Application of an AMPK activator in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells

Abstract

The present invention discloses the application of an AMPK activator in improving the efficiency of differentiating mammalian pluripotent stem cells into definitive endoderm cells, and also discloses a culture medium and a culture method for the in vitro directed differentiation of mammalian pluripotent stem cells into definitive endoderm cells. The culture medium contains a basal medium and an AMPK activator EX229; the culture method is to culture mammalian pluripotent stem cells with the above-mentioned culture medium to enable their directed differentiation into definitive endoderm cells. By adding the AMPK activator EX229 to the basal medium, the present invention improves the efficiency of differentiating mammalian pluripotent stem cells into definitive endoderm cells. The differentiation method provided by the present invention has good repeatability and low cost, and improves the efficiency of differentiating mammalian pluripotent stem cells into definitive endoderm, which provides a more efficient tool for the research on early embryonic development and disease treatment.

Description

Technical Field

[0001] The present invention relates to the fields of stem cells and regenerative medicine, and particularly to the application of an AMPK activator in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells. Background Art

[0002] Embryonic stem cells (ESCs) can be induced to differentiate into three germ layers in vitro and further differentiate into various cells in vivo. When ESCs differentiate into the endoderm, definitive endoderm cells are first obtained by adding Activin A and Wnt3a, and further induced to differentiate into progenitor cells and various adult cells, such as β-cells, hepatocytes, etc. The obtained functional cells can be directly used for cell therapy, or biologically functional organs or tissues can be obtained by 3D printing, so as to be used in research such as organ transplantation, disease model construction, and drug screening.

[0003] AMPK (Adenosine 5‘-monophosphate (AMP)-activated protein kinase) is an AMP-dependent protein kinase and an important molecule regulating intracellular metabolic processes. AMPK participates in regulating almost all physiological and metabolic activities in cells, including: protein metabolism, carbohydrate metabolism, lipid metabolism, as well as autophagy and mitochondrial homeostasis. EX229 is a potent allosteric activator of AMPK, which can effectively increase the kinase activity of AMPK, thereby regulating life activities such as the intracellular metabolic state.

[0004] During the differentiation process of definitive endoderm, the intracellular metabolic level changes significantly, and AMPK also plays an important role in this process. Changing the activity of AMPK during the differentiation process of definitive endoderm is of great significance for improving the differentiation efficiency of definitive endoderm. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of an AMPK activator in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells. Based on the effect of the AMPK activator in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells, the purpose of the present invention is also to provide a culture medium and a culture method for the differentiation of mammalian pluripotent stem cells into definitive endoderm cells.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions:

[0007] In the first aspect of the present invention, there is provided an application of an AMPK activator in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells. The concentration of the AMPK activator is preferably 5-20 mM.

[0008] In a second aspect of the present invention, there is provided a culture medium for differentiating mammalian pluripotent stem cells into definitive endoderm cells, the culture medium comprising: a basal medium, an AMPK activator.

[0009] Further, the culture medium further comprises: Activin A, Wnt3a protein. Even further, the culture medium further comprises fatty acid-free bovine serum albumin and penicillin-streptomycin.

[0010] Further, the concentration of the AMPK activator is preferably 5-20 mM. The concentration of Activin A is preferably 100 ng / mL, the concentration of Wnt3a protein is preferably 25 ng / μL. The concentration of fatty acid-free bovine serum albumin is preferably 0.2%, and the concentration of penicillin-streptomycin is preferably 1%.

[0011] Further, the basal medium is DMEM / F12, IMDM / F12 or DMEM.

[0012] Further, the AMPK activator is EX229.

[0013] Specifically, the mammalian pluripotent stem cells include: one of human pluripotent stem cells, primate pluripotent stem cells, mouse pluripotent stem cells, rat pluripotent stem cells, canine pluripotent stem cells, feline pluripotent stem cells, porcine pluripotent stem cells, bovine pluripotent stem cells and equine pluripotent stem cells.

[0014] In a third aspect of the present invention, there is provided a method for culturing mammalian pluripotent stem cells to differentiate into definitive endoderm cells, the method comprising the following steps: culturing mammalian pluripotent stem cells with the culture medium to differentiate into definitive endoderm cells.

[0015] Further, the method comprises the following steps:

[0016] Culturing mammalian pluripotent stem cells with a stem cell maintenance medium for 3-7 days, digesting and re-seeding them in a well plate coated with Matrigel, and culturing with the stem cell maintenance medium for 1-2 days;

[0017] When the cell density reaches 75-85%, change to the above culture medium for culture to obtain definitive endoderm cells.

[0018] In the above technical solution, the stem cell maintenance medium may specifically be mTeSR™1 or E8 + 1% penicillin-streptomycin, and Matrigel is coated in the well plate at a dilution ratio of 1:100, and the addition ratio can also be appropriately adjusted in other embodiments.

[0019] In the above technical solution, for a 24-well plate, according to 1×105 Inoculate cells at a density per well into a 24-well plate coated with Matrigel; in other embodiments, for different culture dishes, the number of inoculated cells should be appropriately adjusted.

[0020] The CAS number of EX229 of the present invention is 1219739-36-2;

[0021] The present invention has at least the following technical effects or advantages:

[0022] The application of the AMPK activator provided by the present invention in improving the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells. By adding the AMPK activator EX229 to the basal medium, the differentiation efficiency of mammalian pluripotent stem cells into definitive endoderm cells is improved; specifically:

[0023] (1) Adding EX229 to the medium enables a relatively high differentiation efficiency to be achieved when pluripotent stem cells are differentiated for 3 or 4 days, which can shorten the differentiation time.

[0024] (2) The medium provided by the present invention differentiates mammalian pluripotent stem cells into definitive endoderm cells in an efficient and stable manner. This provides high-efficiency research materials for in vitro research on early embryonic development and regenerative medicine, which will greatly promote the research and application of clinical cell therapy and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Quantitative PCR results showing the effect of EX229 on the expression of endoderm differentiation marker genes in human embryonic stem cells for comparison between Example 1 and Comparative Example 1;

[0026] Figure 2 Flow cytometry results showing the effect of EX229 on the positive rate of endoderm differentiation in human embryonic stem cells for comparison between Example 1 and Comparative Example 1;

[0027] Figure 3 Immunofluorescence results showing the effect of EX229 on the expression of endoderm differentiation marker genes in human embryonic stem cells for comparison between Example 1 and Comparative Example 1;

[0028] Figure 4 Flowchart of the culture method for differentiating mammalian pluripotent stem cells of the present invention into definitive endoderm cells. DETAILED DESCRIPTION OF THE INVENTION

[0029] In order to more clearly demonstrate the advantages and various effects of the present invention, the present invention will be described below in combination with specific embodiments and examples. For those skilled in the art, these specific embodiments and examples are used to illustrate the present invention rather than limit the present invention.

[0030] The terms used in this specification, unless otherwise specified, should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as the general understanding of those skilled in the art to which this invention pertains. In case of any contradiction, this specification shall prevail.

[0031] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchases or by existing methods.

[0032] The following will, in conjunction with examples, comparative examples, and experimental data, elaborate in detail on a culture medium and a culture method for differentiating mammalian pluripotent stem cells into definitive endoderm cells according to this application.

[0033] Example 1

[0034] 1. A culture medium for differentiating human pluripotent stem cells into definitive endoderm cells

[0035] This culture medium is based on DMEM / F12 and further includes the following components: 100 ng / mL Activin A, 25 ng / μL Wnt3a, 0.2% fatty acid-free bovine serum albumin, 1% double antibody, and 5, 10, or 20 mM EX229.

[0036] 2. A culture method for differentiating human pluripotent stem cells into definitive endoderm cells, using the above culture medium for culturing, specifically including the following steps:

[0037] (1) Human embryonic stem cell line HUES8 (Cowan CA, Klimanskaya I, McMahon J, Atienza J, Witmyer J, Zucker JP, Wang S, Morton CC, McMahon AP, Powers D, Melton DA. Derivation of embryonic stem-cell lines from human blastocysts. N Engl J Med. 2004 Mar 25;350(13):1353 - 6. doi: 10.1056 / NEJMsr040330.) was cultured using mTeSR™1 + 1% double antibody as the stem cell maintenance medium on Matrigel (BD Bioscience) at a 1:100 dilution ratio.

[0038] (2) When the human embryonic stem cells in step (1) are cultured to a cell density of about 80%-90% of the bottom area of the well plate, dead cells are washed away with DPBS, and then incubated with Accutase in a 37°C cell culture incubator for about 3 minutes until the cells are observed to be spherical under a microscope. DMEM / F12 medium is added to terminate digestion and the cells are resuspended by pipetting. The cells are centrifuged at 1000 rpm for 3 min, and then the cell pellet is resuspended with mTeSR™1 + 1% double antibody. After counting, the cells are seeded into a 24-well plate coated with Matrigel at a density of 1×10 5 per well.

[0039] (3) When the cells in step (2) are cultured for 1-2 days until the cell density reaches about 80% of the bottom area of the well plate, the above freshly prepared medium is replaced to start definitive endoderm differentiation, denoted as differentiation D0.

[0040] (4) The fresh above-mentioned medium is replaced every 24 hours, and definitive endoderm cells can be obtained at D3.

[0041] Comparative Example 1

[0042] In this Comparative Example 1, except that EX229 is not added to the differentiation medium, other steps are the same as those in Example 1.

[0043] Experimental Example 1

[0044] The mRNA level or differentiation efficiency of the marker genes of the definitive endoderm cells obtained in each example and each comparative example was detected.

[0045] I. The detection method is as follows:

[0046] 1. Detect the mRNA level of the marker genes of the definitive endoderm cells obtained by real-time fluorescence quantitative PCR:

[0047] (1) Cell collection

[0048] The definitive endoderm cells differentiated at D3 above are washed with DPBS to remove dead cells, and then TrypLE is added and incubated in a 37°C cell culture incubator for 1 min. DMEM / F12 medium is gently pipetted to terminate digestion, and the cells are collected in a 1.5 mL EPP tube, centrifuged at 4°C and 3000 rpm for 3 min, and the supernatant is aspirated to obtain a cell pellet.

[0049] (2) Total cell RNA extraction

[0050] The total RNA of the cells was extracted using the Total RNA Mini Kit (double-column type) from Vazyme Biotech Co., Ltd. The specific operation steps are as follows:

[0051] Take an appropriate amount of Buffer RL and add it to the cell pellet, then pipette and mix well. Transfer the above liquid to the gDNA filter column and centrifuge at 14,000 g for 2 min; discard the gDNA filter column, add an equal volume of 70% ethanol and pipette to mix evenly; transfer the above liquid to the RNA purification column, centrifuge at 12,000 g for 1 min, and discard the filtrate; reinstall the RNA purification column into the collection tube, add 500 μL of Buffer RW1 to the RNA purification column, centrifuge at 12,000 g for 1 min, and discard the filtrate; reinstall the RNA purification column into the collection tube, add 500 μL of Buffer RW2 to the RNA purification column, centrifuge at 12,000 g for 1 min, and discard the filtrate; reinstall the RNA purification column into the collection tube, add 500 μL of Buffer RW2 to the RNA purification column, centrifuge at 12,000 g for 1 min, and discard the filtrate; reinstall the RNA purification column into the collection tube, centrifuge at 12,000 g for 2 min, transfer the RNA purification column to a new 1.5 mL EP tube, add 30 μL of RNase-Free Water to the center of the purification column, and let it stand at room temperature for 2 min; centrifuge at 12,000 g for 1 min, discard the filter column, detect the RNA concentration and quality, and store at -80 °C. The above steps are all carried out on ice.

[0052] (3)Reverse transcription to obtain cDNA

[0053] Use the Abclonal reverse transcription kit to prepare cDNA. The specific operation steps are as follows:

[0054] Add 4 μL of Abclonal's 5× qRT SuperMix and 1 μg of the above-obtained RNA to an EP tube, add RNase-Free Water to make the volume up to 20 μL, mix well and centrifuge with a handheld centrifuge until the liquid accumulates at the bottom of the tube, and perform reverse transcription reaction in a Bio-rad PCR instrument. The reverse transcription conditions are 25 °C for 5 min; 42 °C for 20 min; 85 °C for 5 sec, and store at -20 °C after completion.

[0055] (4)Real-time fluorescence quantitative PCR

[0056] Add 20 ng of the above cDNA, 5 μL of Bimake 2× SYBR Green qPCR MasterMix, 0.5 μL of 5 μM forward primer, and 0.5 μL of 5 μM reverse primer to each well of a 384-well plate, add RNase-Free Water to make the volume up to 10 μL; use a Bio-rad CFX384 quantitative PCR instrument for amplification. The reaction conditions are: 95 °C for 5 min, 95 °C for 15 s, 60 °C for 30 s, repeat 39 cycles. The experimental results are analyzed using the ΔΔCT method compared with the housekeeping gene GAPDH.

[0057] The primer sequences used in this experiment are as follows:

[0058] GAPDH Forward primer: AATGAAGGGGTCATTGATGG (shown as SEQ ID NO.1), reverse primer: AAGGTGAAGGTCGGAGTCAA (shown as SEQ ID NO.2);

[0059] FOXA2 Forward primer: GGAGCAGCTACTATGCAGAGC (shown as SEQ ID NO.3), reverse primer: CGTGTTCATGCCGTTCATCC (shown as SEQ ID NO.4);

[0060] SOX17 Forward primer: GCATGACTCCGGTGTGAATCT (shown as SEQ ID NO.5), reverse primer: TCACACGTCAGGATAGTTGCAGT (shown as SEQ ID NO.6);

[0061] CXCR4 Forward primer: TACACCGAGGAAATGGGCTCA (shown as SEQ ID NO.7), reverse primer: AGATGATGGAGTAGATGGTGGG (shown as SEQ ID NO.8).

[0062] 2. Detect the differentiation efficiency of human embryonic stem cells into definitive endoderm by flow cytometry.

[0063] Wash the specified definitive endoderm cells obtained from the above differentiation with DPBS to remove dead cells, then add TrypLE and incubate in a 37 °C cell culture incubator for 1 min. Gently pipette the cells with DPBS + 2% FBS to terminate digestion, divide the cells evenly and collect them in two 1.5 mL EP tubes, centrifuge at 4 °C and 3000 rpm for 3 min, and aspirate the supernatant. Dilute the CXCR4-APC, SOX17-FITC, and APC-Isotype (negative control group) antibodies with DPBS + 2% FBS at a dilution ratio of 1:200. Take 200 μL of the diluted antibody each to disperse and mix the cell pellet, and incubate in the dark on ice for 30 min. Centrifuge at 4 °C and 3000 rpm for 3 min, discard the supernatant, resuspend the cells with DPBS + 2% FBS, centrifuge at 4 °C and 3000 rpm for 3 min, and discard the supernatant. Finally, resuspend the cells with ice-cold DPBS and transfer them to a flow tube, and detect the positive rate of CXCR4 by flow cytometry. The antibodies used in this experiment are Anti-CXCR4 (555976, 1:200, BD Biosciences) and Anti-SOX17 (AF1924, 1:200, R&D).

[0064] 3. Detect the differentiation efficiency of human embryonic stem cells into definitive endoderm by immunofluorescence:

[0065] Wash the specified definitive endoderm cells obtained from the above differentiation with DPBS to remove dead cells, add an appropriate amount of 4% PFA to each well, incubate at room temperature for 15 min, and wash once with DPBS; add an appropriate amount of blocking solution (8.7 mL DPBS + 1 mL donkey serum + 0.3 mL 10% Triton-X100) to each well, incubate at room temperature for 30 min; discard the blocking solution, add an appropriate amount of primary antibody diluted with the blocking solution, incubate at room temperature for 2 h, and wash three times with DPBS, 5 min each time; discard the DPBS, add an appropriate amount of secondary antibody diluted with the blocking solution, incubate in the dark at room temperature for 2 h, and wash three times with DPBS, 5 min each time; discard the DPBS, add an appropriate amount of DAPI diluted with DPBS, incubate in the dark at room temperature for 10 min, and wash once with DPBS; finally, soak the cells with DPBS, place them under an inverted fluorescence microscope for fluorescence observation and collect pictures. The primary antibodies used in this experiment are Anti-FOXA2 (ET1703-76, 1:200, HuaBio); Anti-OCT4 (sc-5279, 1:200, SANTA CRUZ). The fluorescent secondary antibodies used in this experiment are DoαMs TRITC (1:200, Jackson ImmunoResearch); DoαRb 488 (1:200, Jackson ImmunoResearch); nuclear dye: DAPI (Roche, USA).

[0066] II. Test Results and Analysis

[0067] 1. Example 1 and Comparative Example 1

[0068] Detect the mRNA and protein expression levels of definitive endoderm marker genes in the cells of Example 1 and Comparative Example 1. The specific results are shown in Figures 1-3 .

[0069] Figure 1 For the mRNA expression levels of the definitive endoderm marker genes FOXA2 , SOX17 , CXCR4 in Example 1 and Comparative Example 1, where "EX229 - 0 μM" is Comparative Example 1. The results show that after adding 5, 10, and 20 μM of EX229 in Example 1, the expression levels of FOXA2 increased by 1.5, 1.5, and 1.4 times compared with 1-fold of the comparative example, SOX17 the expression levels of CXCR4 increased by 1.5, 1.6, and 1.6 times,

[0070] Figure 2 For the flow cytometry results of the proportion of double-positive cells of the definitive endoderm marker genes SOX17 and CXCR4 in Example 1 and Comparative Example 1. Compared with the 35% positive rate of the comparative example "EX229 - 0 μM", with the addition of EX229 in Example 1, SOX17 and CXCR4 the proportion of double-positive cells increased significantly in a concentration-dependent manner. When the added concentration of EX229 was 20 μM, the proportion of double-positive cells in the example increased by 20%.

[0071] Figure 3 For the immunofluorescence results of the proportion of positive cells of the definitive endoderm marker gene FOXA2 and the pluripotency marker gene OCT4 in Example 1 and Comparative Example 1. The results show that compared with Comparative Example 1, after adding EX229 during the differentiation process, the positive rate of the pluripotency gene OCT4 decreased significantly, and the positive rate of the definitive endoderm marker gene FOXA2 increased significantly 。

[0072] Figures 1-3 All the results of

[0073] Finally, it should also be noted that the term "comprise", "include" or any other variation thereof is intended to cover non-exclusive inclusion, such that a process, method, article or apparatus comprising a series of elements not only includes those elements but also includes other elements not expressly listed, or elements inherent to such process, method, article or apparatus.

[0074] Although the preferred embodiments of the present invention have been described, additional changes and modifications can be made by those skilled in the art once they learn of the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications that fall within the scope of the present invention.

[0075] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. Use of an AMPK activator in enhancing the efficiency of differentiation of human pluripotent stem cells into definitive endoderm cells in vitro, characterized in that: The AMPK activator described above is EX229; the human pluripotent stem cells are human embryonic stem cells HUES8.

2. The application according to claim 1, characterized in that, The concentration of the AMPK activator described above is 5 - 20 mM.

3. A culture medium for differentiating human pluripotent stem cells into definitive endoderm cells, characterized in that, The culture medium described above contains: basal medium DMEM / F12, 100 ng / mL Activin A, 25 ng Wnt3a, 0.2% fatty acid-free bovine serum albumin, 1% double antibody, 5 - 20 mM EX229.

4. A culture method for differentiating human pluripotent stem cells into definitive endoderm cells, characterized in that, The method described above includes the following steps: culturing human pluripotent stem cells with the culture medium described in claim 3 to direct their differentiation into definitive endoderm cells; the human pluripotent stem cells are human embryonic stem cells HUES8.

5. The culture method for differentiating human pluripotent stem cells into definitive endoderm cells according to claim 4, wherein The method described above includes the following steps: culturing human pluripotent stem cells with a stem cell maintenance medium, and when the cell density reaches 75 - 85%, replacing it with the culture medium described in claim 3 for culture to obtain definitive endoderm cells.

Images