepharose 6 Fast Flow (GE Company, product number 17-5318-01), the target protein monkeypox virus A29L protein was collected by column operation as follows: (1) Clarification and filtration of the supernatant: the supernatant was clarified using a 50 ml syringe and a 0.22 μm filter membrane; (2) the target protein in the supernatant was captured and purified using a protein chromatography column on an AKTA protein purification system; (3) the system was flushed, and the A1 pump of the AKTA protein purification system was flushed with an equilibration solution (1× PBS buffer) and the eluent (1 M miconazole) was used. (4) Set the system flow rate to 0.1 ml / min, select the corresponding column position 1 to connect the protein chromatography column, balance the AKTA and protein chromatography column with the balance solution, and adjust the UV to zero after the balance is completed; (5) Start loading the sample, transfer the A1 pump to the sample loading centrifuge tube for sample loading; (6) After the loading is completed, transfer the A1 pump to the balance solution, rinse the balance solution until the detection wavelength is stable, use the B1 pump for gradient elution, and collect the eluate; (7) Rinse again with the balance solution (1×PBS buffer), and finally rinse with 20% ethanol and store.

[0049] Through the above operation, the recombinant 6×His-tagged A29L protein was eluted from the protein chromatography column with elution buffer, and the purified protein was analyzed by SDS-PAGE and observed by Coomassie Brilliant Blue staining to obtain a highly pure A29L protein.

[0050] Preparation of monoclonal antibodies against monkeypox virus A29L protein

[0051] In this example, healthy 6-8 week old BALB / c female mice were immunized with the A29L protein obtained above as the immune antigen. Splenic lymphocytes from the successfully immunized mice were fused with mouse myeloma SP2 / 0 cells using cell fusion technology. After subclone screening, a hybridoma cell line that stably secretes monoclonal antibodies against monkeypox virus A29L protein was obtained.

[0052] Animal Immunization

[0053] Animal Preparation: Balb / c mice of similar weight and age were randomly divided into Group A and Group B. Group A mice were immunized with 100 μg / mouse immunization antigen to induce an immune response; Group B mice were immunized with 150 μg / mouse immunization antigen to induce an immune response. Each group of mice also had a blank control group.

[0054] Collect negative control serum: Before the start of the immunization experiment, collect the pre-immune serum of each mouse (collect pre-immune serum by eye bleeding on the fifth day, and collect an appropriate amount of blood to ensure that the mice are in normal condition) as a negative control, and store the collected serum at -80°C.

[0055] Prepare an aluminum-adjuvanted immunoassay: Dilute the A29L antigen to the corresponding doses (100 μg / mouse and 150 μg / mouse) in 75 μL of PBS to create an immunogen diluent. Mix the immunogen diluent with alum adjuvant (i.e., aluminum hydroxide adjuvant, 1 mg / mouse) at a volume ratio of 3:1 (i.e., add 25 μL of alum adjuvant to 75 μL of immunogen diluent) to prepare the aluminum-adjuvanted immunoassay. Shake the alum adjuvant well before use and slowly add it dropwise to the immunogen diluent. Mix the alum adjuvant and antigen diluent for 30 minutes to allow the adjuvant to effectively absorb the antigen.

[0056] Preparation of immune reagents without aluminum adjuvant: The antigen A29L protein was diluted to corresponding doses (100 ug / mouse, 150 ug / mouse) in 100 μL PBS to prepare immune reagents without aluminum adjuvant and set aside.

[0057] Immunization of mice: Mice were immunized three times, two weeks apart, by subcutaneous injection. Group A received an immunization agent containing an aluminum adjuvant, Group B received an immunization agent without an aluminum adjuvant, and the control group received normal saline. Seven days after the first two immunizations, eye blood was collected, and the supernatant was centrifuged for serum antibody titer assay. Seven days after the third immunization, a maximum blood volume was collected from the heart, the supernatant was centrifuged, and stored at -80°C. The antibody titer assay results for selected sera after the second immunization are shown in Table 1. Mice numbered A0, A1, and A2 belong to Group A, and mice numbered B0 and B1 belong to Group B.

[0058] Table 1 - Serum antibody titer test data after the second immunization

[0059]

[0060] As shown in Table 1, the orbital blood antibody titers of the three mice numbered A2, B0, and B1 after the second immunization were all greater than 62,500, and they can be used for cell fusion experiments to screen hybridoma cell lines that stably secrete monoclonal antibodies against monkeypox virus A29L protein.

[0061] Establishment of antibody titer detection method

[0062] In this embodiment, the antibody titer is detected by enzyme-linked immunosorbent assay (ELISA), and the specific steps are as follows:

[0063] (1) Bottom plate coating: Dilute the antigen to be used with coating diluent to 3 μg / mL, add 100 μL of the prepared coating solution to each well, and place in a 4°C refrigerator for 24 hours.

[0064] (2) After 24 hours, take the wells out of the refrigerator and place them at 37°C for 30 minutes. Then discard the liquid in the wells and wash the wells three times with washing solution, each time for 3 minutes.

[0065] (3) Block the enzyme-labeled reaction wells: Add 200 μL of 5% calf serum to each well and incubate at 37°C for 90 min. After blocking, wash the wells three times with washing solution, each time for 3 min.

[0066] (4) Add the sample to be tested: dilute the sample according to the required ratio, add the diluted sample to the enzyme-labeled reaction well, 100 μL per well, incubate at 37°C for 90 min; wash the well three times with washing solution, each time for 3 min.

[0067] (5) Add enzyme-labeled antibody: Add secondary antibody at an appropriate concentration according to the instructions; incubate at 37°C for 90 min, add 100 μL per well and wash as before.

[0068] (6) Add substrate solution: Add 100 μL of substrate to each well and incubate at 37°C in the dark for 15 to 30 minutes.

[0069] (7) Termination reaction: Add 50 μL of stop solution to each well to terminate the reaction and measure the experimental results within 20 minutes.

[0070] Construction and screening of hybridoma cell lines

[0071] Splenic lymphocytes from immunized mice numbered A2, B0, and B1 were fused with the myeloma cell line SP2 / 0 for three rounds. Fusion cells were screened using HAT selection medium (containing hypoxanthine, aminopterin, and thymidine), and 27 positive wells were selected for subcloning. After fusion screening, 48 positive wells with OD450 values ​​>2.2 were selected for titer determination by serial dilution. A second subcloning screening was performed, ultimately resulting in nine hybridoma cell lines. Three hybridoma cell lines were established based on immunized mouse A2, numbered A2-1, A2-2, and A2-3; three hybridoma cell lines were established based on immunized mouse B0, numbered B0-1, B0-2, and B0-3; and three hybridoma cell lines were established based on immunized mouse B1, numbered B1-1, B1-2, and B1-3.

[0072] Preparation of monoclonal antibodies

[0073] In this example, monoclonal antibodies against the monkeypox virus A29L protein were prepared using an in vivo ascites-induced method in F1 mice. Three F1 mice were intraperitoneally injected with each complete cell line, and ascites samples were collected. A total of nine ascites samples were obtained, numbered according to the corresponding cell line number. Antibody titers in these samples were determined using the aforementioned antibody titer assay. The test data are shown in Table 2.

[0074] Table 2 - Ascites sample titer test data

[0075]

[0076] Purification of monoclonal antibodies and antigen binding activity detection

[0077] The nine ascites samples were purified by octanoic acid-ammonium sulfate precipitation to obtain nine purified cloned antibody samples. The antibody sample numbers refer to the corresponding cell line numbers. The antibody titers of the antibody samples were tested using the aforementioned antibody titer detection method. The test data are shown in Table 3.

[0078] Table 3 - Antibody sample titer test data

[0079]

[0080] As shown in Table 3, the nine monoclonal antibody samples have good specific binding ability to the immune antigen A29L protein prepared in the "Expression of Monkeypox Virus A29L Protein" of this Example. The ELISA titer of the above purified monoclonal antibody is >1:128, 000, purity>90%.

[0081] To verify the antigen-binding activity of the monoclonal antibody prepared in this example, antibody titer was tested using three commercially available monkeypox virus A29L antigen proteins as shown in Table 4.

[0082] Table 4 - Information on commercially available monkeypox virus A29L antigen protein

[0083]

[0084] According to the aforementioned antibody titer detection method, the titer of the 9 monoclonal antibody samples prepared in this example was tested using antigen No. 1. The test data are shown in Table 5.

[0085] Table 5 - Antibody sample titer test data

[0086]

[0087] According to the aforementioned antibody titer detection method, the titer of the 9 monoclonal antibody samples prepared in this example was tested using antigen No. 2. The test data are shown in Table 6.

[0088] Table 6 - Antibody sample titer test data

[0089]

[0090] According to the aforementioned antibody titer detection method, the titer of the 9 monoclonal antibody samples prepared in this example was tested using antigen No. 3. The test data are shown in Table 7.

[0091] Table 7 - Antibody sample titer test data

[0092]

[0093] As shown in Tables 4, 5, 6, and 7, the monoclonal antibodies prepared in this Example exhibit broad binding activity against both the monkeypox virus A29L antigen protein prepared in this Example and the commercially available monkeypox virus A29L antigen protein, demonstrating high purity, sensitivity, and specificity. In particular, the monoclonal antibodies numbered A2-3, B1-2, and B1-3 exhibited superior binding activity against the commercially available monkeypox virus A29L antigen protein compared to other monoclonal antibody samples, and can be used in various immunological assays, including ELISA, immunochromatography, immunoblotting, and immunofluorescence.

[0094] Sequence Analysis of Monoclonal Antibody Anti-A29L-1

[0095] The antibody sample numbered A2-3 was named Anti-A29L-1, and the sequence of the antibody heavy chain variable region and light chain variable region was analyzed.

[0096] Design primers for the heavy chain variable region gene and light chain variable region gene amplification for the monoclonal antibody Anti-A29L-1. The primer sequences are as follows:

[0097] Heavy chain variable region forward primer (VH-F): GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG (SEQ ID NO: 17);

[0098] Heavy chain variable region reverse primer (VH-R): GGAAGGTGTGCACACCGCTGGAC (SEQ ID NO: 18);

[0099] Light chain variable region forward primer (VL-F): TCGTGTTKCTSTGGTTGTCTG (SEQ ID NO: 19);

[0100] Light chain variable region reverse primer (VL-R): GATGGTGGGAAGATGGATACAGTT (SEQ ID NO: 20).

[0101] Take the hybridoma cell line (about 10 7 cells), and total RNA was extracted from the cells according to the instructions of the Trizol RNA extraction kit (TAKARA, Cat. No. 9767). The total RNA was used as a template for reverse transcription to synthesize the first-strand cDNA. The above-mentioned amplified product was used as a template for PCR amplification of the heavy chain variable region and light chain variable region genes of the monoclonal antibody Anti-A29L-1.

[0102] The heavy chain variable region and light chain variable region gene fragments of the monoclonal antibody Anti-A29L-1 were recovered and sent for sequencing. The sequencing results are shown in Table 8.

[0103] Table 8 - Sequence information of monoclonal antibody Anti-A29L-1

[0104]

[0105]

[0106] While the basic concepts have been described above, it will be apparent to those skilled in the art that the detailed disclosure is merely illustrative and does not limit this specification. Although not explicitly stated herein, various modifications, improvements, and revisions to this specification may be made by those skilled in the art. Such modifications, improvements, and revisions are suggested in this specification and remain within the spirit and scope of the exemplary embodiments of this specification.

[0107] This specification also uses specific terms to describe the embodiments of this specification. For example, "one embodiment," "an embodiment," and / or "some embodiments" refer to a feature, structure, or characteristic associated with at least one embodiment of this specification. Therefore, it should be emphasized and noted that references to "one embodiment," "an embodiment," or "an alternative embodiment" two or more times in different locations in this specification do not necessarily refer to the same embodiment. Furthermore, certain features, structures, or characteristics of one or more embodiments of this specification may be appropriately combined.

[0108] In some embodiments, numbers are used to describe the quantity of components and attributes. It should be understood that such numbers used in the description of the embodiments are modified by the modifiers "about", "approximately" or "substantially" in some examples. Unless otherwise stated, "about", "approximately" or "substantially" indicate that the numbers are allowed to vary by ±20%. Accordingly, in some embodiments, the numerical parameters used in the description and claims are approximate values, which may change according to the required characteristics of individual embodiments. In some embodiments, the numerical parameters should take into account the specified significant digits and adopt the general method of retaining digits. Although the numerical domains and parameters used to confirm the breadth of their range in some embodiments of this specification are approximate values, in specific embodiments, the settings of such numerical values ​​are as accurate as possible within the feasible range.

[0109] Each patent, patent application, patent application publication, and other materials, such as articles, books, specifications, publications, and documents, cited in this specification is hereby incorporated by reference in its entirety. This includes application history documents that are inconsistent with or conflict with the content of this specification, as well as documents (currently or subsequently attached to this specification) that limit the broadest scope of the claims of this specification. It should be noted that if the descriptions, definitions, and / or terminology used in the accompanying materials are inconsistent or conflicting with the content of this specification, the descriptions, definitions, and / or terminology used in this specification will control.

[0110] Finally, it should be understood that the embodiments described in this specification are intended only to illustrate the principles of the embodiments of this specification. Other variations may also fall within the scope of this specification. Therefore, by way of example and not limitation, alternative configurations of the embodiments of this specification may be considered consistent with the teachings of this specification. Accordingly, the embodiments of this specification are not limited to the embodiments explicitly described and illustrated in this specification.

Claims

1. A monoclonal antibody against monkeypox virus A29L protein, characterized in that Include: a heavy chain variable region comprising CDRH1, CDRH2, and CDRH3 having amino acid sequences as shown in SEQ ID NOs: 3-5; and The light chain variable region comprises CDRL1 having an amino acid sequence as shown in SEQ ID NO: 6, CDRL2 having a sequence as KVS, and CDRL3 having a sequence as shown in SEQ ID NO:

8.

2. The monoclonal antibody according to claim 1, wherein The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO:

2.

3. The monoclonal antibody according to claim 1 or 2, wherein The monoclonal antibody is a mouse antibody, a rabbit antibody or a humanized antibody.

4. The monoclonal antibody according to claim 1 or 2, wherein The monoclonal antibody is an IgG antibody.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the monoclonal antibody according to any one of claims 1 to 4.

6. The nucleic acid molecule according to claim 5, wherein The nucleic acid molecule comprises: A heavy chain coding sequence encoding the heavy chain variable region of the monoclonal antibody, comprising the sequences encoding CDRH1, CDRH2 and CDRH3 of the heavy chain variable region as shown in SEQ ID NOs: 11-13; and The light chain coding sequence encoding the light chain variable region of the monoclonal antibody comprises a sequence encoding CDRL1 of the light chain variable region as shown in SEQ ID NO: 14, a sequence encoding CDRL2 of the light chain variable region as shown in SEQ ID NO: AAAGTTTCC, and a sequence encoding CDRL3 of the light chain variable region as shown in SEQ ID NO:

16.

7. The nucleic acid molecule according to claim 6, wherein The heavy chain coding sequence is shown in SEQ ID NO: 9, and the light chain coding sequence is shown in SEQ ID NO:

10.

8. A detection kit, characterized in that The method comprises the monoclonal antibody according to any one of claims 1 to 4.

9. A composition for detecting monkeypox virus infection, characterized in that The method comprises the monoclonal antibody according to any one of claims 1 to 4.

10. Use of the monoclonal antibody according to any one of claims 1 to 4 in the preparation of a product for detecting monkeypox virus A29L protein.

Citation Information

Patent Citations

  • Specific fusion protein antigen of monkey pox virus as well as preparation method and application of specific fusion protein antigen

    CN115043948A

  • Protein vaccines against poxviruses

    US20100196491A1