Neutralizing antibody P36-5D2 neutralizing a broad spectrum of SARS-CoV-2 and application thereof

Abstract

The application discloses a neutralizing antibody P36-5D2 for neutralizing SARS-CoV-2 in a broad spectrum and application thereof. The application provides an IgG antibody, named antibody P36-5D2, which is composed of a light chain and a heavy chain; CDR1, CDR2 and CDR3 in the heavy chain variable region are in sequence 4 from N-terminal 45-52th, 70-77th and 116-130th amino acid residues; CDR1, CDR2 and CDR3 in the light chain variable region are in sequence 6 from N-terminal 46-51th, 69-71th and 108-116th amino acid residues. The antibody P36-5D2 has the effect of neutralizing SARS-CoV-2 in a broad spectrum, and has strong neutralization capacity to wild-type novel coronavirus and natural mutant strains. The application has great application value for prevention and control of the novel coronavirus, and will have far-reaching social significance.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a broad-spectrum neutralizing antibody P36-5D2 that neutralizes SARS-CoV-2 and its applications. Background Technology

[0002] COVID-19 is caused by infection with a novel coronavirus. The main symptoms are low-grade fever, fatigue, and dry cough. A few patients may also experience upper respiratory and digestive symptoms such as nasal congestion, runny nose, and diarrhea. Severe cases can develop acute respiratory distress syndrome, septic shock, metabolic acidosis, coagulation dysfunction, and multiple organ failure. The novel coronavirus (SARS-CoV-2) belongs to the β-coronavirus genus.

[0003] During its transmission, SARS-CoV-2 has undergone numerous mutations, enhancing its transmissibility and immune evasion. Currently, the main circulating naturally occurring mutant strains include the Alpha strain discovered in the UK, the Beta strain in South Africa, and the Gamma strain in Brazil. Vaccination against the novel coronavirus has also been affected. The neutralizing activity of inactivated vaccine serum against the South African mutant strain has decreased by half, and the neutralizing activity of mRNA vaccine serum against the South African mutant strain has decreased by approximately tenfold. Many monoclonal antibodies have also shown weakened or lost neutralizing activity against the mutant strain.

[0004] Monoclonal antibodies can be mass-produced industrially. Their high affinity and specificity for antigen binding significantly reduce adverse reactions in clinical applications. Furthermore, antibody molecules can be modified to increase their antiviral efficacy. Antibodies, with their specificity and flexibility of use, are a very promising tool in the treatment of infectious diseases. Currently, there is an urgent need to address the challenges posed by naturally occurring mutant strains of the novel coronavirus. Developing broad-spectrum human monoclonal antibodies against the novel coronavirus will provide more effective prevention and treatment for infections caused by these naturally occurring mutant strains. Summary of the Invention

[0005] The purpose of this invention is to provide a broad-spectrum neutralizing antibody P36-5D2 against SARS-CoV-2 and its applications.

[0006] This invention provides an IgG antibody, named antibody P36-5D2, composed of a light chain and a heavy chain; the CDR1, CDR2, and CDR3 in the variable region of the heavy chain are, in sequence 4 from the N-terminus, amino acid residues 45-52, 70-77, and 116-130, respectively; the CDR1, CDR2, and CDR3 in the variable region of the light chain are, in sequence 6 from the N-terminus, amino acid residues 46-51, 69-71, and 108-116, respectively.

[0007] The heavy chain variable region consists of amino acid residues from the N-terminus of sequence 4 in the sequence listing, from position 20 to 142.

[0008] The light chain variable region consists of amino acid residues from the N-terminus of sequence 6 in the sequence listing, from position 20 to 126.

[0009] The heavy chain is either (a) or (b) as follows: (a) the protein consisting of amino acid residues 20-471 from the N-terminus of Sequence 4 in the sequence listing; (b) the protein shown in Sequence 4 in the sequence listing.

[0010] The light chain is either (c) or (d) as follows: (c) the protein consisting of amino acid residues 20-233 from the N-terminus of Sequence 6 in the sequence listing; (d) the protein shown in Sequence 6 in the sequence listing.

[0011] The gene encoding the IgG antibody is also within the scope of protection of this invention.

[0012] The gene encoding the heavy chain is as follows (1) or (2):

[0013] (1) The DNA molecule shown in sequence 5 of the sequence listing, from nucleotides 949 to 2304 from the 5' end;

[0014] (2) The DNA molecule shown in sequence 5 of the sequence listing, from nucleotides 892 to 2307 from the 5' end.

[0015] The gene encoding the light chain is as follows (3) or (4):

[0016] (3) The DNA molecule shown in sequence 7 of the sequence listing, from nucleotides 1095 to 1736 from the 5' end;

[0017] (4) The DNA molecule shown in sequence 7 of the sequence listing, from nucleotides 1038 to 1739 at the 5' end.

[0018] The present invention also protects the use of the IgG antibody in the preparation of a medicament for inhibiting the novel coronavirus.

[0019] The present invention also protects a drug for inhibiting the novel coronavirus, the active ingredient of which is the IgG antibody.

[0020] The present invention also protects the use of the IgG antibody in the preparation of a medicament for neutralizing the novel coronavirus.

[0021] The present invention also protects a drug for neutralizing the novel coronavirus, the active ingredient of which is the IgG antibody.

[0022] The present invention also protects the use of the IgG antibody in the preparation of medicaments for the prevention and / or treatment of COVID-19.

[0023] The present invention also protects a medicament for the prevention and / or treatment of COVID-19, the active ingredient of which is the IgG antibody.

[0024] The COVID-19 pandemic described above is caused by the novel coronavirus.

[0025] The novel coronavirus mentioned above is either a wild-type novel coronavirus or a naturally occurring variant of the wild-type novel coronavirus.

[0026] The novel coronavirus mentioned above is a wild-type novel coronavirus, a novel coronavirus Alpha strain, a novel coronavirus Beta strain, or a novel coronavirus Gamma strain.

[0027] The novel coronavirus mentioned above is the novel coronavirus Alpha strain, the novel coronavirus Beta strain, or the novel coronavirus Gamma strain.

[0028] This invention utilizes the spike protein of the novel coronavirus as bait, screening antibody-generating memory B cells from peripheral blood mononuclear cells of infected individuals to obtain a monoclonal antibody that specifically binds to the spike protein, named antibody P36-5D2. The antibody P36-5D2 provided by this invention has a broad-spectrum neutralizing effect against SARS-CoV-2, exhibiting strong neutralizing ability against both wild-type novel coronavirus and naturally occurring variants. This invention has significant application value for the prevention and control of the novel coronavirus and will have profound social implications. Attached Figure Description

[0029] Figure 1 This is a chromatogram of gel filtration chromatography.

[0030] Figure 2 The neutralizing activity of the P36-5D2 antibody against the novel coronavirus pseudovirus was measured.

[0031] Figure 3 The neutralizing activity of the P36-5D2 antibody against live novel coronavirus was measured.

[0032] Figure 4 This is the weight change curve in Example 5.

[0033] Figure 5 This is the survival rate change curve in Example 5.

[0034] Figure 6 This is the result of viral load in Example 5.

[0035] Figure 7 The results are from the pathological sections in Example 5. Detailed Implementation

[0036] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. hACE2-hela cells (ie "HeLa cell lines stably expressing the ACE2" in the literature molecules"), recorded in the following literature: Wang, R., Zhang, Q., Ge, J., Ren, W., Zhang, R., Lan, J., Ju, B., Su, B., Yu, F., Chen, P .,Liao,H.,Feng,Y.,Li,X.,Shi,X.,Zhang,Z.,Zhang,F.,Ding,Q.,Zhang,T.,Wang,X.&Zhang,L.Analysis of SARS-CoV-2 variantmutations reveals neutralization escape mechanisms and the ability to use ACE2 receptors from additional species. Immunity 54, 1611-1621.e1615, doi:10.1016 / j.immuni.2021.06.003(2021). Plasmid pcDNA3.1(+): Invitrogen, catalog number V790-20. 293T cells: Gader, CRL-11268.

[0038] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0039] Example 1: Antibody Screening

[0040] I. Protein Preparation

[0041] 1. Constructing recombinant plasmids

[0042] The small fragment between the BamHI and HindIII restriction sites in plasmid pcDNA3.1(+) was replaced with a double-stranded DNA molecule as shown in Sequence 2 of the sequence listing, resulting in the recombinant plasmid pcDNA3.1-SARS-CoV-2spike 2P. The recombinant plasmid has been sequenced and verified.

[0043] The DNA molecule shown in Sequence 2 of the sequence listing encodes the protein shown in Sequence 1 of the sequence listing. The protein shown in Sequence 1 of the sequence listing is named the SARS-CoV-2 spike 2P extracellular region fusion protein, or simply the fusion protein. The fusion protein exists in trimer form, with an expected molecular weight of 420 kDa.

[0044] In sequence 1 of the sequence listing, amino acid residues 1-14 form the signal peptide, amino acid residues 15-1211 form the extracellular region of SARS-CoV-2, amino acid residues 1212-1219 form the 3C restriction site, amino acid residues 1220-1227 form the linker peptide, amino acid residues 1228-1255 form the trimer tag, amino acid residues 1256-1263 form the strep tag, and amino acid residues 1264-1269 form the His6 tag.

[0045] The corresponding protein in the wild-type novel coronavirus is shown in Sequence 3 of the sequence listing. Compared with the protein shown in Sequence 3, the protein shown in Sequence 1 has undergone the following modifications: two mutations were introduced, namely, the S1 / S2 restriction site was changed from “RRKR” to “GSAS” and “KV” was changed to “PP”, to increase protein stability; a 3C restriction site, a linker peptide, a trimer tag, a strep tag, and a His6 tag were introduced at the C-terminus.

[0046] 2. Protein preparation

[0047] (1) Transfect 293F cells with the recombinant plasmid pcDNA3.1-SARS-CoV-2spike 2P, culture them in SMM 293-TII medium for 72 h, then centrifuge at 4000 rpm for 30 min and collect the supernatant.

[0048] (2) Affinity chromatography

[0049] Affinity chromatography column specifications: length 3cm, inner diameter 1cm.

[0050] Affinity chromatography column packing material: nickel column beads (purchased from Qiagen, catalog number 30230).

[0051] The following steps were performed sequentially: ① 300 mL of the supernatant obtained in step (1) was loaded onto an affinity chromatography column and incubated at 4°C for 3 hours; ② The column was washed with 100 mL of HEPEs buffer (pH 7.2, 1 M) containing 20 mM imidazole; ③ The target protein was eluted with 30 mL of HEPEs buffer (pH 7.2, 1 M) containing 500 mM imidazole, and the post-column solution was collected.

[0052] (3) Take the column pass solution obtained in step (2) and concentrate it using a 30kD concentration tube (purchased from Merck, catalog number UFC800396) to obtain a 1mL concentrate.

[0053] (4) Gel filtration chromatography

[0054] The specifications for the gel filtration chromatography column are: length 24cm, inner diameter 2cm.

[0055] Gel filtration chromatography column packing material: Superdex 200 Increase 10 / 300GL (purchased from GE Healthcare, catalog number 28-9909-44).

[0056] Perform the following steps: Load 0.5 mL of the concentrated solution obtained in step (3), elute with PBS buffer (pH 7.2, 10 mM) at a flow rate of 0.5 mL / min, and collect the post-column solution corresponding to the target peak, which is the protein solution containing the SARS-CoV-2 spike 2P extracellular fusion protein.

[0057] Chromatogram (see) Figure 1 The arrow marks the target peak.

[0058] II. Identification and sorting of memory B cells from infected individuals, and antibody construction followed by supernatant screening.

[0059] 1. Isolation of peripheral blood mononuclear cells: EDTA-anticoagulated peripheral venous blood was collected from convalescent patients infected with COVID-19. Peripheral blood mononuclear cells were isolated using density gradient centrifugation and aliquoted into 5×10⁶ cells / ml containers. 6 / tube, placed in liquid nitrogen for cryopreservation.

[0060] 2. Fluorescent antibody staining: Peripheral blood mononuclear cells were thawed in a 37°C water bath, washed three times with PBS buffer, and then stained with fluorescently labeled antibodies (9 analysis tubes were prepared; tubes 1-7 were filled with the corresponding single fluorescently labeled antibody, tube 9 was filled with a mixture of 7 fluorescently labeled antibodies, and tube 8 was a blank tube containing only cells). The cells were incubated at room temperature in the dark for 15 min, washed with PBS buffer, and then suspended in 200 μl of PBS buffer before being loaded onto a flow cytometer BDAriaII.

[0061] 3. Sorting of Memory B Cells: Sample tubes were analyzed to distinguish live B cells from non-B cells based on PI and CD3, CD14, CD16, and CD235a. B cells were then identified based on CD19. CD27+IgG+ memory B cells were identified from the B cell population. Antigen-specific memory B cells were then sorted into 96-well PCR plates containing lysis buffer using the strep and His6 tags of the SARS-CoV-2 spike 2P extracellular fusion protein, one cell per well.

[0062] 4. Obtaining the antibody gene: The genome of a single cell is obtained using SmartSeq2 technology. First, single-cell mRNA is reverse transcribed into cDNA. The cDNA is pre-amplified, and then a transcriptome is used to build a library for next-generation sequencing. The BCR sequence is obtained by assembling the single-cell transcriptome sequencing data using BASIC software. The antibody variable region is then mounted onto the constant regions of the antibody heavy and light chains.

[0063] 5. Screening of neutralizing antibodies: The strongest neutralizing antibodies with the best effect are screened through pseudovirus neutralization experiments.

[0064] The antibody that yielded the best results was named P36-5D2 antibody.

[0065] The P36-5D2 antibody is an IgG antibody. The heavy chain is shown in Sequence 4 of the sequence listing (amino acid residues 20-142 form the variable region, amino acid residues 143-471 form the constant region; CDR1, CDR2 and CDR3 are at positions 45-52, 70-77 and 116-130 respectively). The light chain is shown in Sequence 6 of the sequence listing (amino acid residues 20-126 form the variable region, amino acid residues 127-233 form the constant region; CDR1, CDR2 and CDR3 are at positions 46-51, 69-71 and 108-116 respectively).

[0066] Example 2: Preparation of P36-5D2 antibody

[0067] I. Construction of Recombinant Plasmids

[0068] The DNA molecule shown in Sequence 5 of the sequence listing was inserted into the pLB-simple vector to obtain the recombinant plasmid. This recombinant plasmid has been verified by sequencing. This plasmid is also named the heavy chain expression plasmid. In Sequence 5 of the sequence listing, nucleotides 1-891 are the promoter, nucleotides 892-2307 are the heavy chain coding region, and nucleotides 2308-2453 are the terminator. The DNA molecule shown in Sequence 5 of the sequence listing expresses the heavy chain shown in Sequence 4 of the sequence listing.

[0069] The DNA molecule shown in Sequence 7 of the sequence listing was inserted into the pLB-simple vector to obtain the recombinant plasmid. This recombinant plasmid has been verified by sequencing. This plasmid is also named the light chain expression plasmid. In Sequence 7 of the sequence listing, nucleotides 1-1037 are the promoter, nucleotides 1038-1739 are the light chain coding region, and nucleotides 1740-1887 are the terminator. The DNA molecule shown in Sequence 7 of the sequence listing expresses the light chain shown in Sequence 6 of the sequence listing.

[0070] pLB-simple Vector is a component of Tiangen Biotech's pLB zero-background rapid ligation kit (catalog number VT206), available at http: / / www.tiangen.com / ?productShow / t1 / 6 / id / 308.html.

[0071] II. Preparation of P36-5D2 antibody

[0072] 1. The heavy chain expression vector and the light chain expression vector were co-transfected into 293T cells, and then cultured in DMEM medium containing 2% fetal bovine serum for 72 h. After centrifugation at 4°C and 4000 rpm for 30 min, the supernatant was collected.

[0073] 2. Affinity chromatography

[0074] Affinity chromatography column specifications: length 3cm, inner diameter 1cm;

[0075] Affinity chromatography column packing material: protein A beads (Thermo, catalog number 10006D);

[0076] Perform the following steps in sequence: ① Load 300 mL of the supernatant obtained in step 1 onto an affinity chromatography column and incubate at 4 °C for 16 hours; ② Wash the column with 60 mL of binding buffer; ③ Elute the target protein with 30 mL of elution buffer and collect the post-column solution.

[0077] Binding buffer: Dissolve 112.6g of glycine and 175.2g of sodium chloride in water and bring the volume to 1L. Adjust the pH to 8.0 with sodium hydroxide.

[0078] Elution buffer: Dissolve 7.5g of glycine in water and bring the volume to 500mL. Adjust the pH to 3.0 with hydrochloric acid.

[0079] 3. Take the column pass solution obtained in step 2, concentrate it with an ultrafiltration concentrator and replace the system with PBS buffer (pH 7.2, 10mM) to obtain 1 mL of antibody solution with an antibody concentration of 2 mg / mL, which is called P36-5D2 antibody solution.

[0080] Example 3: Detection of the neutralizing activity of P36-5D2 antibody against novel coronavirus pseudovirus

[0081] The sources of the novel coronavirus membrane proteins are as follows:

[0082] Wild-type novel coronavirus (Genbank: MN908947.3);

[0083] The novel coronavirus Alpha strain (GISAID: EPI_ISL_601443) contains 9 mutations: 69-70del, 144del, N501Y, A570D, D614G, P681H, T716I, S982A, and D1118H; B.1.1.7;

[0084] The novel coronavirus Beta strain (GISAID: EPI_ISL_700450) contains 10 mutations: L18F, D80A, D215G, 242-244del, S305T, K417N, E484K, N510Y, D614G, A701V; B.1.351;

[0085] The novel coronavirus Gamma strain (GISAID: EPI_ISL_792681) contains 12 mutations: L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I, V1176F; P.1.

[0086] I. Preparation of Novel Coronavirus Pseudovirus

[0087] Co-transfection of 293T cells with a plasmid expressing the SARS-CoV-2 membrane protein and a backbone plasmid pNL4-3R-E-luciferase yielded an infectious but non-replicating pseudovirus of SARS-CoV-2, with infectivity similar to that of live SARS-CoV-2. The backbone plasmid pNL4-3R-E-luciferase, i.e., the backbone plasmid pNL4-3R-E containing Luciferase (i.e., vector with the luciferase gene containing backbone pNL4-3R-E in the literature): Wang Q, Liu L, Ren W, Gettie A, Wang H, Liang Q, Shi X, Montefiori DC, Zhou T, Zhang L. Cell Rep. 2019.

[0088] The gene encoding the novel coronavirus membrane protein was inserted between the BamHII and EcoRI restriction sites of the pcDNA3.1(+) vector to obtain a plasmid expressing the novel coronavirus membrane protein. The plasmid expressing the novel coronavirus membrane protein and the backbone plasmid pNL4-3R-E-luciferase were co-transfected into 293T cells and incubated at 37°C (using DMEM medium containing 10% fetal bovine serum). The cell culture supernatant was collected 60 hours after transfection; this was the viral solution containing the novel coronavirus pseudovirus.

[0089] In the wild-type novel coronavirus, the membrane protein is shown in Sequence 8 of the sequence listing. When the gene encoding the novel coronavirus membrane protein is shown in Sequence 9 of the sequence listing (encoding the protein shown in Sequence 8), the above steps are performed to obtain wild-type novel coronavirus pseudoviruses. Various mutations are then performed on Sequence 9 of the sequence listing (corresponding mutations for the novel coronavirus Alpha strain are shown in Table 1, for the novel coronavirus Beta strain in Table 2, and for the novel coronavirus Gamma strain in Table 3), and then used as the gene encoding the novel coronavirus membrane protein. The above steps are then performed to obtain novel coronavirus Alpha strain pseudoviruses, novel coronavirus Beta strain pseudoviruses, and novel coronavirus Gamma strain pseudoviruses, respectively.

[0090] Table 1

[0091] Protein mutation DNA mutation (corresponding to position of SEQ ID NO: 9) 69-70del (deletion of two amino acid residues "HV") Deletion of "CACGTG" at positions 205-210 144del (deletion of one amino acid residue "Y") Deletion of "TAT" at positions 430-432 N501Y (one amino acid residue mutation) "A" at position 1501 mutated to "T" A570D (one amino acid residue mutation) "C" at position 1709 mutated to "A" D614G (one amino acid residue mutation) "A" at position 1841 mutated to "G" P681H (one amino acid residue mutation) "C" at position 2042 mutated to "A" T716I (one amino acid residue mutation) "C" at position 2147 mutated to "T" S982A (one amino acid residue mutation) "AG" at positions 2944-2945 mutated to "GC" D1118H (one amino acid residue mutation) "G" at position 3352 mutated to "C"

[0092] Table 2

[0093] Protein mutation DNA mutation (corresponding to position of SEQ ID NO: 9) L18F (one amino acid residue mutation) "C" at position 52 mutated to "T" and "G" at position 54 mutated to "C" D80A (one amino acid residue mutation) "A" at position 239 mutated to "C" D215G (one amino acid residue mutation) "A" at position 644 mutated to "G" 242-244del (deletion of three amino acid residues) Deletion of "CTGGCCCTG" at positions 724-732 S305T (one amino acid residue mutation) "G" at position 914 mutated to "C" K417N (one amino acid residue mutation) "G" at position 1251 mutated to "C" E484K (one amino acid residue mutation) "G" at position 1450 mutated to "A" N501Y (one amino acid residue mutation) "A" at position 1501 mutated to "T" and "T" at position 1503 mutated to "C" D614G (one amino acid residue mutation) "A" at position 1841 mutated to "G" A701V (one amino acid residue mutation) "CC" at positions 2102-2103 mutated to "TG"

[0094] Table 3

[0095] Protein mutation DNA mutation (corresponding to position of SEQ ID NO: 9) L18F (one amino acid residue mutation) "C" at position 52 mutated to "T" and "G" at position 54 mutated to "C" T20N (one amino acid residue mutation) "C" at position 59 mutated to "A" P26S (one amino acid residue mutation) "CCT" at positions 76-78 mutated to "AGC" D138Y (one amino acid residue mutation) "G" at position 412 mutated to "T" R190S (one amino acid residue mutation) "A" at position 570 mutated to "C" K417T (one amino acid residue mutation) "AG" at positions 1250-1251 mutated to "CC" E484K (one amino acid residue mutation) "G" at position 1450 mutated to "A" N501Y (one amino acid residue mutation) "A" at position 1501 mutated to "T" D614G (a single amino acid residue mutation) The "A" at position 1841 mutates to "G". H655Y (a mutation involving one amino acid residue) The "C" at position 1963 mutated to "T". T1027I (a single amino acid residue mutation) The 3080th position "C" mutates to "T". V1176F (a single amino acid residue mutation) The "G" at position 3526 mutates to "T", and the "G" at position 3528 mutates to "C".

[0096] II. Detection of Neutralizing Activity of Monoclonal Antibodies

[0097] The test antibody was either P36-5D2 antibody (prepared in Example 2) or 2G4 antibody.

[0098] 1. The test antibody was diluted using DMEM medium containing 10% FBS to obtain a diluted solution.

[0099] 2. Mix 100 μl of the diluent obtained in step 1 with 50 μl of the virus solution prepared in step 2 (virus content of 100 TCID50), and incubate at 37°C for 1 hour. Set up a blank control by replacing 100 μl of the diluent with 100 μl of DMEM medium containing 10% FBS.

[0100] 3. After completing step 2, add 50 μl of hACE2-hela cell suspension (containing approximately 2 × 10⁻⁶ cells). 4 (1 cell), incubated at 37°C for 48 hours.

[0101] 4. After completing step 3, add 100 μl of PBS buffer and 50 μl of cell lysis buffer (Bright-Globe). TM The Luciferase Assay System (Promega, E2650) was used to incubate the sample for 2 minutes, and then the luciferase activity was detected using a chemiluminescence analyzer.

[0102] Three replicates were set for each treatment, and the average value of the results was taken.

[0103] Neutralization activity = (fluorescence intensity of blank control group - fluorescence intensity of experimental group with added diluent) / fluorescence intensity of blank control group × 100%.

[0104] The antibody concentration corresponding to a neutralizing activity of 50% is the IC50 value.

[0105] See results Figure 2 The P36-5D2 antibody exhibits strong neutralizing ability against both wild-type SARS-CoV-2 and naturally occurring variants. Its IC50 values ​​are 0.053 μg / ml against wild-type SARS-CoV-2, 0.025 μg / ml against the Alpha strain, 0.039 μg / ml against the Beta strain, and 0.032 μg / ml against the Gamma strain.

[0106] Example 4: Detection of the neutralizing activity of P36-5D2 antibody against live novel coronavirus virus

[0107] The experiment was conducted in the Biosafety Level 3 (BSL-3) laboratory at the National University of Singapore.

[0108] The tested viruses were: wild-type novel coronavirus (Genbank: MN908947.3), novel coronavirus Alpha strain (B.1.1.7; GH branch, ID: EPI_ISL_754083), and novel coronavirus Beta strain (B.1.351, GR branch, ID: EPI_ISL_1173248).

[0109] The test antibody was either P36-5D2 antibody (prepared in Example 2) or 2G4 antibody.

[0110] 1. Take a 96-well plate and add 1×10 to each well. 4 One Vero E6 cell was cultured overnight in DMEM medium containing 10% FBS.

[0111] 2. Take a 96-well plate and set up sample wells, cell control wells, and virus control wells.

[0112] For each sample well, add 100 μl of the test virus solution (50 PFU) and 50 μl of antibody diluent. The antibody diluent is obtained by diluting the test antibody with PBS buffer.

[0113] For the virus control wells, add 100 μl of the test virus solution (virus content of 50 PFU) and 50 μl of PBS buffer to each well.

[0114] Add 150 μl of PBS buffer to each cell control well.

[0115] Place the 96-well plate in an incubator at 37°C and incubate for 1 hour.

[0116] 3. After completing step 2, take samples from each well (150 μl per well) and add them to the 96-well plate after completing step 1 in a one-to-one correspondence, and incubate at 37°C for 1 hour.

[0117] 4. After completing step 3, discard the supernatant, wash with PBS buffer, discard the supernatant again, add 100 μl of upper layer culture medium to each well, and incubate at 37°C for 72 h. Preparation method of upper layer culture medium: Add microcrystalline cellulose to DMEM medium to a concentration of 1.2 g / 100 ml.

[0118] 5. After completing step 4, fix the cells overnight with 10% formalin fixative, and then counterstain with crystal violet. Calculate the number of plaques, calculate the neutralization percentage by comparing it with the number of plaques in the virus control wells, and calculate the antibody IC50 value using Graphpad.

[0119] See results Figure 3 The P36-5D2 antibody exhibits strong neutralizing ability against both wild-type SARS-CoV-2 and naturally occurring variants. Its IC50 values ​​are 0.060 μg / ml against wild-type SARS-CoV-2, 0.051 μg / ml against the Alpha strain, 0.039 μg / ml against the Beta strain, and 0.034 μg / ml against the Gamma strain.

[0120] Example 5: Protective effect of P36-5D2 antibody against novel coronavirus (animal experiment)

[0121] The experiment was conducted in a Biosafety Level 3 (BSL-3) laboratory at the National University of Singapore. The Animal Control and Use Committee (IACUC) approval number was R20-0504, and the standard operating procedures (SOPs) approved by the Biosafety Committee (IBC) and the Biosafety Committee (BBC) of the National University of Singapore Medical School were followed.

[0122] The experimental animals were 8-week-old female K18-hACE2 transgenic mice (background B6 mice), manufactured by InVivos Ptd, Singapore. Prior to the experiment, the mice were kept in a biosafety level 3 (ABSL-3) laboratory for 72 hours to acclimatize.

[0123] The tested viruses were: novel coronavirus Alpha strain (B.1.1.7; GH branch, ID: EPI_ISL_754083) and novel coronavirus Beta strain (B.1.351, GR branch, ID: EPI_ISL_1173248).

[0124] I. Weight and Survival Rate Statistics

[0125] Each tested virus was used to set up an experimental group and a control group, with 6 experimental animals in each group.

[0126] One day before the challenge: the experimental group animals were injected intraperitoneally with P36-5D2 antibody (prepared in Example 2) at a dose of 10 μg antibody / kg body weight; the control group animals were not treated in any way.

[0127] On the day of challenge: Both experimental and control animals were challenged with the test virus via nasal cavity, with each animal receiving a challenge dose of 10... 3 PFU test virus (total volume 25 μl, diluted with PBS buffer).

[0128] The animals were weighed before challenge as baseline weight, and their weight was measured daily after challenge. Weight changes are shown in [see attached table]. Figure 4 .

[0129] After the virus challenge, the survival rate of each group was calculated daily. The survival rate results are shown below. Figure 5 .

[0130] II. Viral load and pathological testing

[0131] For each type of virus tested, an experimental group and a control group were set up, with 5-7 experimental animals in each group.

[0132] One day before the challenge: the experimental group animals were injected intraperitoneally with P36-5D2 antibody (prepared in Example 2) at a dose of 10 μg antibody / kg body weight; the control group animals were not treated in any way.

[0133] On the day of challenge: Both experimental and control animals were challenged with the test virus via nasal cavity, with each animal receiving a challenge dose of 10... 3 PFU test virus (total volume 25 μl, diluted with PBS buffer).

[0134] Four days after the animal was challenged with the virus, it was euthanized.

[0135] Lung and brain tissues were obtained from the experimental animals. First, the tissues were homogenized, and the supernatant was collected, diluted, and added to 12-well plates containing Vero E6 cells. The cells were incubated at 37°C for 1 hour. Then, the supernatant was discarded, and the cells were washed with PBS buffer, followed by another discarding of the supernatant. Next, upper layer culture medium (prepared by adding microcrystalline cellulose to DMEM medium to a concentration of 1.2 g / 100 ml) was added, and the cells were incubated at 37°C for 72 hours. The cells were then fixed overnight with 10% formalin fixative, counterstained with crystal violet, and the number of plaques was calculated. The viral titer for each sample was expressed as the logarithm of plaque-forming units (PFU) per organ. Results are shown below. Figure 6 .

[0136] The left lung lobe of the experimental animal was obtained, paraffin sections were prepared, and then hematoxylin-eosin staining was performed. Results are shown below. Figure 7 .

[0137] The results of this embodiment show that the P36-5D2 antibody enabled mice challenged with SARS-CoV-2 Alpha or Beta strains to survive completely, with almost undetectable viral load in lung and brain tissues and no severe lung inflammation, thus providing good protection in vivo.

[0138] The preparation method of the 2G4 antibody used in the examples is basically the same as that of the P36-5D2 antibody, with the only difference being the heavy chain variable region and its coding sequence, as well as the light chain variable region and its coding sequence. The coding sequence of the heavy chain variable region of the 2G4 antibody is shown in Sequence 10 of the sequence listing, and the coding sequence of the light chain variable region of the 2G4 antibody is shown in Sequence 11 of the sequence listing. The 2G4 antibody is described in the following literature: Saphire EO, Schendel SL, Gunn BM, Milligan JC, Alter G. Antibody-mediated protection against Ebola virus. Nat Immunol 19, 1169-1178 (2018).

[0139] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Tsinghua University <120> A broad-spectrum neutralizing antibody P36-5D2 against SARS-CoV-2 and its application <130> CGGNQYX-216131 <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1269 <212> PRT <213> Artificial Sequence <400> 1 Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val 1 5 10 15 Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe 20 25 30 Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu 35 40 45 His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp 50 55 60 Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp 65 70 75 80 Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu 85 90 95 Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser 100 105 110 Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile 115 120 125 Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr 130 135 140 Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr 145 150 155 160 Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu 165 170 175 Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe 180 185 190 Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr 195 200 205 Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu 210 215 220 Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr 225 230 235 240 Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser 245 250 255 Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro 260 265 270 Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala 275 280 285 Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys 290 295 300 Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val 305 310 315 320 Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys 325 330 335 Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala 340 345 350 Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu 355 360 365 Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro 370 375 380 Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe 385 390 395 400 Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly 405 410 415 Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys 420 425 430 Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn 435 440 445 Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe 450 455 460 Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys 465 470 475 480 Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly 485 490 495 Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val 500 505 510 Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys 515 520 525 Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn 530 535 540 Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu 545 550 555 560 Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val 565 570 575 Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe 580 585 590 Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val 595 600 605 Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile 610 615 620 His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser 625 630 635 640 Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val 645 650 655 Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala 660 665 670 Ser Tyr Gln Thr Gln Thr Asn Ser Pro Gly Ser Ala Ser Ser Val Ala 675 680 685 Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser 690 695 700 Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile 705 710 715 720 Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val 725 730 735 Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu 740 745 750 Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr 755 760 765 Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln 770 775 780 Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe 785 790 795 800 Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser 805 810 815 Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly 820 825 830 Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp 835 840 845 Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu 850 855 860 Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly 865 870 875 880 Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile 885 890 895 Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr 900 905 910 Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn 915 920 925 Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser Ala 930 935 940 Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn 945 950 955 960 Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val 965 970 975 Leu Asn Asp Ile Leu Ser Arg Leu Asp Pro Pro Glu Ala Glu Val Gln 980 985 990 Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val 995 1000 1005 Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn Leu 1010 1015 1020 Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys Arg Val 1025 1030 1035 1040 Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro Gln Ser Ala 1045 1050 1055 Pro His Gly Val Val Phe Leu His Val Thr Tyr Val Pro Ala Gln Glu 1060 1065 1070 Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His Asp Gly Lys Ala His 1075 1080 1085 Phe Pro Arg Glu Gly Val Phe Val Ser Asn Gly Thr His Trp Phe Val 1090 1095 1100 Thr Gln Arg Asn Phe Tyr Glu Pro Gln Ile Ile Thr Thr Asp Asn Thr 1105 1110 1115 1120 Phe Val Ser Gly Asn Cys Asp Val Val Ile Gly Ile Val Asn Asn Thr 1125 1130 1135 Val Tyr Asp Pro Leu Gln Pro Glu Leu Asp Ser Phe Lys Glu Glu Leu 1140 1145 1150 Asp Lys Tyr Phe Lys Asn His Thr Ser Pro Asp Val Asp Leu Gly Asp 1155 1160 1165 Ile Ser Gly Ile Asn Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp 1170 1175 1180 Arg Leu Asn Glu Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu 1185 1190 1195 1200 Gln Glu Leu Gly Lys Tyr Glu Gln Tyr Ile Lys Leu Glu Val Leu Phe 1205 1210 1215 Gln Gly Pro Gly Gly Gly Ser Gly Gly Gly Ser Gly Tyr Ile Pro Glu 1220 1225 1230 Ala Pro Arg Asp Gly Gln Ala Tyr Val Arg Lys Asp Gly Glu Trp Val 1235 1240 1245 Leu Leu Ser Thr Phe Leu Gly Trp Ser His Pro Gln Phe Glu Lys His 1250 1255 1260 His His His His His 1265 <210> 2 <211> 3810 <212> DNA <213> Artificial Sequence <400> 2 atgttcgtgt tcctggtgct gctgcctctg gtgagcagcc agtgcgtgaa tctgaccacc 60 agaacccagc tgcctcctgc ctacaccaat agcttcacca gaggagttta ttatcccgat 120 aaggtgttca gaagtagtgt attacatagt acccaggacc tgttcctacc tttcttcagt 180 aacgtgacct ggttccacgc catccacgtg agcggcacca atggcaccaa gagattcgac 240 aatcctgtgc tgcctttcaa tgacggcgtg tacttcgcca gcaccgagaa gagcaatatc 300 atcagaggct ggatcttcgg caccaccttg gattccaaga ctcagagcct gctgattgta 360 aacaacgcta caaatgtggt gatcaaggtg tgcgagttcc agttctgcaa tgaccctttc 420 ctgggtgttt attatcataa gaacaacaag agctggatgg agagcgagtt ccgcgtatat 480 tcgtcggcta ataattgcac cttcgagtac gtgagccagc ctttcctgat ggacctggag 540 ggcaagcagg gcaatttcaa gaatctgaga gagttcgtgt tcaagaatat cgacggctac 600 ttcaagatct acagcaagca cacacccatt aatctggtga gagacctgcc tcagggcttc 660 agcgccctgg agcctctggt ggacctgcct atcggcatca atatcaccag attccagacc 720 ctgctggccc tgcacagatc atatcttaca ccaggcgatt cgtcaagcgg ttggaccgct 780 ggagctgcgg catattacgt gggctacctg cagcctagaa ccttcctgct gaagtacaat 840 gagaatggta cgataaccga cgcagttgat tgtgccctgg accctctgag cgagaccaag 900 tgcaccctga agagcttcac cgtggagaag ggcatctacc agaccagcaa tttcagagtg 960 cagcctaccg agagcatcgt gagattccct aatatcacca atctgtgccc tttcggcgag 1020 gtgttcaatg ccaccagatt cgccagcgtg tacgcatgga accgcaagcg gataagcaat 1080 tgcgtggccg actacagcgt gctgtacaat agcgccagct tcagcacctt caaatgttat 1140 ggtgtttcgc caacaaagct gaatgacctg tgcttcacca atgtgtacgc cgacagcttc 1200 gtgatcagag gcgacgaggt gagacagatc gcgccagggc agaccggcaa gatcgccgac 1260 tacaattaca agctgcctga cgacttcacc ggctgcgtga tcgcgtggaa ctctaacaat 1320 ctagattcga aagttggagg caattacaat tacctgtaca gactgttcag aaagagcaat 1380 ctgaagcctt tcgagagaga catcagcacc gagatctacc aggccggcag cacaccgtgt 1440 aatggcgtgg agggcttcaa ttgctacttc cctctgcaga gctacggctt ccagcctacc 1500 aatggcgtgg gctaccagcc ttacagagtg gtggtgctga gcttcgagct gctgcacgct 1560 cccgctaccg tgtgcggccc taagaagc accaatctgg tgaagaataa gtgcgtgaat 1620 ttcaatttca atggtctaac tggaacgggc gtgctgaccg agagcaataa gaagtttctt 1680 ccctttcaac aattcggcag agacatcgcc gacaccacag atgctgtaag agaccctcag 1740 accctggaga tcctggacat cactccgtgt agcttcggcg gcgtgagcgt gatcacaccg 1800 ggtaccaata ccagcaatca ggtggccgtg ctgtaccagg acgtgaattg caccgaggtg 1860 cctgtggcca tccacgccga ccagctgact cccacttgga gggtatattc cacgggaagc 1920 aatgtgttcc agaccagagc cggctgcctg atcggcgccg agcacgtgaa taatagctac 1980 gagtgcgaca tccctatcgg cgccggcatc tgcgccagct accagaccca gaccaatagc 2040 cctggaagcg caagcagcgt ggccagccag agcatcatcg cctacacat gagcctgggc 2100 gccgagaata gcgtggccta cagcaataat agcatcgcca tccctaccaa tttcaccatc 2160 agcgtgacca ccgaaatatt accagtctcc atgaccaaga ccagcgtgga ctgcaccatg 2220 tacatctgcg gcgacagcac cgagtgcagc aatctgctgc tgcagtacgg cagcttctgc 2280 acccagctga atagagccct gaccggcatc gccgtggagc aggacaagaa tacccaggag 2340 gtgttcgccc aggtgaagca gatctacaag actccgccga tcaaggactt cggcggcttc 2400 aatttcagcc aaatactccc agatccaagc aagcctagca agaggagctt catcgaggac 2460 ctgctgttca ataaggtgac cctggccgac gccggcttca tcaagcagta cggcgactgc 2520 ctaggtgata ttgcggcaag agacctgatc tgcgcccaga agtttaacgg tttgacagta 2580 ctacctcctc tgctgaccga cgagatgata gcacaatata cgtcggcatt gctcgctggc 2640 acgatcacat cgggctggac ttcggcgcc ggagcagcgt tgcaaatccc ttcgccatg 2700 cagatggcct acagattcaa tggcatcggc gtgacccaga atgtgctgta cgagaatcag 2760 aagctgatcg ccaatcagtt caatagcgcc atcggcaaga tccaggacag cctgagcagc 2820 accgccagcg ccctgggcaa gctgcaggac gtggtgaatc agaatgccca ggccctgaat 2880 accctggtga agcagctgag cagcaatttc ggcgccatca gtagtgtact caacgatatc 2940 ctgagcagac tggacccgcc ggaggccgag gtgcaaattg atcgtcttat tactggcaga 3000 ctgcagagcc tgcagaccta cgtgacccag cagctgatca gagccgccga gatcagagcc 3060 agcgccaatc tggccgccac cagatgagc gagtgcgtgc tgggccag cagagagtg 3120 gacttctgcg gcaagggcta ccacctgatg agctccctc agagcgctcc acatggcgtg 3180 gtgttcctgc acgtgaccta cgtgcctgcc caggagaga atttcaccac cgcacccgca 3240 atctgccacg acggcaggc ccactccct agagaggggcg tgttcgtgag caatggcacc 3300 cactggttcg tgacccagag aaatttctac gagcctcaga tcatcaccac cgacaatacc 3360 ttcgtgagcg gcaatgcga cgtggtgatc gggatagtca atatactgt ctacgaccct 3420 ctgcagcctg agctggacag cttcaggag gagctggaca agtactca gatcacacc 3480 agccctgacg tggacctcgg tgatatttcg ggaatcaatg ccagcgtggt gatatccag 3540 aaggaaattg atcggctca cgaagtggcc aagaatctctga atgagagcct gatcgacctg 3600 caggagctgg gcaagtacga gcagtacatc aagctggaag ttctgttcca ggggcccgga 3660 ggaggaagtg gaggaggaag tggctatatt ccggaagcgc cgcgcgatgg ccaggcgtat 3720 gtgcgcaaag atggcgaatg ggtgctgctg agcacctttc tgggctggtc ccaccctcag 3780 ttcgagaagc accaccaccaccaccactga 3810 <210> 3 <211> 1211 <212> PRT <213> SARS‐CoV‐2 <400> 3 Met Phe Val Phe Leu Val Leu Pro Leu Val Ser Ser Gln Cys Val 1 5 10 15 Asn Leu Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe 20 25 30 Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu 35 40 45 His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp 50 55 60 Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp 65 70 75 80 Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu 85 90 95 Lys Ser Asn Ile Ile Arg Gly TRP Ile Phe Gly Thr Thr Leu Asp Ser 100 105 110 Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile 115 120 125 Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr 130 135 140 Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr 145 150 155 160 Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu 165 170 175 Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe 180 185 190 Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr 195 200 205 Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu 210 215 220 Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr 225 230 235 240 Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser 245 250 255 Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro 260 265 270 Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala 275 280 285 Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys 290 295 300 Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val 305 310 315 320 Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys 325 330 335 Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala 340 345 350 Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu 355 360 365 Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro 370 375 380 Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe 385 390 395 400 Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly 405 410 415 Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys 420 425 430 Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn 435 440 445 Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe 450 455 460 Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys 465 470 475 480 Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly 485 490 495 Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val 500 505 510 Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys 515 520 525 Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn 530 535 540 Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu 545 550 555 560 Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val 565 570 575 Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe 580 585 590 Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val 595 600 605 Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile 610 615 620 His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser 625 630 635 640 Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val 645 650 655 Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala 660 665 670 Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg Lys Arg Ser Val Ala 675 680 685 Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser 690 695 700 Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile 705 710 715 720 Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val 725 730 735 Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu 740 745 750 Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr 755 760 765 Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln 770 775 780 Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe 785 790 795 800 Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser 805 810 815 Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly 820 825 830 Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp 835 840 845 Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu 850 855 860 Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly 865 870 875 880 Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile 885 890 895 Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr 900 905 910 Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn 915 920 925 Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser Ala 930 935 940 Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn 945 950 955 960 Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val 965 970 975 Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala Glu Val Gln 980 985 990 Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val 995 1000 1005 Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn Leu 1010 1015 1020 Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys Arg Val 1025 1030 1035 1040 Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro Gln Ser Ala 1045 1050 1055 Pro His Gly Val Val Phe Leu His Val Thr Tyr Val Pro Ala Gln Glu 1060 1065 1070 Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His Asp Gly Lys Ala His 1075 1080 1085 Phe Pro Arg Glu Gly Val Phe Val Ser Asn Gly Thr His Trp Phe Val 1090 1095 1100 Thr Gln Arg Asn Phe Tyr Glu Pro Gln Ile Ile Thr Thr Asp Asn Thr 1105 1110 1115 1120 Phe Val Ser Gly Asn Cys Asp Val Val Ile Gly Ile Val Asn Asn Thr 1125 1130 1135 Val Tyr Asp Pro Leu Gln Pro Glu Leu Asp Ser Phe Lys Glu Glu Leu 1140 1145 1150 Asp Lys Tyr Phe Lys Asn His Thr Ser Pro Asp Val Asp Leu Gly Asp 1155 1160 1165 Ile Ser Gly Ile Asn Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp 1170 1175 1180 Arg Leu Asn Glu Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu 1185 1190 1195 1200 Gln Glu Leu Gly Lys Tyr Glu Gln Tyr Ile Lys 1205 1210 <210> 4 <211> 471 <212> PRT <213> Artificial Sequence <400> 4 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 20 25 30 Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Thr Tyr Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu 50 55 60 Glu Trp Met Gly Trp Ile Asn Ala Gly Asn Gly Asn Thr Lys Tyr Ser 65 70 75 80 Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Arg Asp Thr Ser Ala Ser 85 90 95 Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Gly Gly Gly Gly Arg Arg Leu Gln Phe Asp Tyr Phe 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr 130 135 140 Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser 145 150 155 160 Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu 165 170 175 Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His 180 185 190 Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser 195 200 205 Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys 210 215 220 Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu 225 230 235 240 Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro 245 250 255 Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 260 265 270 Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val 275 280 285 Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp 290 295 300 Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr 305 310 315 320 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp 325 330 335 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu 340 345 350 Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 355 360 365 Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys 370 375 380 Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 385 390 395 400 Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys 405 410 415 Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 420 425 430 Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser 435 440 445 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser 450 455 460 Leu Ser Leu Ser Pro Gly Lys 465 470 <210> 5 <211> 2453 <212> DNA <213> Artificial Sequence <400> 5 atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc ccacttggca 60 gtacatcaag tgtatcatat gccaagtacg ccccctattg acgtcaatga cggtaaatgg 120 cccgcctggc attatgccca gtacatgacc ttatgggact ttcctacttg gcagtacatc 180 tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacat caatgggcgt 240 ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt caatgggagt 300 ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaacaactc cgccccattg 360 acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc tcgtttagtg 420 aaccgtcaga tcgcctggag acgccatcca cgctgttttg acctccatag aagacaccgg 480 gaccgatcca gcctccatcg gctcgcatct ctccttcacg cgcccgccgc cctacctgag 540 gccgccatcc acgccggttg agtcgcgttc tgccgcctcc cgcctgtggt gcctcctgaa 600 ctgcgtccgc cgtctaggta agtttaaagc tcaggtcgag accgggcctt tgtccggcgc 660 tcccttggag cctacctaga ctcagccggc tctccacgct ttgcctgacc ctgcttgctc 720 aactctagtt aacggtggag ggcagtgtag tctgagcagt actcgttgct gccgcgcgcg 780 ccaccagaca taatagctga cagaccaca gactgttcct ttccatgggt cttttctgca 840 gtcaccgtcc tcgacacgtg tgatcagata tcgcggccgc tctagaccac catgggatgg 900 tcatgtatca tccttttct agtagcaact gcaaccggtg tacattccca ggtccagctt 960 gtgcagtctg gggctgaggt gaaagcct ggggcctcag tgaaggtttc ctgcaaggct 1020 tctggataca ccttcactac ctatgctatg cattgggtgc gccaggcccc cggacaaagg 1080 cttgagtgga tgggatggat caacgctggc aatggtaaca caaaatattc agaagttc 1140 cagggcagag tcaccattac caggagacaca tccgcgagca cagcctacat ggagctgagc 1200 agcctgagat ctgaagacac ggctgtgtat tactgtgcgg gaggggggg taggcggcta 1260 caatttgatt actttgacta ctggggccag ggaaccctgg tcaccgtctc ctcagcgtcg 1320 accaagggcc catcggtctt ccccctggca ccctcctcca agagcacctc tggggcaca 1380 gcggccctgg gctgcctggt caaggactac ttccccgaac ctgtgacggt ctcgtggaac 1440 tcaggcgcc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 1500 tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcaccca gacctacatc 1560 tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agagagttga gcccaaatct 1620 tgtgacaaaa ctcacacatg cccaccgtgc ccagcacctg aactcctggg gggaccgtca 1680 gtttctctct tccccccaaa acccaaggac accctcatga tctcccggac ccctgaggtc 1740 acatgcgtgg tggtggacgt gagccacgaa gaccctgagg tcaagttcaa ctggtacgtg 1800 gacggcgtgg aggtgcataa tgccaagaca aagccgcggg aggagcagta caacagcacg 1860 taccgtgtgg tcagcgtcct caccgtcctg caccaggact ggctgaatgg caaggagtac 1920 aagtgcaagg tctccaacaa agccctccca gcccccatcg agaaaaccat ctccaaagcc 1980 aaagggcagc cccgagaacc acaggtgtac accctgcccc catcccggga ggagatgacc 2040 aagaaccagg tcagcctgac ctgcctggtc aaaggcttct atcccagcga catcgccgtg 2100 gagtgggaga gcaatgggca gccggagaac aactacaaga ccacgcctcc cgtgctggac 2160 tccgacggct ccttcttcct ctatagcaag ctcaccgtgg acaagagcag gtggcagcag 2220 gggaacgtct tctcatgctc cgtgatgcat gaggctctgc acaaccacta cacgcagaag 2280 agcctctccc tgtccccggg taaatgaaag cttggccgcc atggcccaac ttgtttattg 2340 cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt 2400 tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat cat 2453 <210> 6 <211> 233 <212> PRT <213> Artificial Sequence <400> 6 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala 20 25 30 Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile 35 40 45 Ser Ser Trp Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys 50 55 60 Leu Leu Ile Tyr Asp Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg 65 70 75 80 Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser 85 90 95 Leu Gln Pro Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Gly 100 105 110 Tyr Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 115 120 125 Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 130 135 140 Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 145 150 155 160 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly 165 170 175 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 180 185 190 Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His 195 200 205 Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val 210 215 220 Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 <210> 7 <211> 1887 <212> DNA <213> Artificial Sequence <400> 7 agtaatcaat tacggggtca ttagttcata gcccatatat ggagttccgc gttacataac 60 ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa 120 tgacgtatgt tcccatagta acgccaatag ggactttcca ttgacgtcaa tgggtggagt 180 atttacggta aactgcccac ttggcagtac atcaagtgta tcatatgcca agtacgcccc 240 ctattgacgt caatgacggt aaatggcccg cctggcatta tgcccagtac atgaccttat 300 gggactttcc tacttggcag tacatctacg tattagtcat cgctattacc atggtgatgc 360 ggttttggca gtacatcaat gggcgtggat agcggtttga ctcacgggga tttccaagtc 420 tccaccccat tgacgtcaat gggagtttgt tttggcacca aaatcaacgg gactttccaa 480 aatgtcgtaa caactccgcc ccattgacgc aaatgggcgg taggcgtgta cggtgggagg 540 tctatataag cagagctcgt ttagtgaacc gtcagatcgc ctggagacgc catccacgct 600 gttttgacct ccatagaaga caccgggacc gatccagcct ccatcggctc gcatctctcc 660 ttcacgcgcc cgccgcccta cctgaggccg ccatccacgc cggttgagtc gcgttctgcc 720 gcctcccgcc tgtggtgcct cctgaactgc gtccgccgtc taggtaagtt taaagctcag 780 gtcgagaccg ggcctttgtc cggcgctccc ttggagccta cctagactca gccggctctc 840 cacgctttgc ctgaccctgc ttgctcaact ctagttaacg gtggagggca gtgtagtctg 900 agcagtactc gttgctgccg cgcgcgccac cagacataat agctgacaga ctaacagact 960 gttcctttcc atgggtcttt tctgcagtca ccgtcgtcga cacgtgtgat cagatatcgc 1020 ggccgctcta gaccaccatg ggatggtcat gtatcatcct ttttctagta gcaactgcaa 1080 ccggtgtaca ttcagacatc cagatgaccc agtctccttc caccctgtct gcatctgtag gagacagagt caccatcact tgccgggcca gtcagagtat tagtagctgg ttggcctggt atcagcaga accagggaa gcccctaagc tcctgatcta tgatgcctcc agtttggaaa gtggggtccc atctaggttc agcggcagtg gatctgggac agaattcact ctcaccatca 1320. gcagcctgca gcctgatgat tttgcaactt attactgcca acagtataat ggttacccgt 1380 1440. ggacgttcgg ccaagggacc aaggtggaa tcaaacgtac ggtggctgca ccatctgtct tcatcttccc gccatctgat gagcagttga aatctggaac tgcctctgtt gtgtgcctgc tgaataactt ctatcccaga gaggccaaag tacagtggaa ggtggataac gccctccaat cgggtaactc ccaggagagt gtcacagagc aggacagcaa ggacagcacc tacagcctca gcagcaccct gacgctgagc aaagcagact acgagaaaca caaagtctac gcctgcgaag tcacccatca gggcctgagc tcgcccgtca caaagagctt caacagggga gagtgttaga 1740. agcttggccg ccatggccca acttgtttat tgcagcttat aatggttaca aataagcaa tagcatcaca aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc 1860 caaactcatc aatgtatctt atcatgt 1887 <210> 8 <211> 1273 <212> PRT <213> SARS‑CoV‑2 <400> 8 Met Phe Val Phe Leu Val Leu Leu Pro Leu Val Ser Ser Gln Cys Val 1 5 10 15 Asn Leu Thr Thr Arg Thr Gln Leu Pro Pro Ala Tyr Thr Asn Ser Phe 20 25 30 Thr Arg Gly Val Tyr Tyr Pro Asp Lys Val Phe Arg Ser Ser Val Leu 35 40 45 His Ser Thr Gln Asp Leu Phe Leu Pro Phe Phe Ser Asn Val Thr Trp 50 55 60 Phe His Ala Ile His Val Ser Gly Thr Asn Gly Thr Lys Arg Phe Asp 65 70 75 80 Asn Pro Val Leu Pro Phe Asn Asp Gly Val Tyr Phe Ala Ser Thr Glu 85 90 95 Lys Ser Asn Ile Ile Arg Gly Trp Ile Phe Gly Thr Thr Leu Asp Ser 100 105 110 Lys Thr Gln Ser Leu Leu Ile Val Asn Asn Ala Thr Asn Val Val Ile 115 120 125 Lys Val Cys Glu Phe Gln Phe Cys Asn Asp Pro Phe Leu Gly Val Tyr 130 135 140 Tyr His Lys Asn Asn Lys Ser Trp Met Glu Ser Glu Phe Arg Val Tyr 145 150 155 160 Ser Ser Ala Asn Asn Cys Thr Phe Glu Tyr Val Ser Gln Pro Phe Leu 165 170 175 Met Asp Leu Glu Gly Lys Gln Gly Asn Phe Lys Asn Leu Arg Glu Phe 180 185 190 Val Phe Lys Asn Ile Asp Gly Tyr Phe Lys Ile Tyr Ser Lys His Thr 195 200 205 Pro Ile Asn Leu Val Arg Asp Leu Pro Gln Gly Phe Ser Ala Leu Glu 210 215 220 Pro Leu Val Asp Leu Pro Ile Gly Ile Asn Ile Thr Arg Phe Gln Thr 225 230 235 240 Leu Leu Ala Leu His Arg Ser Tyr Leu Thr Pro Gly Asp Ser Ser Ser 245 250 255 Gly Trp Thr Ala Gly Ala Ala Ala Tyr Tyr Val Gly Tyr Leu Gln Pro 260 265 270 Arg Thr Phe Leu Leu Lys Tyr Asn Glu Asn Gly Thr Ile Thr Asp Ala 275 280 285 Val Asp Cys Ala Leu Asp Pro Leu Ser Glu Thr Lys Cys Thr Leu Lys 290 295 300 Ser Phe Thr Val Glu Lys Gly Ile Tyr Gln Thr Ser Asn Phe Arg Val 305 310 315 320 Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn Leu Cys 325 330 335 Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val Tyr Ala 340 345 350 Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser Val Leu 355 360 365 Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val Ser Pro 370 375 380 Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp Ser Phe 385 390 395 400 Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln Thr Gly 405 410 415 Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr Gly Cys 420 425 430 Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly Gly Asn 435 440 445 Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro Phe 450 455 460 Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr Pro Cys 465 470 475 480 Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser Tyr Gly 485 490 495 Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val Val Val 500 505 510 Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly Pro Lys 515 520 525 Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Asn Phe Asn 530 535 540 Gly Leu Thr Gly Thr Gly Val Leu Thr Glu Ser Asn Lys Lys Phe Leu 545 550 555 560 Pro Phe Gln Gln Phe Gly Arg Asp Ile Ala Asp Thr Thr Asp Ala Val 565 570 575 Arg Asp Pro Gln Thr Leu Glu Ile Leu Asp Ile Thr Pro Cys Ser Phe 580 585 590 Gly Gly Val Ser Val Ile Thr Pro Gly Thr Asn Thr Ser Asn Gln Val 595 600 605 Ala Val Leu Tyr Gln Asp Val Asn Cys Thr Glu Val Pro Val Ala Ile 610 615 620 His Ala Asp Gln Leu Thr Pro Thr Trp Arg Val Tyr Ser Thr Gly Ser 625 630 635 640 Asn Val Phe Gln Thr Arg Ala Gly Cys Leu Ile Gly Ala Glu His Val 645 650 655 Asn Asn Ser Tyr Glu Cys Asp Ile Pro Ile Gly Ala Gly Ile Cys Ala 660 665 670 Ser Tyr Gln Thr Gln Thr Asn Ser Pro Arg Arg Ala Arg Ser Val Ala 675 680 685 Ser Gln Ser Ile Ile Ala Tyr Thr Met Ser Leu Gly Ala Glu Asn Ser 690 695 700 Val Ala Tyr Ser Asn Asn Ser Ile Ala Ile Pro Thr Asn Phe Thr Ile 705 710 715 720 Ser Val Thr Thr Glu Ile Leu Pro Val Ser Met Thr Lys Thr Ser Val 725 730 735 Asp Cys Thr Met Tyr Ile Cys Gly Asp Ser Thr Glu Cys Ser Asn Leu 740 745 750 Leu Leu Gln Tyr Gly Ser Phe Cys Thr Gln Leu Asn Arg Ala Leu Thr 755 760 765 Gly Ile Ala Val Glu Gln Asp Lys Asn Thr Gln Glu Val Phe Ala Gln 770 775 780 Val Lys Gln Ile Tyr Lys Thr Pro Pro Ile Lys Asp Phe Gly Gly Phe 785 790 795 800 Asn Phe Ser Gln Ile Leu Pro Asp Pro Ser Lys Pro Ser Lys Arg Ser 805 810 815 Phe Ile Glu Asp Leu Leu Phe Asn Lys Val Thr Leu Ala Asp Ala Gly 820 825 830 Phe Ile Lys Gln Tyr Gly Asp Cys Leu Gly Asp Ile Ala Ala Arg Asp 835 840 845 Leu Ile Cys Ala Gln Lys Phe Asn Gly Leu Thr Val Leu Pro Pro Leu 850 855 860 Leu Thr Asp Glu Met Ile Ala Gln Tyr Thr Ser Ala Leu Leu Ala Gly 865 870 875 880 Thr Ile Thr Ser Gly Trp Thr Phe Gly Ala Gly Ala Ala Leu Gln Ile 885 890 895 Pro Phe Ala Met Gln Met Ala Tyr Arg Phe Asn Gly Ile Gly Val Thr 900 905 910 Gln Asn Val Leu Tyr Glu Asn Gln Lys Leu Ile Ala Asn Gln Phe Asn 915 920 925 Ser Ala Ile Gly Lys Ile Gln Asp Ser Leu Ser Ser Thr Ala Ser Ala 930 935 940 Leu Gly Lys Leu Gln Asp Val Val Asn Gln Asn Ala Gln Ala Leu Asn 945 950 955 960 Thr Leu Val Lys Gln Leu Ser Ser Asn Phe Gly Ala Ile Ser Ser Val 965 970 975 Leu Asn Asp Ile Leu Ser Arg Leu Asp Lys Val Glu Ala Glu Val Gln 980 985 990 Ile Asp Arg Leu Ile Thr Gly Arg Leu Gln Ser Leu Gln Thr Tyr Val 995 1000 1005 Thr Gln Gln Leu Ile Arg Ala Ala Glu Ile Arg Ala Ser Ala Asn Leu 1010 1015 1020 Ala Ala Thr Lys Met Ser Glu Cys Val Leu Gly Gln Ser Lys Arg Val 1025 1030 1035 1040 Asp Phe Cys Gly Lys Gly Tyr His Leu Met Ser Phe Pro Gln Ser Ala 1045 1050 1055 Pro His Gly Val Val Phe Leu His Val Thr Tyr Val Pro Ala Gln Glu 1060 1065 1070 Lys Asn Phe Thr Thr Ala Pro Ala Ile Cys His Asp Gly Lys Ala His 1075 1080 1085 Phe Pro Arg Glu Gly Val Phe Val Ser Asn Gly Thr His Trp Phe Val 1090 1095 1100 Thr Gln Arg Asn Phe Tyr Glu Pro Gln Ile Ile Thr Thr Asp Asn Thr 1105 1110 1115 1120 Phe Val Ser Gly Asn Cys Asp Val Val Ile Gly Ile Val Asn Asn Thr 1125 1130 1135 Val Tyr Asp Pro Leu Gln Pro Glu Leu Asp Ser Phe Lys Glu Glu Leu 1140 1145 1150 Asp Lys Tyr Phe Lys Asn His Thr Ser Pro Asp Val Asp Leu Gly Asp 1155 1160 1165 Ile Ser Gly Ile Asn Ala Ser Val Val Asn Ile Gln Lys Glu Ile Asp 1170 1175 1180 Arg Leu Asn Glu Val Ala Lys Asn Leu Asn Glu Ser Leu Ile Asp Leu 1185 1190 1195 1200 Gln Glu Leu Gly Lys Tyr Glu Gln Tyr Ile Lys Trp Pro Trp Tyr Ile 1205 1210 1215 Trp Leu Gly Phe Ile Ala Gly Leu Ile Ala Ile Val Met Val Thr Ile 1220 1225 1230 Met Leu Cys Cys Met Thr Ser Cys Cys Ser Cys Leu Lys Gly Cys Cys 1235 1240 1245 Ser Cys Gly Ser Cys Cys Lys Phe Asp Glu Asp Asp Ser Glu Pro Val 1250 1255 1260 Leu Lys Gly Val Lys Leu His Tyr Thr 1265 1270 <210> 9 <211> 3822 <212> DNA <213> Artificial Sequence <400> 9 atgttcgtgt tcctggtgct gctgcctctg gtgagcagcc agtgcgtgaa tctgaccacc 60 agaacccagc tgcctcctgc ctacaccaat agcttcacca gaggagttta ttatcccgat 120 aaggtgttca gaagtagtgt attacatagt acccaggacc tgttcctacc tttcttcagt 180​​​aatcctgtgc tgcctttcaa tgacggcgtg tacttcgcca gcaccgagaa gagcaatatc 300 atcagaggct ggatcttcgg caccaccttg gattccaaga ctcagagcct gctgattgta 360 aacaacgcta caaatgtggt gatcaaggtg tgcgagttcc agttctgcaa tgaccctttc 420 ctgggtgttt attatcataa gaacaacaag agctggatgg agagcgagtt ccgcgtatat 480 tcgtcggcta ataattgcac cttcgagtac gtgagccagc ctttcctgat ggacctggag 540 ggcaagcagg gcaatttcaa gaatctgaga gagttcgtgt tcaagaatat cgacggctac 600 ttcaagatct acagcaagca cacacccatt aatctggtga gagacctgcc tcagggcttc 660 agcgccctgg agcctctggt ggacctgcct atcggcatca atatcaccag attccagacc 720 ctgctggccc tgcacagatc atatcttaca ccaggcgatt cgtcaagcgg ttggaccgct 780 ggagctgcgg catattacgt gggctacctg cagcctagaa ccttcctgct gaagtacaat 840 gagaatggta cgataaccga cgcagttgat tgtgccctgg accctctgag cgagaccaag 900 tgcaccctga agagcttcac cgtggagaag ggcatctacc agaccagcaa tttcagagtg 960 cagcctaccg agagcatcgt gagattccct aatatcacca atctgtgccc ttcggcgag 1020 gtgttcaatg ccaccagatt cgccagcgtg tacgcatgga accgcaagcg gataagcaat 1080 tgcgtggccg actacagcgt gctgtacaat agcgccagct tcagcacctt caaatgttat 1140 ggtgttcgc caacaaagct gaatgacctg tgcttcacca atgtgtacgc cgacagcttc 1200 gtgatcagag gcgacgaggt gagacagatc gcgccagggc agaccggcaa gatcgccgac 1260 tacaattaca agctgcctga cgacttcacc ggctgcgtga tcgcgtggaa ctctaacaat 1320 ctagattcga aagttggagg caattacaat tacctgtaca gactgttcag aaagagcaat 1380 ctgaagcctt tcgagagaga catcagcacc gagatctacc aggccggcag cacaccgtgt 1440 aatggcgtgg agggcttcaa ttgctacttc cctctgcaga gctacggctt ccagcctacc 1500 aatggcgtgg gctaccagcc ttacagagtg gtggtgctga gcttcgagct gctgcacgct 1560 cccgctaccg tgtgcggccc taagaagagc accaatctgg tgaagaataa gtgcgtgaat 1620 ttcaatttca atggtctaac tggaacgggc gtgctgaccg agagcaataa gaagtttctt 1680 ccctttcaac aattcggcag agacatcgcc gacaccacag atgctgtaag agaccctcag 1740 accctggaga tcctggacat cactccgtgt agcttcggcg gcgtgagcgt gatcacaccg 1800 ggtaccaata ccagcaatca ggtggccgtg ctgtaccagg acgtgaattg caccgaggtg 1860 cctgtggcca tccacgccga ccagctgact cccacttgga gggtatattc cacgggaagc 1920 aatgtgttcc agaccagagc cggctgcctg atcggcgccg agcacgtgaa taatagctac 1980 gagtgcgaca tccctatcgg cgccggcatc tgcgccagct accagaccca gaccaatagc 2040 cctagaagag ccagaagcgt ggccagccag agcatcatcg cctacaccat gagcctgggc 2100 gccgagaata gcgtggccta cagcaataat agcatcgcca tccctaccaa tttcaccatc 2160 agcgtgacca ccgaaatatt accagtctcc atgaccaaga ccagcgtgga ctgcaccatg 2220 tacatctgcg gcgacagcac cgagtgcagc aatctgctgc tgcagtacgg cagcttctgc 2280 acccagctga atagagccct gaccggcatc gccgtggagc aggacaagaa tacccaggag 2340 gtgttcgccc aggtgaagca gatctacaag actccgccga tcaaggactt cggcggcttc 2400 aatttcagcc aaatactccc agatccaagc aagcctagca agaggagctt catcgaggac 2460 ctgctgttca ataggtgac cctggccgac gccggcttca tcaagcagta cggcgactgc 2520 ctaggtgata ttgcggcaag agacctgatc tgcgccaga agtttaacgg ttgacagta 2580 ctacctcctc tgctgaccga cgagatgata gcacaata cgtcggcatt gctcgctggc 2640 acgatcacat cgggctggac ttcggcgcc ggagcagcgt tgcaatccc ttcgccatg 2700 cagatggcct acagattcaa tggcatcggc gtgacccaga atgtgctgta cgagaatcag 2760 aagctgatcg ccaatcagtt caatagcgcc atcggcaga tccaggacag cctgagcagc 2820 accgccagcg ccctgggcaa gctgcaggac gtggtgaatc agaatgccca ggccctgaat 2880 accctggtga agcagctgag cagcaatttc ggcgccatca gtagtgtact caacgatatc 2940 ctgagcagac tggacaggt ggaggccgag gtgcaattg atcgtcttat tactggcaga 3000 ctgcagagcc tgcagaccta cgtgacccag cagctgatca gagccgccga gatcagagcc 3060 agcgccaatc tggccgccac cagatgagc gagtgcgtgc tgggccag cagagagtg 3120 gactctgcg gcaagggcta cacctgatg agcttccctc agagcgctcc acatggcgtg 3180 gtgttcctgc acgtgaccta cgtgcctgcc caggagaaga atttcaccac cgcacccgca 3240 atctgccacg acggcaaggc ccacttccct agagagggcg tgttcgtgag caatggcacc 3300 cactggttcg tgacccagag aaatttctac gagcctcaga tcatcaccac cgacaatacc 3360 ttcgtgagcg gcaattgcga cgtggtgatc gggatagtca ataatactgt ctacgaccct 3420 ctgcagcctg agctggacag cttcaaggag gagctggaca agtacttcaa gaatcacacc 3480 agccctgacg tggacctcgg tgatatttcg ggaatcaatg ccagcgtggt gaatatccag 3540 aaggaaattg atcggctcaa cgaagtggcc aagaatctga atgagagcct gatcgacctg 3600 caggagctgg gcaagtacga gcagtacatc aagtggcctt ggtacatctg gctgggcttc 3660 atcgccggcc tgatcgccat cgtgatggtg accatcatgc tgtgctgcat gacctcctgt 3720 tgttcctgtt tgaaagggtg ttgttcgtgt gggtcctgct gcaagttcga cgaggacgac 3780 agcgagcctg tgctgaaggg cgtgaagctg cactacacct ga 3822 <210> 10 <211> 363 <212> DNA <213> Artificial Sequence <400> 10 cattccgccc tggaagagag cggaggcgga ctgatgcaac ccggcggatc catgaagctg 60 tcctgcgtgg cgagcggctt caccttcagc aactactgga tgaactgggt gaggcagtcc 120 cccgagaaag gcctggagtg ggtggctgag atcaggctga agtccaacaa ctacgccacc 180 cattacgccg aaagcgtcaa aggcaggttc accatttcca gagacgacag caaaaggtcc 240 gtgtacctcc agatgaacac cctgagggct gaggacaccg gcatctacta ctgcaccaga 300 ggcaacggca attatagagc catggattac tggggccagg gcacaagcgt caccgtgtcc 360 tcc 363 <210> 11 <211> 318 <212> DNA <213> Artificial Sequence <400> 11 gacatccaga tgacacagtc ccccgcttcc ctgagcgtga gcgtgggcga gaccgtgagc 60 atcacctgca gggccagcga aaacatctac agcagcctgg cctggtatca gcagaagcag 120 ggcaagagcc cccagctgct ggtgtactcc gccacaatcc tggccgacgg agtgcccagc 180 aggttttccg gatccggcag cggcacccag tacagcctga agatcaacag cctgcagagc 240 gaggacttcg gcacctacta ctgccagcac ttctggggca caccctacac attcggcggc 300 ggcaccaagc tggagatt 318

Claims

1. An IgG antibody that specifically binds to the SARS-CoV-2 spike protein, comprising a light chain and a heavy chain; wherein the CDR1, CDR2, and CDR3 in the variable region of the heavy chain are, in sequence 4 of the sequence listing, amino acid residues 45-52, 70-77, and 116-130 from the N-terminus; and the CDR1, CDR2, and CDR3 in the variable region of the light chain are, in sequence 6 of the sequence listing, amino acid residues 46-51, 69-71, and 108-116 from the N-terminus.

2. The IgG antibody that specifically binds to the SARS-CoV-2 spike protein as described in claim 1, characterized in that: The heavy chain variable region consists of amino acid residues from the N-terminus of sequence 4 in the sequence listing, from position 20 to 142. The light chain variable region consists of amino acid residues from the N-terminus of sequence 6 in the sequence listing, from position 20 to 126.

3. The IgG antibody that specifically binds to the SARS-CoV-2 spike protein as described in claim 2, characterized in that: The heavy chain is either (a) or (b) the protein consisting of amino acid residues 20-471 from the N-terminus of Sequence 4 in the sequence listing; or (b) the protein shown in Sequence 4 in the sequence listing. The light chain is either (c) or (d) as follows: (c) the protein consisting of amino acid residues 20-233 from the N-terminus of Sequence 6 of the sequence listing; (d) the protein shown in Sequence 6 of the sequence listing.

4. A gene encoding an IgG antibody that specifically binds to the SARS-CoV-2 spike protein as described in claim 3, characterized in that: The gene encoding the heavy chain is as follows (1) or (2): (1) The DNA molecule shown in sequence 5 of the sequence listing, from nucleotides 949 to 2304 from the 5' end; (2) The DNA molecule shown in sequence 5 of the sequence listing, from nucleotides 892 to 2307 from the 5' end; The gene encoding the light chain is as follows (3) or (4): (3) The DNA molecule shown in sequence 7 of the sequence listing, from nucleotides 1095 to 1736 from the 5' end; (4) The DNA molecule shown in sequence 7 of the sequence listing, from nucleotides 1038 to 1739 from the 5' end.

5. Use of the IgG antibody according to claim 1, 2 or 3 in the preparation of a medicament for inhibiting SARS-CoV-2.

6. A drug for inhibiting SARS-CoV-2, wherein the active ingredient is the IgG antibody as described in claim 1, 2 or 3.

7. Use of the IgG antibody of claim 1, 2 or 3 in the preparation of a medicament for neutralizing SARS-CoV-2.

8. A medicament for neutralizing SARS-CoV-2, wherein the active ingredient is the IgG antibody as described in claim 1, 2 or 3.

9. The use of the IgG antibody according to claim 1, 2 or 3 in the preparation of a medicament for the prevention and / or treatment of pneumonia caused by SARS-CoV-2 infection.

10. A medicament for the prevention and / or treatment of pneumonia caused by SARS-CoV-2 infection, wherein the active ingredient is the IgG antibody as described in claim 1, 2 or 3.

Images