Construction method and application of escherichia coli engineering bacteria for improving l-lysine yield
By knocking out the lysine tRNA gene in the E. coli genome, an engineered E. coli strain was constructed, solving the problem of side effects in bacterial growth and metabolism in existing technologies, and achieving an increase in L-lysine production and biomass.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-21
- Publication Date
- 2026-03-24
AI Technical Summary
Existing technologies that increase yield by reducing the participation of L-lysine in protein synthesis may have side effects on bacterial growth and metabolism, affecting normal bacterial growth.
Five lysine tRNA genes in the Escherichia coli genome were knocked out to construct an engineered E. coli strain. The engineered E. coli strain E. coli-ΔtLys was prepared by PCR amplification of homologous arm sequences, seamless cloning technology, and plasmid transformation.
It increased the yield and biomass of L-lysine, reduced production costs, and achieved a balance between increased L-lysine production and cell growth.
Smart Images

Figure CN115975895B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to a method for constructing an Escherichia coli engineering bacterium for improving L-lysine yield and application thereof, and belongs to the technical field of bioengineering. BACKGROUND
[0002] L-lysine is involved in protein synthesis, energy metabolism and fat metabolism in organisms, and is one of the eight essential amino acids involved in human metabolic balance. Currently, commercial L-lysine is mainly in the form of L-lysine hydrochloride and L-lysine sulfate and is widely used in the feed, food and pharmaceutical industries. Microbial fermentation method is widely used in the industrial production of L-lysine due to its advantages of small pollution, high yield and low cost.
[0003] Corynebacterium glutamicum and its mutant strains are early strains used in the industrial production of L-lysine. At present, strains for the industrial production of L-lysine at home and abroad are mainly modified strains of Corynebacterium glutamicum and Escherichia coli.
[0004] In Corynebacterium glutamicum and Escherichia coli, the diaminopimelic acid (dap) pathway is the main L-lysine biosynthesis pathway. The diaminopimelic acid (dap) pathway contains multiple enzymatic reactions, and enhancing the expression of key enzymes in the synthesis of L-lysine can promote the synthesis of L-lysine. For example, Chinese patent CN108504617A (application number: 201810313577.6) discloses a recombinant Escherichia coli strain for high-yield L-lysine and a method for constructing the same, and discloses a method for improving the accumulation of L-lysine in the strain by enhancing the meso-DAP synthesis ability of the recombinant Escherichia coli strain.
[0005] L-lysine in Escherichia coli is mainly involved in protein synthesis and catalyzed by L-lysine decarboxylase I and II encoded by cadA and ldcC genes to generate pentamethylenediamine and carbon dioxide. At present, the overexpression of key enzyme genes in the amino acid synthesis pathway mediated by expression plasmid is the main means of genetic modification of L-lysine producing bacteria. Chinese patent document CN104878034A (application number: 201510185330.7) discloses an L-lysine genetically engineered production strain, mainly enhancing the related genes of L-lysine synthesis pathway, weakening the branch metabolic pathway, screening a strain of L-lysine high-yield bacteria, and constructing a method for knocking out the genes related to the L-lysine metabolic pathway in the original strain. The knocked out genes are cadA, ldcC, gltI, thrC, cynT, thrL and maeB; the genes related to the L-lysine metabolic pathway in the gene knockout strain are enhanced to obtain a gene enhanced strain, and the enhanced genes are ybjE and cyo operon.
[0006] However, the method of reducing the synthesis of L-lysine in proteins to improve the yield of L-lysine may have some side effects on the bacteria itself due to the reduction of L-lysine involved in protein synthesis, affecting the normal growth and metabolism of the bacteria, and therefore the method is rarely reported. SUMMARY
[0007] The present application provides a method for constructing an Escherichia coli engineering strain for improving the yield of L-lysine and its application.
[0008] The inventors studied a variety of experimental schemes, and finally obtained the technical scheme of the present application: knocking out five lysine tRNA genes in the genome of Escherichia coli to construct an Escherichia coli engineering strain. The present application first found that the Escherichia coli engineering strain constructed by the method not only has improved L-lysine yield, but also has improved biomass compared with the original strain.
[0009] The technical scheme of the present application is as follows:
[0010] The application of the gene in preparing an L-lysine-producing Escherichia coli engineering strain, the nucleotide sequence of the gene is shown in SEQ ID NO. 1, specifically, knocking out the gene with the nucleotide sequence shown in SEQ ID NO. 1 in Escherichia coli to obtain an Escherichia coli engineering strain.
[0011] According to the present application, preferably, in the above application, the Escherichia coli is Escherichia coli CGMCC1.366.
[0012] According to the present application, preferably, the above method for constructing an Escherichia coli engineering strain comprises the following steps:
[0013] (1) PCR amplification of the upstream and downstream homologous arm sequences of the knockout gene using Escherichia coli genomic DNA as the template, the nucleotide sequence of the upstream homologous arm t-Lys1 is shown in SEQ ID NO. 2, the nucleotide sequence of the downstream homologous arm t-Lys2 is shown in SEQ ID NO. 3, and the nucleotide sequence of the knockout gene is shown in SEQ ID NO. 1;
[0014] (2) PCR amplification of the resistance tag gene fragment FRT-Kan-FRT of plasmid pKD13, the nucleotide sequence is shown in SEQ ID NO. 4;
[0015] (3) using the seamless cloning technology, the upstream homologous arm t-Lys1 and the downstream homologous arm t-Lys2 fragments prepared in step (1) are connected with the FRT-Kan-FRT fragment prepared in step (2) and the linearized vector pET-28a(+) to prepare a recombinant plasmid;
[0016] (4) preparing Escherichia coli competent cells, transforming the plasmid pKD46 into the competent cells to obtain a recombinant strain E. coli-pKD46;
[0017] (5) preparing the recombinant strain obtained in step (4) into competent cells, transforming the recombinant plasmid prepared in step (3) into the competent cells to obtain a recombinant strain E. coli-kanR;
[0018] (6) preparing the recombinant strain obtained in step (5) into competent cells, transforming the plasmid pCP20 into the competent cells to obtain the Escherichia coli engineering bacteria E. coli-ΔtLys.
[0019] According to the present application, in step (1), PCR amplification is performed using Escherichia coli genomic DNA as the template to obtain the upstream homologous arm t-Lys1, and the nucleotide sequence is shown in SEQ ID NO. 2;
[0020] The nucleotide sequence of the PCR amplification primer is as follows:
[0021] t-Lys1-F: gtggtggtggtggtgctcgagGTGCAGGATAAATCCCGCC SEQ ID NO. 5;
[0022] t-Lys1-R: ggtccacggagaattcACTTTTTCGTTGCTTTCGGTTT SEQ ID NO. 6.
[0023] According to the present application, the reaction system for PCR amplification is as follows, and the total system is 50 μl:
[0024]
[0025]
[0026] The PCR amplification procedure is as follows:
[0027] 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 30 sec, 30 cycles; 72℃ extension for 10 min, 4℃ preservation.
[0028] According to the present application, in the step (1), the PCR amplification is performed by taking the genomic DNA of Escherichia coli as a template to obtain the downstream homologous arm t-Lys2, and the nucleotide sequence is as shown in SEQ ID NO. 3.
[0029] The nucleotide sequences of the PCR amplification primers are as follows:
[0030] t-Lys2-F cgagctcggtaccATGTAAAAAAGCGCCCTAAAGG SEQ ID NO. 7;
[0031] t-Lys2-R: cagcaaatgggtcgcggatccATGCTTAACGGCGTCGGC SEQ ID NO. 8.
[0032] According to the present application, the reaction system for PCR amplification is as follows, and the total system is 50 μl:
[0033]
[0034] The PCR amplification procedure is as follows:
[0035] 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 30 sec, 30 cycles; 72℃ extension for 10 min, 4℃ preservation.
[0036] According to the present application, in the step (2), the PCR amplification template is the DNA of plasmid pKD13 to obtain the kanamycin resistance fragment FRT-Kan-FRT with FRT sites, and the nucleotide sequence is as shown in SEQ ID NO. 4.
[0037] The nucleotide sequences of the PCR amplification primers are as follows:
[0038] Kan-F: aagtGAATTCTCCGTGGACCTGCA SEQ ID NO. 9;
[0039] Kan-R: tttacatGGTACCGAGCTCGGATCCG SEQ ID NO. 10.
[0040] According to the present application, preferably, the reaction system of PCR amplification is as follows, the total system is 50 μl:
[0041]
[0042] The PCR amplification procedure is as follows:
[0043] 95 ℃ pre-denaturation 5 min; 94 ℃ denaturation 30 sec, 55 ℃ annealing 30 sec, 72 ℃ extension 2 min, 30 cycles; 72 ℃ extension 10 min, 4 ℃ preservation.
[0044] According to the present application, preferably, in the step (3), the multi-fragment seamless cloning system is as follows, the total system is 10 μl:
[0045]
[0046] The seamless cloning procedure is as follows:
[0047] Multi-fragment recombination reaction, 50 ℃, 15 min; decrease to 4 ℃ or immediately place on ice to cool.
[0048] According to the present application, preferably, the specific steps of the step (4) are as follows:
[0049] (i) pick up Escherichia coli single colony, culture in seed medium to the bacterial concentration OD 600 0.5-0.6, place on ice to cool, after cooling, centrifuge, wash the bacterial body with pre-cooled electrotransformation buffer for 3-5 times, resuspend the bacterial body with electrotransformation buffer, and prepare competent cells;
[0050] (ii) high-voltage electric shock transform pKD46 plasmid into the competent cells prepared in the step (i), move into liquid recovery medium, culture at 28-32 ℃ for 12-16 h, and then screen, and the recombinant strain E. coli-pKD46 is obtained.
[0051] Further preferably, in the step (i), the seed medium is as follows per liter of components:
[0052] Peptone 8-12 g, yeast powder 4-6 g, sodium chloride 8-12 g, and the rest is water.
[0053] Further preferably, in the step (i), the components of the electrotransformation buffer are as follows per liter:
[0054] Sorbitol 85-96 g, Mannitol 85-96 g, Glycerol 95-105 mL, and the rest of water.
[0055] Further preferably, in the step (i), the high-voltage electric shock transformation is performed at 1800 V for 5 ms.
[0056] Further preferably, in the step (ii), the components of the liquid recovery medium are as follows per liter:
[0057] Peptone 8-12 g, Yeast powder 4-6 g, Sodium chloride 8-12 g, Sorbitol 85-96 g, Mannitol 65-73 g, and the rest of water.
[0058] According to the present application, preferably, the specific steps of the step (5) are as follows:
[0059] ① A single colony of Escherichia coli obtained in the step (4) is cultured in a seed medium until the bacterial concentration OD 600 is 0.5-0.6, and then cooled on ice, centrifuged, and washed with pre-cooled electrotransformation buffer 3-5 times. The bacterial cells are resuspended in the electrotransformation buffer to obtain competent cells;
[0060] ② The recombinant plasmid prepared in the step (3) is transformed into the competent cells prepared in the step ① by high-voltage electric shock, and then transferred into a liquid recovery medium. After being cultured at 28-32°C for 12-16 h, the recombinant strain E. coli-kanR is screened.
[0061] Further preferably, in the step ①, the components of the seed medium are as follows per liter:
[0062] Peptone 8-12 g, Yeast powder 4-6 g, Sodium chloride 8-12 g, and the rest of water.
[0063] Further preferably, in the step ①, the components of the electrotransformation buffer are as follows per liter:
[0064] Sorbitol 85-96 g, Mannitol 85-96 g, Glycerol 95-105 mL, and the rest of water.
[0065] Further preferably, in the step ①, the high-voltage electric shock transformation is performed at 1800 V for 5 ms.
[0066] Further preferably, in the step ②, the components of the liquid recovery medium are as follows per liter:
[0067] Peptone 8-12 g, yeast powder 4-6 g, sodium chloride 8-12 g, sorbitol 85-96 g, mannitol 65-73 g, and the rest is water.
[0068] According to the application, the step (6) is specifically as follows:
[0069] I. The single colony of Escherichia coli obtained in step (5) is cultured in a seed culture medium until the bacterial concentration OD 600 is 0.5-0.6, and then cooled on ice, centrifuged, and washed with pre-cooled electrotransformation buffer for 3-5 times. The bacterial cells are resuspended in the electrotransformation buffer to obtain competent cells.
[0070] II. The plasmid pCP20 is transformed into the competent cells obtained in step I by high-voltage electric shock, and then transferred into a liquid recovery medium and cultured at 28-32℃ for 12-16 hours. Then, screening is performed to obtain the Escherichia coli engineering bacteria E.coli-ΔtLys.
[0071] According to the application, in step I, the seed culture medium contains the following components per liter:
[0072] Peptone 8-12 g, yeast powder 4-6 g, sodium chloride 8-12 g, and the rest is water.
[0073] According to the application, in step I, the electrotransformation buffer contains the following components per liter:
[0074] Sorbitol 85-96 g, mannitol 85-96 g, glycerol 95-105 mL, and the rest is water.
[0075] According to the application, in step I, the high-voltage electric shock transformation is performed at 1800V for 5 ms.
[0076] According to the application, in step II, the liquid recovery medium contains the following components per liter:
[0077] Peptone 8-12 g, yeast powder 4-6 g, sodium chloride 8-12 g, sorbitol 85-96 g, mannitol 65-73 g, and the rest is water.
[0078] The Escherichia coli engineering bacteria E.coli-ΔtLys obtained by the above construction method is applied in the production of L-lysine.
[0079] Advantages
[0080] The application provides a method for constructing an engineered Escherichia coli strain for improving L-lysine yield. BRIEF DESCRIPTION OF DRAWINGS
[0081] Figure 1 The electrophoretogram of the gene fragments homologous arm t-Lys1 and homologous arm t-Lys2 in Example 1.
[0082] In the figure, lane 1 is t-Lys1, and lanes 3, 4 and 5 are t-Lys2.
[0083] Figure 2 The electrophoretogram of the gene fragment FRT-Kan-FRT in Example 1.
[0084] Figure 3 The electrophoretogram of the gene fragment bet in Example 3.
[0085] Figure 4 The electrophoretogram of the gene fragment t-Lys1-FRT-Kan-FRT-t-Lys2 in Example 4.
[0086] Figure 5 The 24h growth curve of the original strain and the engineered Escherichia coli strain. DETAILED DESCRIPTION
[0087] The technical solutions of the application are further described below in combination with examples, but the scope of the application is not limited thereto.
[0088] Source of biological material
[0089] The Escherichia coli CGMCC 1.366 can be obtained from the China General Microbiological Culture Collection Center.
[0090] The plasmid pET-28a(+) is from Wuhan Moliang Biological Technology Co., Ltd.
[0091] The plasmid pKD13 is purchased from Hangzhou Baosai Biological Technology Co., Ltd.
[0092] The drugs and reagents used in the examples are all commercially available products unless otherwise specified, and the contents not specifically described in the examples are all based on the prior art in the field
[0093] Example 1
[0094] Construction of gene knockout fragment
[0095] (i) extracting Escherichia coli CGMCC 1.366 genomic DNA, taking the genomic DNA as a template, and performing PCR amplification to obtain a homologous arm t-Lys, the nucleotide sequence of which is shown as SEQ ID NO. 2;
[0096] The PCR primer sequence is as follows:
[0097] t-Lys1-F: gtggtggtggtggtgctcgagGTGCAGGATAAATCCCGCC SEQ ID NO. 5;
[0098] t-Lys1-R: ggtccacggagaattcACTTTTTCGTTGCTTTCGGTTT SEQ ID NO. 6;
[0099] The PCR amplification system is shown in Table 1:
[0100] Table 1
[0101]
[0102] The PCR amplification procedure is as follows:
[0103] 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 30 sec, 30 cycles; 72℃ extension for 10 min, 4℃ preservation;
[0104] Extracting Escherichia coli genomic DNA, taking the genomic DNA as a template, and performing PCR amplification to obtain a homologous arm t-Lys2, the nucleotide sequence of which is shown as SEQ ID NO. 3;
[0105] The PCR primer sequence is as follows:
[0106] t-Lys2-F cgagctcggtaccATGTAAAAAAGCGCCCTAAAGG SEQ ID NO. 7;
[0107] t-Lys2-R: cagcaaatgggtcgcggatccATGCTTAACGGCGTCGGC SEQ ID NO. 8;
[0108] The PCR amplification system is shown in Table 2:
[0109] Table 2
[0110]
[0111] The PCR amplification procedure is as follows:
[0112] 95°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 30 sec, 30 cycles; 72°C extension for 10 min, 4°C preservation;
[0113] The PCR product is detected by agarose gel electrophoresis, and the length is about 500 bp, as shown in Figure 1 which is close to the theoretical value of 500 bp. The SanPrep column DNA gel recovery kit (Shanghai Biomed) is used for gel recovery, and the recovered product is stored at -20°C for standby;
[0114] (ii) Extract the DNA of plasmid pKD13, and perform PCR amplification with the DNA as a template to obtain the FRT-Kan-FRT fragment, and the nucleotide sequence is shown in SEQ ID NO. 4;
[0115] The PCR primer sequence is as follows:
[0116] Kan-F: aagtGAATTCTCCGTGGACCTGCA SEQ ID NO. 9;
[0117] Kan-R: tttacatGGTACCGAGCTCGGATCCG SEQ ID NO. 10;
[0118] The PCR amplification system is shown in Table 3:
[0119] Table 3
[0120]
[0121] The PCR amplification procedure is as follows:
[0122] 95°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 2 min, 30 cycles; 72°C extension for 10 min, 4°C preservation;
[0123] The PCR product is detected by agarose gel electrophoresis, and the length is about 1300 bp, as shown in Figure 2 which is close to the theoretical value of 1324 bp. The SanPrep column DNA gel recovery kit (Shanghai Biomed) is used for gel recovery, and the recovered product is stored at -20°C for standby; (iii) The t-Lys1 and t-Lys2 fragments prepared in step (i) and the FRT-Kan-FRT fragment prepared in step (ii) are connected with the linearized vector pET-28a(+) using the seamless cloning kit to obtain the recombinant plasmid.
[0124] The overlap seamless cloning connection system is shown in Table 4:
[0125] Table 4
[0126]
[0127] The seamless cloning amplification procedure is as follows:
[0128] Multi-fragment recombination reaction, 50°C, 15 min; reduce to 4°C or immediately cool on ice, ready for use;
[0129] Example 2
[0130] Preparation of Escherichia coli competence
[0131] (i) Pick a single colony of Escherichia coli CGMCC 1.366 and inoculate into 10 mL seed medium, 37°C, 220 r / min, overnight culture;
[0132] Seed medium, components per liter as follows:
[0133] Peptone 10 g, yeast powder 5 g, sodium chloride 10 g, the rest water.
[0134] (ii) Take 1 mL of the above bacterial solution and transfer to 100 mL of seed medium, 37°C, 220 r / min, culture to OD 600 = 0.9;
[0135] (iii) Transfer the bacterial solution to a 100 mL centrifuge tube and ice bath for 15-20 min to stop bacterial growth;
[0136] (iv) After ice bath, centrifuge at 4°C, 5000 g, 5 min, collect the bacterial cells;
[0137] (v) Wash the centrifuged bacterial cells with pre-cooled electrotransformation buffer (ETM) 3 times;
[0138] Electrotransformation buffer, components per liter as follows:
[0139] Sorbitol 91 g, mannitol 91 g, glycerol 100 mL, the rest water.
[0140] (vi) After washing, resuspend the bacterial cells with 1000 μL of electrotransformation buffer;
[0141] (vii) Divide the prepared competent cells into 100 μL per tube and store at -80°C for later use.
[0142] Example 3
[0143] Electrotransformation of plasmid pKD46 into the Escherichia coli competence cells prepared in Example 2
[0144] (i) First, the concentration of plasmid pKD46 was determined by using a nucleic acid ultramicro spectrophotometer, and after reaching a concentration of 300 μg / mL, the cells were subjected to electroporation at 1800V for 5ms. The obtained cells were resuscitated and cultured at 30°C for 1h using resuscitation medium, and then 100 μL was spread on LB solid medium containing 100 μg / mL ampicillin and cultured at 30°C for 1 day to screen for ampicillin-resistant transformants, thereby obtaining E. coli recombinant bacteria E. coli-pKD46.
[0145] A single colony grown on ampicillin LB solid medium was picked as a template, and PCR amplification was performed using pKD46-F and pKD46-R as primers. The amplification product was verified by agarose gel electrophoresis.
[0146] The PCR primer sequences are as follows:
[0147] pKD46-F: ATGAGTATTCAACATTTCCGTGTCG SEQ ID NO. 11;
[0148] pKD46-R: TTACCAATGCTTAATCAGTGAGGC SEQ ID NO. 12;
[0149] The PCR amplification system is 20 μL, and Table 5 is as follows:
[0150] Table 5
[0151]
[0152] The PCR amplification program is as follows:
[0153] Pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 45 sec, extension at 72°C for 4 min, 30 cycles; extension at 72°C for 10 min, and storage at 4°C;
[0154] The PCR product was verified by agarose gel electrophoresis, and the results showed that a specific gene band with a size of about 750 bp could be amplified using primers pKD46-F and pKD46-R, as shown in Figure 3 which is close to the theoretical value of 786 bp, indicating that the knockout cassette transformation was successful, and E. coli engineering bacteria E. coli-pKD46 was obtained.
[0155] Liquid resuscitation medium, with the following components per liter:
[0156] Proteose peptone 10 g, yeast powder 5 g, sodium chloride 10 g, sorbitol 91 g, mannitol 69.4 g, and the rest is water.
[0157] Example 4
[0158] The recombinant plasmid prepared in Example 1 was electrotransformed into the E. coli prepared in Example 3, E. coli-pKD46.
[0159] (i) First, the concentration of the recombinant plasmid was determined using a nucleic acid ultramicro spectrophotometer, and after reaching a concentration of 300 μg / mL, an electric shock of 1800 V for 5 ms was performed for electrotransformation. The obtained cells were resuscitated in resuscitation medium at 37°C for 1 h, and 100 μL was spread on LB solid medium containing 100 μg / mL ampicillin and incubated at 37°C for 1 day. The transformants with kanamycin resistance were screened, and the E. coli recombinant strain E. coli-KanR was obtained.
[0160] A single colony grown on kanamycin LB solid medium was picked as a template, and t-Lys1-F and t-Lys2-R were used as primers for PCR amplification. The amplification product was verified using agarose gel electrophoresis.
[0161] The sequences of the PCR primers are as follows:
[0162] t-Lys1-F: gtggtggtggtggtgctcgagGTGCAGGATAAATCCCGCC SEQ ID NO. 5;
[0163] t-Lys2-R: cagcaaatgggtcgcggatccATGCTTAACGGCGTCGGC SEQ ID NO. 8;
[0164] The PCR amplification system was 20 μL, and Table 6 is as follows:
[0165] Table 6
[0166]
[0167] The PCR amplification program is as follows:
[0168] Pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 45 sec, extension at 72°C for 4 min, 30 cycles; extension at 72°C for 10 min, and storage at 4°C;
[0169] The PCR product was verified by agarose gel electrophoresis, and the results showed that a specific gene band with a size of about 2300 bp could be amplified using primers t-Lys1-F and t-Lys2-R, as shown in Figure 4 The size was close to the theoretical value of 2324 bp, indicating that the knockout frame transformation was successful, and the E. coli engineering strain E. coli-KanR was obtained.
[0170] The liquid resuscitation medium had the following components per liter:
[0171] Tryptone 10 g, yeast extract 5 g, sodium chloride 10 g, sorbitol 91 g, mannitol 69.4 g, and the rest of water.
[0172] Example 5
[0173] The plasmid pCP20 was electrotransformed into the E. coli recombinant bacteria prepared in Example 4 to obtain E. coli-KanR.
[0174] (i) First, the concentration of the plasmid pCP20 was determined using a nucleic acid ultramicro spectrophotometer, and after reaching a concentration of 300 μg / mL, 1800V was applied for 5 ms for electrotransformation. The obtained cells were resuscitated in a resuscitation medium at 37°C for 1 h, and 100 μL was spread on LB solid medium and cultured at 37°C for 1 day to screen for transformants.
[0175] Liquid resuscitation medium, per liter of components as follows:
[0176] Tryptone 10 g, yeast extract 5 g, sodium chloride 10 g, sorbitol 91 g, mannitol 69.4 g, and the rest of water.
[0177] Example 6
[0178] Positive colony screening
[0179] The positive recombinant colonies (screening transformants) of Example 5 were picked and inoculated into solid LB medium containing 100 μg / mL ampicillin resistance and not containing resistance, respectively, and cultured at 37°C overnight. After the culture was completed, single colonies that grew only in LB solid medium without resistance were picked as templates, and t-Lys1-F and t-Lys2-R were used as primers for PCR amplification, and the amplification product was verified using agarose gel electrophoresis;
[0180] The sequences of the PCR primers are as follows:
[0181] t-Lys1-F: gtggtggtggtggtgctcgagGTGCAGGATAAATCCCGCC SEQ ID NO. 5;
[0182] t-Lys2-R: cagcaaatgggtcgcggatccATGCTTAACGGCGTCGGC SEQ ID NO. 8;
[0183] The PCR amplification system is 20 μL, and Table 7:
[0184] Table 7
[0185]
[0186] The PCR amplification program is as follows:
[0187] 95℃ pre-denaturation 5 min; 94℃ denaturation 30 sec, 55℃ annealing 45 sec, 72℃ extension 4 min, 30 cycles; 72℃ extension 10 min, 4℃ preservation;
[0188] The PCR product was detected by agarose gel electrophoresis, and the results showed that a specific gene band could be amplified using primers t-Lys1-F and t-Lys2-R, with a size of about 1100 bp, close to the theoretical value of 1085 bp, indicating that the lysine tRNA gene was successfully knocked out, and the E. coli engineering bacteria E. coli-ΔtLys was obtained. The E. coli engineering bacteria knocked out the gene nucleotide sequence as shown in SEQ ID NO. 1.
[0189] Example 7
[0190] L-lysine fermentation test
[0191] The prepared E. coli engineering bacteria E. coli-ΔtLys and the original bacteria CGMCC 1.366 of Example 6 were inoculated into 100 mL of LB medium (10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, and the balance of water) at 220 rpm and 37℃ for seed culture for 12 h, and then inoculated into 100 mL of fermentation medium (100 g / L of glucose, 20 g / L of proteose peptone, 30 mL / L of corn syrup, 5 g / L of urea, 25 g / L of (NH4)2SO4, 0.34 g / L of L-lysine, 2 g / L of KH2PO4, 1.5 g / L of MgSO4·7H2O, 0.001 g / L of biotin, and the balance of water) at a volume percentage of 2% inoculation amount, and fermented for 50 h. The content of L-lysine in the fermentation broth was determined by a biological sensor analyzer SBA-40C (manufactured by Shandong Academy of Sciences, a commercially available product), and the average value of three fermentation measurements was calculated, and the results are shown in Table 8. The 24 h growth curves of the original bacteria and the E. coli engineering bacteria are shown in Figure 5 .
[0192] Table 8 L-lysine production of E. coli engineering bacteria and original bacteria
[0193] Strain \ Fermentation time 50h Escherichia coli engineering bacteria 3.2 g / L Original bacteria CGMCC 1.366 2.48 g / L
[0194] The results show that the content of L-lysine in the fermentation broth of the engineered E. coli reaches 3.2±0.15 g / L after 50 h of fermentation, while the yield of the original strain is basically 2.48±0.08 g / L at 50 h, and the yield of L-lysine of the engineered E. coli is increased by 29% compared with the original strain; the biomass of the engineered E. coli strain is also increased to a certain extent compared with the original strain; which shows that knocking out the five lysine tRNA genes of E. coli can increase the L-lysine fermentation yield of E. coli, and the biomass of the engineered E. coli is also increased to a certain extent compared with the original strain.
[0195] The inventors also carried out experiments of knocking out the lysine tRNA gene sequence in C. glutamicum CICC 23604, and the construction of the engineered C. glutamicum was unsuccessful, and the inventors found that after knocking out the lysine tRNA gene sequence in C. glutamicum, the bacteria did not grow. Further, it is further proved that knocking out the lysine tRNA gene sequence in all microbial strains can increase the yield of L-lysine, and knocking out the lysine tRNA gene sequence in some microbial strains will affect the normal growth of the bacteria.
[0196] The present application provides a method for constructing an engineered E. coli for increasing the yield of L-lysine, and the inventors find that knocking out the lysine tRNA gene can increase the yield of L-lysine, and the biomass of the bacteria is also increased. The constructed engineered E. coli has higher yield of L-lysine than the original strain, lower production cost, and the biomass of the bacteria is also increased to a certain extent.
Claims
1. Application of the gene in the preparation of engineered Escherichia coli producing L-lysine, wherein the nucleotide sequence of the gene is shown in SEQ ID NO. 1, specifically in Escherichia coli (… Escherichia coli The engineered Escherichia coli strain E was obtained by knocking out the gene with the nucleotide sequence shown in SEQ ID NO.
1. coli-ΔtLys .
2. The application as described in claim 1, characterized in that, Escherichia coli ( Escherichia coli The result was Escherichia coli CGMCC 1.
366.
3. The application as described in claim 1, characterized in that, The method for constructing the engineered Escherichia coli includes the following steps: (1) With Escherichia coli ( Escherichia coli Using genomic DNA as a template, PCR amplification of upstream and downstream gene fragments of the knockout gene was used as homologous arm sequences. The nucleotide sequence of the upstream homologous arm t-Lys1 is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream homologous arm t-Lys2 is shown in SEQ ID NO. 3; the nucleotide sequence of the knockout gene is shown in SEQ ID NO.
1. (2) The resistance tag gene fragment FRT-Kan-FRT of plasmid pKD13 was amplified by PCR, and the nucleotide sequence is shown in SEQ ID NO.4; (3) Using seamless cloning technology, the upstream homologous arm t-Lys1 and downstream homologous arm t-Lys2 fragments obtained in step (1) and the FRT-Kan-FRT fragment obtained in step (2) are ligated with the linearized vector pET-28a(+) to obtain a recombinant plasmid. (4) Prepare competent Escherichia coli cells, transform plasmid pKD46 into competent cells, and obtain recombinant strain E. coli -pKD46; (5) Prepare competent cells from the recombinant strain obtained in step (4), and transform the recombinant plasmid obtained in step (3) into competent cells to obtain recombinant strain E. coli -kanR; (6) Prepare competent cells from the recombinant strain obtained in step (5), and transform plasmid pCP20 into competent cells to obtain engineered Escherichia coli strain E. coli-ΔtLys .
4. The application as described in claim 3, characterized in that, In step (1), PCR amplification is performed using Escherichia coli (E. coli) Escherichia coli Using the genomic DNA of ) as a template, the upstream homologous arm t-Lys1 was obtained, and its nucleotide sequence is shown in SEQ ID NO. 2; The nucleotide sequences of the PCR amplification primers are as follows: t-Lys1-F: gtggtggtggtggtgctcgagGTGCAGGATAAATCCCGCCSEQ ID NO. 5; t-Lys1-R: ggtccacggagaattcACTTTTTCGTTGCTTTCGGTTTSEQ ID NO. 6; The PCR amplification reaction system is as follows, with a total volume of 50 μl: 2×HiFi-PCR master 25μl t-Lys1-F2μl t-Lys1-R2μl Template 2μl dd H2O 19μl; The PCR amplification procedure is as follows: Pre-denaturation at 95℃ for 5 min; denaturation at 94℃ for 30 sec, annealing at 55℃ for 30 sec, extension at 72℃ for 30 sec, 30 cycles; extension at 72℃ for 10 min, storage at 4℃.
5. The application as described in claim 3, characterized in that, In step (1), PCR amplification is performed using Escherichia coli (E. coli) Escherichia coli Using the genomic DNA of ) as a template, the downstream homologous arm t-Lys2 was obtained, and its nucleotide sequence is shown in SEQ ID NO. 3; The nucleotide sequences of the PCR amplification primers are as follows: t-Lys2-F cgagctcggtaccATGTAAAAAAGCGCCCTAAAGGSEQ ID NO. 7; t-Lys2-R: cagcaaatgggtcgcggatccATGCTTAACGGCGTCGGCSEQ ID NO. 8; The PCR amplification reaction system is as follows, with a total volume of 50 μl: 2×HiFi-PCR master 25μl t-Lys2-F2μl t-Lys2-R2μl Template 2μl dd H2O 19μl; The PCR amplification procedure is as follows: Pre-denaturation at 95℃ for 5 min; denaturation at 94℃ for 30 sec, annealing at 55℃ for 30 sec, extension at 72℃ for 30 sec, 30 cycles; extension at 72℃ for 10 min, storage at 4℃.
6. The application as described in claim 3, characterized in that, In step (2), the DNA template for PCR amplification is plasmid pKD13, and the kanamycin resistance fragment FRT-Kan-FRT with FRT site is obtained, and the nucleotide sequence is shown in SEQ ID NO.4; The nucleotide sequences of the PCR amplification primers are as follows: Kan-F: aagtGAATTCTCCGTGGACCTGCASEQ ID NO. 9; Kan-R: tttacatGGTACCGAGCTCGGATCCGSEQ ID NO. 10; The PCR amplification reaction system is as follows, with a total volume of 50 μl: 2×HiFi-PCR master 25μl Kan-F2μl Kan-R2μl Template 2μl dd H2O 19μl; The PCR amplification procedure is as follows: Pre-denaturation at 95℃ for 5 min; denaturation at 94℃ for 30 sec, annealing at 55℃ for 30 sec, extension at 72℃ for 2 min, 30 cycles; extension at 72℃ for 10 min, storage at 4℃.
7. The application as described in claim 3, characterized in that, In step (3), the multi-fragment seamless cloning system is as follows, with a total volume of 10 μl: Linearized vector pET-28a(+) 2μl t-Lys11μl t-Lys21μl FRT-Kan-FRT1μl 2 × ClonExpress Mix 5μl The seamless cloning procedure is as follows: Multi-fragment recombination reaction, 50 °C, 15 min; cool to 4 °C or immediately on ice.
8. The application as described in claim 3, characterized in that, The specific steps of step (4) are as follows: (i) Picking Escherichia coli ( Escherichia coli Single colonies were cultured in seed culture medium until the bacterial cell concentration reached OD500. 600 The concentration was 0.5–0.6, and the cells were placed on ice to cool. After cooling, the cells were centrifuged and washed 3–5 times with pre-cooled electroporation buffer. The cells were then resuspended in electroporation buffer to obtain competent cells. (ii) The pKD46 plasmid was transformed into competent cells obtained in step (i) by high voltage electroporation, transferred into liquid resuscitation medium, and cultured at 28-32℃ for 12-16 h. After screening, recombinant strain E was obtained. coli -pKD46.
9. The application as described in claim 8, characterized in that, In step (i), the seed culture medium has the following components per liter: 8-12g peptone, 4-6g yeast powder, 8-12g sodium chloride, and the remainder water; In step (i), the electroporation buffer has the following components per liter: Sorbitol 85-96 g, mannitol 85-96 g, glycerol 95-105 mL, balance water; In step (i), the conditions for high-voltage electric shock conversion are: 1800 V electric shock for 5 ms; The liquid resuscitation medium in step (ii) has the following components per liter: 8-12g peptone, 4-6g yeast powder, 8-12g sodium chloride, 85-96g sorbitol, 65-73g mannitol, and the remainder water.
10. The application as described in claim 3, characterized in that, The specific steps of step (5) are as follows: ① Pick the Escherichia coli obtained in step (4) Escherichia coli Single colonies were cultured in seed culture medium until the bacterial cell concentration reached OD500. 600 The concentration was 0.5–0.6, and the cells were placed on ice to cool. After cooling, the cells were centrifuged and washed 3–5 times with pre-cooled electroporation buffer. The cells were then resuspended in electroporation buffer to obtain competent cells. ② The recombinant plasmid obtained in step (3) is converted into competent cells obtained in step ① by high voltage electroporation, transferred into liquid resuscitation medium, and cultured at 28-32℃ for 12-16 h. After screening, recombinant strain E is obtained. coli -kanR.
11. The application as described in claim 10, characterized in that, In step ①, the seed culture medium has the following components per liter: 8-12g peptone, 4-6g yeast powder, 8-12g sodium chloride, and the remainder water; In step ①, the electroporation buffer solution has the following components per liter: Sorbitol 85-96 g, mannitol 85-96 g, glycerol 95-105 mL, balance water; In step ①, the conditions for high-voltage electric shock conversion are: 1800 V electric shock for 5 ms; The liquid resuscitation medium in step ② has the following components per liter: 8-12g peptone, 4-6g yeast powder, 8-12g sodium chloride, 85-96g sorbitol, 65-73g mannitol, and the remainder water.
12. The application as described in claim 3, characterized in that, The specific steps of step (6) are as follows: Ⅰ Pick the E. coli obtained in step (5) Escherichia coli Single colonies were cultured in seed culture medium until the bacterial cell concentration reached OD500. 600 The concentration was 0.5–0.6, and the cells were placed on ice to cool. After cooling, the cells were centrifuged and washed 3–5 times with pre-cooled electroporation buffer. The cells were then resuspended in electroporation buffer to obtain competent cells. II. The plasmid pCP20 was transformed into the competent cells obtained in step I by high-voltage electroporation, transferred into liquid resuscitation medium, and cultured at 28–32°C for 12–16 h. After screening, the engineered Escherichia coli strain E was obtained. coli-ΔtLys.
13. The application as described in claim 12, characterized in that, In step I, the seed culture medium has the following components per liter: 8-12g peptone, 4-6g yeast powder, 8-12g sodium chloride, and the remainder water; In step I, the electroporation buffer solution has the following components per liter: Sorbitol 85-96 g, mannitol 85-96 g, glycerol 95-105 mL, balance water; In step I, the conditions for high-voltage electric shock conversion are: 1800 V electric shock for 5 ms; The liquid resuscitation medium in step II has the following components per liter: 8-12g peptone, 4-6g yeast powder, 8-12g sodium chloride, 85-96g sorbitol, 65-73g mannitol, and the remainder water.
14. The engineered Escherichia coli strain E obtained by the application according to any one of claims 1-13. coli-ΔtLys Applications in the production of L-lysine.
Citation Information
Patent Citations
L-lysine gene engineering producing bacterium
CN104878034A
L-lysine genetically engineered production bacteria
CN104878034B
Escherichia coli recombinant strain with high yield of L-lysine and construction method thereof
CN108504617A