A mixed epithelial-mesenchymal phenotype tumor cell model based on the bidirectional regulation function of keratin 5 and its construction method

Abstract

The present invention discloses a mixed epithelial-mesenchymal phenotype tumor cell model based on the bidirectional regulatory function of keratin5, belonging to the technical field of tumor models. The model is a stable mixed E / M phenotype cell model obtained by knocking down the keratin5 gene in epithelial cells. The present invention also discloses a method for constructing the above model. The mixed E / M phenotype cells in the cell model of the present invention have significantly enhanced stemness, in vitro migration and invasion capabilities, and resistance to the chemotherapy drug cisplatin, thereby facilitating the study of tumor invasion and metastasis.

Description

Technical Field

[0001] The present invention relates to the technical field of tumor models, and in particular to a mixed epithelial-mesenchymal phenotype tumor cell model based on the bidirectional regulatory function of keratin 5 and a construction method thereof. Background Art

[0002] Epithelial-mesenchymal plasticity, which includes reversible transitions between epithelial, mixed epithelial / mesenchymal (E / M), and mesenchymal phenotypes, underlies various aspects of aggressive tumor progression, such as metastasis, therapeutic resistance, and immune evasion. The process by which cells acquire one or more mixed E / M phenotypes is called partial epithelial-mesenchymal transition (partial EMT). Cells with a mixed E / M phenotype may be more stem and invasive than cells with a complete epithelial or mesenchymal phenotype. Therefore, in tumor research systems, obtaining a stable mixed epithelial / mesenchymal phenotype (E / M) cell model is crucial for the study of tumor invasion and metastasis. The key lies in deciphering the key regulators of the mixed E / M phenotype, which act as resistors for phenotypic plasticity and accelerators for subsequent tumor invasion and metastasis.

[0003] However, there are no reports on cell models with the above functions. Summary of the Invention

[0004] One of the objectives of the present invention is to provide a mixed epithelial-mesenchymal phenotype tumor cell model based on the bidirectional regulatory function of keratin 5 to solve the above problems.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: a mixed epithelial-mesenchymal phenotype tumor cell model based on the bidirectional regulatory function of keratin 5, wherein the model is a stable mixed E / M phenotype cell model obtained by knocking down the keratin 5 gene in epithelial cells.

[0006] The inventors of this application have found the keratin 5 gene through extensive research. The gene sequence is as follows:

[0007] atgtctcgcc agtcaagtgt gtccttccgg agcgggggca gtcgtagctt cagcaccgcc

[0008] tctgccatca ccccgtctgt ctcccgcacc agcttcacct ccgtgtcccg gtccgggggt

[0009] ggcggtggtg gtggcttcgg cagggtcagc cttgcgggtg cttgtggagt gggtggctat

[0010] ggcagccgga gcctctacaa cctgggggc tccaagagga tatccatcag cactagtggt

[0011] ggcagcttca ggaaccggtt tggtgctggt gctggaggcg gctatggctt tggaggtggt

[0012] gccggtagtg gatttggttt cggcggtgga gctggtggtg gctttgggct cggtggcgga

[0013] gctggctttg gaggtggctt cggtggccct ggctttcctg tctgccctcc tggaggtatc

[0014] caagaggtca ctgtcaacca gagtctcctg actcccctca acctgcaaat cgaccccagc

[0015] atccagaggg tgaggaccga ggagcgcgag cagatcaaga ccctcaacaa taagtttgcc

[0016] tccttcatcg aaaggtgcg gttcctggag cagcaagaa aggttctgga caccaagtgg

[0017] accctgctgc aggagcaggg caccaagact gtgaggcaga acctggagcc gttgttcgag

[0018] footcatca aaacctcag gaggcagctg gacagcatcg tgggggaacg gggccgcctg

[0019] gactcagagc tgagaaacat gcaggacctg gtggaagaact tcaagaacaa gtatgaggat

[0020] gaaatcaaca agcgtaccac tgctgagaat gagtttgtga tgctgaagaa ggatgtagat

[0021] gctgcctaca tgaacaaggt ggagctggag gccaaggttg atgcactgat ggatgagatt

[0022] aacttcatga agatgttctt tgatgcggag ctgtcccaga tgcagacgca tgtctctgac

[0023] acctcagtgg tcctctccat ggacaacaac cgcaacctgg acctggatag catcatcgct

[0024] gaggtcaagg cccagtatga ggagattgcc aaccgcagcc ggacagaagc cgagtcctgg

[0025] tatcagacca agtatgagga gctgcagcag acagctggcc ggcatggcga tgacctccgc

[0026] aacaccaagc atgagatctc tgagatgaac cggatgatcc agaggctgag agccgagatt

[0027] gacaatgtca agaaacagtg cgccaatctg cagaacgcca ttgcggatgc cgagcagcgt

[0028] ggggagctgg ccctcaagga tgccaggaac aagctggccg agctggagga ggccctgcag

[0029] aaggccaagc aggacatggc ccggctgctg cgtgagtacc aggagctcat gaacaccaag

[0030] ctggccctgg acgtggagat cgccacttac cgcaagctgc tggagggcga ggaatgcaga

[0031] ctcagtggag aaggagttgg accagtcaac atctctgttg tcacaagcag tgtttcctct

[0032] ggatatggca gtggcagtgg ctatggcggt ggcctcggtg gaggtcttgg cggcggcctc

[0033] ggtggaggtc ttgccggagg tagcagtgga agctactact ccagcagcag tggggggtgtc

[0034] ggcctaggtg gtgggctcag tgtggggggc tctggcttca gtgcaagcag tggccgaggg

[0035] ctgggggtgg gctttggcag tggcgggggt agcagctcca gcgtcaaatt tgtctccacc

[0036] acctcctcct cccggaagag cttcaagagc taa

[0037] This gene is a bidirectional regulator of E / M, capable of suppressing the complete epithelial or mesenchymal phenotype of tumor cells, thereby stabilizing the cells in a mixed E / M phenotype. By knocking down the keratin 5 gene in epithelial cells, a stable mixed E / M phenotype cell model was established and validated at the cellular, animal, and clinical levels.

[0038] Experiments have demonstrated that knockdown of keratin 5 in epithelial cells promotes EMT while retaining some of the original epithelial phenotype, successfully creating stable hybrid E / M phenotype cells. These hybrid E / M phenotype cells exhibited significantly enhanced stemness, in vitro migration and invasion capabilities, and resistance to the chemotherapy drug cisplatin. In animal models, in vivo experiments in nude mice, the constructed stable hybrid E / M phenotype cells demonstrated statistically significant enhancements in in vivo tumorigenicity and invasion and metastasis compared to the control group. Clinical data analysis demonstrated that keratin 5 expression was significantly correlated with lymph node metastasis in patients with related tumors.

[0039] The second object of the present invention is to provide a method for constructing a mixed epithelial-mesenchymal phenotype tumor cell model based on the bidirectional regulatory function of keratin 5. The technical solution adopted is: when knocking down the keratin 5 gene in epithelial cells, shKRT5-1, shKRT5-2, and shKRT5-3 shRNA interference vectors having the nucleotide sequences shown in SEQ.ID NO: 2 (CCAGAGGAGTTGGACCAGTCAACATCTCGAGATGTTGACTGGTCCAACTCCTTT TTTTG), SEQ.ID NO: 3 (CCGGGCTTGTGGAGTGGGTGGCTATCTCGAGATAGCCACCCACTCCACAAGCTT TTTG) and SEQ.ID NO: 4 (CCGGCCGCAGTTCTATATTCTGCTTCTCGAGAAGCAGAATATAGAACTGCGGTT TTTG) are used for knockdown.

[0040] The present invention constructed three shRNA interference vectors to knock down keratin 5, which were named shKRT5-1, shKRT5-2, and shKRT5-3. The western blot results were as follows: Figure 1 As shown, the three interference vectors can effectively knock down the expression of keratin 5. In the following examples, the inventors selected shKRT5-1 for subsequent cell level, animal level and clinical data research, namely the following examples and figures (except Figure 1 "shKRT5" in the table (excluding the rest) refers to knockdown results using shKRT5-1. Keratin 5 counterstaining with DAPI also confirmed effective knockdown of keratin 5 in both cell lines.

[0041] As a preferred technical solution, the specific construction steps include:

[0042] 1. Synthesis of recombinant sequences and construction and identification of shKRT5 plasmid;

[0043] 2. Amplify shKRT5-1, shKRT5-2, and shKRT5-3 monoclonal bacterial cultures;

[0044] 2.1 Preparation of LB liquid medium: Weigh 0.5 g yeast powder, 1 g peptone, and 1 g sodium chloride into a conical flask, add 100 mL of distilled water, wrap the conical flask mouth with gauze, and sterilize at 121°C for 20 minutes. After cooling, add 100 μL of ampicillin (Amp) at an effective concentration of 100 μg / mL.

[0045] 2.2 Incubate the prepared LB liquid medium on a shaker at 250 rpm and 37°C for 0.5 h;

[0046] 2.3 Take 200 μL of shKRT5-1, shKRT5-2, and shKRT5-3 monoclonal bacterial suspension and inoculate them into three Erlenmeyer flasks containing LB liquid medium respectively, and shake them on a shaker at 250 rpm and 37°C overnight;

[0047] 3.Extract shKRT5 plasmid using Hispeed Plasmid Midi kit;

[0048] 3.1 Collect the bacterial suspension into a 50 mL centrifuge tube and centrifuge at 6000 g for 15 min at 4°C to remove the supernatant.

[0049] 3.2 Add 6 mL of P1 solution and mix by pipetting repeatedly until the precipitate is completely dissolved. Add 6 mL of P2 solution, cover the centrifuge tube and mix by inverting 4-6 times. Let stand at room temperature for 5 minutes. If necessary, add LyseBlue liquid until the liquid turns blue.

[0050] 3.3 Add 6 mL of P3 solution and mix thoroughly by inversion until the liquid turns colorless. Pour the solution into the QIA filter cartridge and incubate at room temperature for 10 min.

[0051] 3.4 Prepare a QIAGEN-tip column, add 4 mL of QBT buffer and allow it to flow naturally. After the QBT buffer has flowed through, pressure filter the liquid in the QIA filter cartridge into the tip column and allow it to flow naturally.

[0052] 3.5 Add 20 mL of QC to wash the tip filter column;

[0053] 3.6 Add 5 mL of QF to elute and collect the plasmid DNA in a clean 15 mL centrifuge tube;

[0054] 3.7 Add 3.5 mL of isopropanol, mix thoroughly, and let stand at room temperature for 5 minutes;

[0055] 3.8 Filter the solution through a filter membrane to allow the plasmid DNA to adsorb onto the membrane. Add 2 mL of 70% ethanol to filter and wash the membrane. Repeat the washing process twice.

[0056] 3.9 Add 800 μL of DEPC water to dissolve the DNA and detect the plasmid concentration using Nano Drop.

[0057] 4. Lentiviral Packaging

[0058] 4.1 Collect 293T cells by centrifugation, count the cells, and seed 2 million cells per 10 cm dish. Incubate the cells in a 37°C 5% CO2 cell culture incubator for 24 h.

[0059] 4.2 Prepare a viral plasmid mixture at a ratio of 3:2.7:0.3 for viral plasmid:dR8.9. Add 580 μL of opti-MEM to the plasmid mixture and incubate at room temperature for 5 minutes. Then add 18 μL of X-tremeGene HP DNA Transfection Reagent and incubate at room temperature for 15 minutes. After incubation, add the mixture to 293T cells and culture at 37°C, 5% CO2 for 10 hours. Then, switch to 20% FBS complete medium.

[0060] 4. After 24 hours, collect the supernatant into a 15 mL centrifuge tube and freeze at -80°C. Add 9 mL of 20% FBS complete medium and continue culturing for 48 hours. Collect the supernatant for the second time and mix it with the first supernatant. Centrifuge at 1500 rpm for 5 minutes, collect the supernatant, and aliquot. After aliquoting, freeze at -80°C for later use.

[0061] 5. Tumor Cell Transfection and Positive Screening

[0062] 5.1 Digest and collect tumor cells, count the cells, and seed 200,000 cells per 10 cm dish. Add complete culture medium and culture in a 37°C 5% CO2 cell culture incubator for 24 h.

[0063] 5.2 Take a 15 mL centrifuge tube and add 9 mL of culture medium without anti-antibody 10% FBS, 1 mL of packaged virus, and 10 μL of 10 μg / mL polybrene. Mix well and add to the culture dish containing tumor cells and incubate.

[0064] 5.3 24 hours after transfection, replace the culture medium with fresh complete culture medium containing penicillin-streptomycin sulfate and puromycin 2 μg / mL for screening.

[0065] Compared with the existing technology, the advantages of the present invention are that the mixed E / M phenotype cell stemness, in vitro migration and invasion ability, and resistance to the chemotherapy drug cisplatin of the cell model of the present invention are significantly enhanced, thereby facilitating the study of tumor invasion and metastasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 Results of keratin 5 (KRT5) gene knockdown in head and neck squamous cell carcinoma cell lines FaDu and CAL 27. Figure 1 In the middle, the left side shows the fluorescence morphology of Keratin 5 and DAPI counterstaining; the right side shows the western blot experimental results of Keratin 5 protein;

[0067] Figure 2Western blot results of the changes in expression of epithelial (E) / mesenchymal (M) related indicator proteins before and after keratin 5 knockdown in FaDu and CAL 27 cells;

[0068] Figure 3 The results of flow cytometry analysis of stem cell surface markers before and after keratin 5 knockdown in FaDu and CAL 27 cells are shown;

[0069] Figure 4 ELISA analysis results of IL-6 in the supernatant of FaDu and CAL 27 cells before and after keratin 5 knockdown (***p<0.001), and western blot results of VEGFA expression and Stat3 signaling pathway protein expression;

[0070] Figure 5 The results of in vitro migration scratch assay of FaDu and CAL 27 cells before and after keratin 5 knockdown (**p<0.01);

[0071] Figure 6 The results of in vitro invasion transwell assays of FaDu and CAL 27 cells before and after keratin 5 knockdown (**p<0.01);

[0072] Figure 7 The results of CCK-8 assays are shown for the sensitivity of FaDu and CAL 27 cells to cisplatin before and after keratin 5 knockdown.

[0073] Figure 8 These are the western blot results of NF-κb signaling pathway protein expression before and after keratin 5 knockdown in FaDu and CAL 27 cells and the results of PDTC-sensitive CCK-8 experiments.

[0074] Figure 9 These are the results of in vivo tumorigenesis experiments in nude mice using FaDu and CAL 27 cells before and after keratin 5 knockdown (*p<0.05, **p<0.01, ***p<0.001).

[0075] Figure 10 These are the results of in vivo invasion and metastasis experiments of FaDu and CAL 27 cells injected into the tail vein of nude mice before and after keratin 5 knockdown (**p<0.01).

[0076] Figure 11 The results of the TCGA head and neck squamous cell carcinoma sample data analysis were used to analyze the correlation between KRT5 expression and lymph node metastasis in patients with head and neck squamous cell carcinoma.

[0077] In the above figures, “scramble” refers to the control example before knockdown. DETAILED DESCRIPTION

[0078] The present invention will be further described below with reference to the accompanying drawings.

[0079] Example 1

[0080] Construction and identification of a mixed epithelial-mesenchymal phenotype tumor cell model based on the bidirectional regulation function of keratin 5

[0081] 1.1 Construction of a mixed epithelial-mesenchymal phenotype tumor cell model based on the bidirectional regulation of keratin 5

[0082] 1.1.1 Synthesis of recombinant sequences and construction and identification of shKRT5 plasmid. The specific experimental process is as follows:

[0083] 1.1.1.1 Synthesize 38 primers based on the target sequence

[0084] 1.1.1.2 PCR to obtain the cloned target sequence

[0085] a. One round of full-length PCR

[0086] Reaction system: 0.5 μL of each primer 1-38 (FVCD0029331-1_1817-38) at approximately 50 pmol / μL, 0.5 μL of polymerase (PV2), 10 μL of 5× PV2 buffer, 1 μL of 10 mM dNTPs, and ddH2O to 50 μL.

[0087] Reaction program: 95°C for 3 min, [95°C for 25 s, 62°C for 20 s, 72°C for 40 s, for a total of 25 cycles], 72°C for 1 min, and end at 4°C;

[0088] b. Second round of full-length PCR

[0089] Reaction system: template PCR product (about 100 ng / μL) 0.3 μL, primer 1 FVCD0029331-1_1 (about 50 pmol / μL) 0.5 μL, primer 2 FVCD0029331-1_38 (about 50 pmol / μL) 0.5 μL, polymerase pv2 0.5 μL, 5× PV2 buffer 10 μL, 10 mM dNTP 1 μL, ddH2O added to 50 μL;

[0090] Reaction program: 95°C for 3 min, [95°C for 25 s, 62°C for 20 s, 72°C for 40 s, for a total of 25 cycles], 72°C for 1 min, and 4°C until the end;

[0091] 1.1.1.3 Recover the PCR product from step 1.1.1.2.1 above by gel (refer to Axygen product manual) and prepare for the ligation experiment; run the PCR product on the gel strip to confirm the product (theoretical size 1846 bp).

[0092] 1.1.1.4 Recombination and ligation experiments

[0093] Simultaneously with PCR, the pLVX-puro plasmid was treated with EcoRI / XbaI, recovered on gel, and confirmed by running the gel bands (theoretical size 8059 kb);

[0094] Recombination reaction system: 4 μL of the gel-recovered product from step 1.1.1.3, 3.5 μL of pLVX-puro (linearized vector), and 2.5 μL of recombinase;

[0095] Place in a 50°C water bath for 25 minutes, let stand for 2-3 minutes to lower the temperature, perform transformation and bacterial liquid coating experiments, and incubate at 37°C overnight.

[0096] 1.1.1.5 Colony screening experiment a. Pick a single colony from the overnight plate;

[0097] b. Colony PCR was performed using primers FVCD0029331-1_1 / FVCD0029331-1_38; PCR bands were confirmed (theoretical size 1846 bp);

[0098] c. Identify positive clones by electrophoresis;

[0099] d. Randomly select 4 positive bacteria and culture them in a 4 mL single tube at 37°C in a shaker overnight.

[0100] 1.1.1.6 Extract plasmid and send for sequencing. Extract the plasmid from the overnight bacterial solution in 1.1.1.5 and send for sequencing.

[0101] Positive bacterial suspension was sequenced using the following primers:

[0102] CMV-F CGCAAATGGGCGGTAGGCGTG

[0103] PLVX-puro-seqR CCATTGCTCAGCGGTGCTGT

[0104] VCD0029331-1-SEQ2 TAGTGGATTTGGGTTTCGGCG

[0105] VCD0029331-1-SEQ3 TGATGGATGAGATTAACTTC

[0106] 1.1.1.7 Obtaining the Correct Plasmid

[0107] 1.1.1.8 Obtain monoclonal bacterial suspension: Use a 10 μL autoclaved pipette tip to pick out three correctly sequenced single colonies and place them into a 15 mL centrifuge tube. Add 5 mL of LB liquid medium containing antibiotics and shake overnight on a shaker at 250 rpm and 37°C. Name them shKRT5-1, shKRT5-2, and shKRT5-3, respectively.

[0108] 1.1.2 Amplify the monoclonal bacterial solution shKRT5-1, shKRT5-2, and shKRT5-3 (the monoclonal bacterial solution from step 1.1.1.8 was provided by Beijing Qingke Biotechnology Co., Ltd.);

[0109] Weigh 0.5 g of yeast powder, 1 g of peptone, and 1 g of sodium chloride into a conical flask, add 100 mL of distilled water, wrap the conical flask mouth with gauze, sterilize at 121 ° C for 20 minutes, add 100 μL of ampicillin (Amp) after cooling, and incubate the prepared LB liquid medium on a shaking incubator (SYK-2102C) at 250 rpm and 37 ° C for 0.5 h; take 200 μL of shKRT5-1, shKRT5-2,

[0110] The shKRT5-3 monoclonal bacterial solution (the monoclonal bacterial solution from step 1.1.1.8 was provided by Beijing Qingke Biotechnology Co., Ltd.) was inoculated into three conical flasks containing LB liquid medium and shaken overnight on a shaking incubator (SYK-2102C) at 250 rpm and 37°C.

[0111] 1.1.3. Extraction of shKRT5 plasmid using Hispeed Plasmid Midi kit (QIAGEN):

[0112] 1.1.3.1 Collect the bacterial suspension into a 50 mL centrifuge tube and centrifuge at 6000 g for 15 min at 4°C in a Beckman Avanti J-26SXP centrifuge. Remove the supernatant.

[0113] 1.1.3.2 Add 6 mL of P1 solution and mix by pipetting repeatedly until the precipitate is completely dissolved. Add 6 mL of P2 solution, cover the tube, and mix by inverting 4-6 times. Let stand at room temperature for 5 minutes. Add LyseBlue solution until the solution turns blue.

[0114] 1.1.3.3 Add 6 mL of P3 solution and mix thoroughly by inversion until the liquid turns colorless. Pour the solution into the QIA filter cartridge and incubate at room temperature for 10 min.

[0115] 1.1.3.4 Prepare a QIAGEN-tip column, add 4 mL of QBT buffer and allow it to flow naturally. After the QBT buffer has flowed through, pressure filter the liquid from the QIA filter cartridge into the tip column and allow it to flow naturally.

[0116] 1.1.3.5 Add 20 mL of QC to wash the tip filter column;

[0117] 1.1.3.6 Add 5 mL of QF to elute and collect the plasmid DNA in a clean 15 mL centrifuge tube;

[0118] 1.1.3.7 Add 3.5 mL of isopropyl alcohol, mix thoroughly by inversion, and let stand at room temperature for 5 minutes;

[0119] 1.1.3.8 Filter the solution through a filter membrane to allow the plasmid DNA to adsorb onto the membrane. Add 2 mL of 70% ethanol and wash the membrane. Repeat the wash twice.

[0120] 1.1.3.9 Add 800 μL of DEPC water to dissolve the DNA and measure the plasmid concentration using Nano Drop.

[0121] 1.1.4 Lentiviral packaging

[0122] 1.1.4.1 Collect 293T cells by centrifugation, count the cells, and seed 2 million cells per 10 cm dish. Incubate the cells in a 37°C 5% CO2 cell culture incubator (Thermo) for 24 h until ready for use.

[0123] 1.1.4.2 Prepare a viral plasmid mixture at a ratio of 3:2.7:0.3 (dR8.9 and VSV-G were provided by Beijing Qingke Biotechnology Co., Ltd.). Add 580 μL of opti-MEM (Gibco: 31985-062) to the plasmid mixture and incubate at room temperature for 5 min. Add 18 μL of X-tremeGene HP DNA Transfection Reagent (Roche: 51572200) and incubate at room temperature for 15 min. After incubation, add the mixture to 293T cells and culture in a 37°C 5% CO2 cell culture incubator (Thermo) for 10 h. Then, switch to 20% FBS complete medium (Gibco).

[0124] 1.1.4.3 After 24 hours, collect the supernatant into a 15 mL centrifuge tube and freeze at -80°C. Add 9 mL of 20% FBS complete medium and continue culturing for 48 hours. Collect the supernatant for the second time and mix it with the first supernatant. Centrifuge at 1500 rpm for 5 minutes. Collect the supernatant and aliquot it. After aliquoting, freeze it at -80°C until use.

[0125] 1.1.5. Tumor cell transfection and positive screening

[0126] 1.1.5.1 Tumor cells were digested and collected, and the cells were counted. 200,000 cells were seeded into 10 cm dishes. Complete culture medium was added and the dish was incubated at 37°C with 5% CO2 in a Thermo cell culture incubator for 24 h.

[0127] 1.1.5.2 Take a 15 mL centrifuge tube and add 9 mL of culture medium containing 10% FBS without anti-antibodies, 1 mL of packaged virus, and 10 μL of 10 μg / mL polybrene. Mix well and add to the culture dish containing tumor cells and incubate.

[0128] 1.1.5.3 24 hours after transfection, replace the culture medium with fresh complete culture medium containing penicillin-streptomycin sulfate (BOSTER: PYG0016) and puromycin (biofroxx) 2 μg / mL for screening.

[0129] 1.2 Immunofluorescence staining to identify the results of keratin 5 knockdown in tumor cells

[0130] 1.2.1 Cell inoculation: Digest and collect cells in the logarithmic growth phase, count them, and adjust the cell concentration to 2.5×10 5 / mL; 200 μL of cell suspension was inoculated into the 15 mm observation area of ​​a 35 mm glass-bottomed culture dish. After the cells adhered to the wall, 2 mL of culture medium was added and the glass-bottomed culture dish was placed in a 37°C, 5% CO2 cell culture incubator (Thermo) for 48 h;

[0131] 1.2.2 Fluorescent staining:

[0132] 1.2.2.1 Remove the culture dish from the incubator, aspirate the upper layer of culture medium, and wash the cells with pre-chilled PBS. Repeat the wash three times, 5 minutes each time.

[0133] 1.2.2.2 Fix cells with 4% paraformaldehyde at room temperature for 30 minutes;

[0134] 1.2.2.3 Aspirate excess paraformaldehyde to stop fixation, add PBS-glycine for 10 minutes, and wash once with PBS;

[0135] 1.2.2.4 Add blocking solution (10 mL blocking solution = 9 mL IF buffer + 1 mL goat serum) and incubate at room temperature for 2 h.

[0136] 1.2.2.5 Dilute the primary antibody Keratin 5 Rabbit mAb (CST:25807) at a ratio of 1:100 in IF buffer (dissolve 0.1 g BSA in 80 mL PBS, add 0.2 mL Triton X-100 and 0.05 mL Tween 20, and dilute to 100 mL with PBS). Add the primary antibody solution to the cells and incubate overnight at 4°C.

[0137] 1.2.2.6 Wash three times with IF buffer at room temperature for 10 minutes each time. Protect from light during subsequent steps.

[0138] 1.2.2.7 Dilute the secondary antibody Goat Anti-Rabbit IgG / HRP (BIOSS) at a ratio of 1:1000 in IF buffer. Add the secondary antibody solution to the cells and incubate at room temperature for 60 minutes.

[0139] 1.2.2.8 Wash once with IF buffer at room temperature for 10 minutes each time, and twice with PBS for 5 minutes each time;

[0140] 1.2.2.9 Dilute the DAPI stock solution to 300 nM with PBS. Pipette 200 μL of DAPI working solution to completely cover the cells and incubate at room temperature for 5 min. Wash with PBS three times, 5 min each time.

[0141] 1.2.2.10 Aspirate excess liquid and add 1-2 drops of anti-fluorescence decay mounting medium to completely cover the cells;

[0142] 1.2.2.11 Place the culture dish under a confocal microscope (Nikon A1) for observation and image capture.

[0143] 1.3 Western Blot Identification of Keratein 5 Knockdown Results in Tumor Cells

[0144] 1.3.1 Protein extraction: Digest and collect cells, resuspend them in pre-cooled 1× PBS, centrifuge at 600g for 5 min to collect cells, aspirate as much supernatant as possible, add pre-cooled enhanced RIPA lysis buffer (BOSTER: AR0102-30) 5×10 6 Add 500 μL of lysis buffer to each cell, pipette several times, incubate on ice for 30 min, centrifuge at 12000 rpm for 20 min, and collect the supernatant as the protein extract;

[0145] 1.3.2 BCA kit (BOSTER: AR0146) to detect protein concentration (microplate method): Take 25 μL of each standard and sample to be tested and add them to the microplate; add 200 μL of BCA working solution (A solution: B solution = 50:1 mixture is the working solution) to each well and shake for 30 seconds to mix thoroughly; cover the microplate and incubate at 37°C for 30 minutes; cool to room temperature and measure the absorbance at 570nm on a microplate reader. Based on the absorbance of the BSA standard (subtract the OD value of the blank well of the standard well to obtain the final reading), draw a standard curve (X-protein concentration ug / ml; Y-final OD value). Calculate the sample protein concentration based on the standard curve and the dilution factor of the sample;

[0146] 1.3.3 Protein denaturation: Dissolve SDS-PAGE loading buffer (5×) at room temperature; add 1 μL of loading buffer (5×) to every 4 μL of protein sample, mixing the protein sample and loading buffer. Heat the mixture in a metal bath at 100°C for 5 minutes to fully denature the protein.

[0147] 1.3.4 Sample Loading: Mount an 8% SDS-PAGE precast gel (Biyuntian: P0688) in the electrophoresis apparatus and fill the apparatus with Running Buffer (weigh 14.4g Glycine, 3.02g Tris Base, and 1g SDS into a 1L beaker, add 0.8L distilled water, and stir on a blender to dissolve. Once fully dissolved, add water to bring the volume up to 1L). Carefully remove the comb; add 30μg of denatured protein sample to the top well and 5μL of marker to the marker well.

[0148] 1.3.5 Electrophoresis: Connect the electrophoresis apparatus to a power source and adjust the voltage (upper layer: 5% stacking gel voltage 80V, electrophoresis for 30 min; lower layer: 8% separation gel voltage 80V, electrophoresis for 90 min) until the bromophenol blue approaches the bottom of the separation gel. Then, turn off the power source and remove the connected wires.

[0149] 1.3.6 Transfer (wet transfer): Carefully remove the electrophoresis gel, cut away the stacking gel, and place the gel in transfer buffer. Add Transfer Buffer (weigh 14.4 g Glycine and 3.02 g Tris Base into a 1 L beaker, add 0.6 L distilled water, and stir on a blender to dissolve. Once fully dissolved, add 0.2 L methanol and dilute to 1 L with water) into a large lunch box. Soak two sponges, two pieces of filter paper, and one PVDF membrane (pre-activate the PVDF membrane in methanol for 30 seconds, remove it, and place it in transfer buffer). Assemble the transfer apparatus in the following order: one layer of sponge + one layer of filter paper + gel + PVDF membrane + one layer of filter paper + one layer of sponge. Place the assembled apparatus in the electrophoresis tank, close the lid, connect the power supply, and run electrophoresis at 4°C, 180 mA, for 70 min.

[0150] 1.3.7 Blocking: After transfer, remove the PVDF membrane and block with blocking solution (5% skim milk powder) at room temperature for 2 h.

[0151] 1.3.8 Incubation with primary antibodies Keratin 5 Rabbit mAb (CST:25807) and GAPDH Rabbit mAb (BIOSS): After blocking, cut the membrane according to the molecular weight of the target protein and add the primary antibody diluted in 1× TBST (the dilution factor of the primary antibody should be based on the concentration in the antibody manual) and incubate overnight at 4°C.

[0152] 1.3.9 Wash the membrane: Wash with TBST (weigh 2.42 g Tris Base and 8 g NaCl into a 1 L beaker, add 0.8 L distilled water, and stir on a blender to dissolve. Once fully dissolved, add 1 mL Tween-20, adjust the pH to 7.6 with concentrated hydrochloric acid, and dilute to 1 L with water) three times, 10 min each time.

[0153] 1.3.10 Incubation with secondary antibody (Goat Anti-Rabbit IgG / HRP (BIOSS)): Add secondary antibody diluted in 1× TBST (the secondary antibody is the antibody corresponding to the primary antibody; if the primary antibody is mouse anti-rat, the secondary antibody is goat anti-rat; if the primary antibody is rabbit anti-rabbit, the secondary antibody is goat anti-rabbit). Dilute the secondary antibody according to the concentration in the antibody instructions and incubate at room temperature for 1 hour.

[0154] 1.3.11 Wash the membrane: Wash three times with TBST, 10 min each time;

[0155] 1.3.12 Development: Immerse the membrane in ultrasensitive ECL chemiluminescent substrate working solution (Sizhengbai Biotechnology: 4AW011-100) and place it in the Tianneng Gel Imaging System 4200 for development.

[0156] Figure 1The results showed that the expression of keratin 5 in tumor cells was successfully knocked down at both the cellular and protein levels.

[0157] Example 2: Test of changes in expression of epithelial (E) / mesenchymal (M) related indicator proteins before and after knockdown

[0158] 2.1 Protein extraction: Digest and collect cells, resuspend them in pre-cooled 1× PBS, centrifuge at 600g for 5min to collect cells, aspirate the supernatant as much as possible, add pre-cooled enhanced RIPA lysis buffer (BOSTER) 5×10 6 Add 500 μL of lysis buffer to each cell, pipette several times, incubate on ice for 30 min, centrifuge at 12000 rpm for 20 min, and collect the supernatant as the protein extract;

[0159] 2.2 BCA kit (BOSTER: AR0146) to detect protein concentration (microplate method): Take 25 μL of each standard and sample to be tested and add them to the microplate. Add 200 μL of BCA working solution to each well (A solution: B solution = 50:1 mixture is the working solution) and shake for 30 seconds to mix thoroughly. Cover the microplate and incubate at 37°C for 30 minutes. Cool to room temperature and detect the absorbance at 570nm on the microplate reader. According to the absorbance of the BSA standard (subtract the OD value of the blank well of the standard well to get the final reading), draw a standard curve (X-protein concentration ug / ml; Y-final OD value). Calculate the protein concentration of the sample based on the standard curve and the dilution multiple of the sample;

[0160] 2.3 Protein denaturation: Dissolve SDS-PAGE loading buffer (5×) at room temperature and add 1 μL of loading buffer (5×) to every 4 μL of protein sample. Mix the protein sample and loading buffer in a metal bath at 100°C for 5 minutes to fully denature the protein.

[0161] 2.4 Sample Loading: Mount an 8% SDS-PAGE precast gel (Biyuntian: P0688) in the electrophoresis apparatus and fill the apparatus with Running Buffer (weigh 14.4g Glycine, 3.02g Tris Base, and 1g SDS into a 1L beaker, add 0.8L distilled water, and stir on a blender to dissolve. Once fully dissolved, adjust the volume to 1L). Carefully remove the comb. Add 30μg of denatured protein sample to the top well and 5μL of marker to the marker well.

[0162] 2.5 Electrophoresis: Connect the electrophoresis apparatus to the power supply and adjust the voltage (upper layer: 5% stacking gel voltage 80V, electrophoresis 30min; lower layer: 8% separation gel voltage 80V, electrophoresis 90min) until the bromophenol blue approaches the bottom of the separation gel, then turn off the power supply and remove the connected wires;

[0163] 2.6 Transfer (wet transfer): Carefully remove the electrophoresis gel, cut off the concentrated gel and place the gel in the transfer buffer. Place Transfer Buffer (weigh 14.4g Glycine and 3.02g Tris Base into a 1L beaker, add 0.6L distilled water, place on a blender and stir to dissolve. After fully dissolved, add 0.2L methanol and adjust the volume to 1L) into a large lunch box, soak 2 sponges, 2 filter papers, and 1 PVDF membrane (the PVDF membrane was activated in methanol for 30S in advance, then taken out and placed in the transfer buffer). Assemble the transfer device in the order of 1 layer of sponge + 1 layer of filter paper + gel + PVDF membrane + 1 layer of filter paper + 1 layer of sponge; place the assembled device into the electrophoresis tank, close the lid, turn on the power supply, and perform electrophoresis at 4℃ and 180mA for 70min;

[0164] 2.7 Blocking: After transfer, remove the PVDF membrane and block it with blocking solution (5% skim milk powder) at room temperature for 2 hours;

[0165] 2.8 Incubation with primary antibodies: After blocking, cut the membrane according to the molecular weight of the target protein and add primary antibodies E-cadherin Rabbit mAb (CST:3195T), N-cadherin Rabbit mAb (CST:13116), Slug Rabbit mAb (CST:9585T), GAPDH Rabbit mAb (BIOSS:bs-2188R) diluted in 1×TBST and incubate overnight at 4°C.

[0166] 2.9 Wash the membrane: Wash with TBST three times, 10 min each time;

[0167] 2.10 Incubation with secondary antibody Goat Anti-Rabbit IgG / HRP (BIOSS): Add secondary antibody diluted in 1×TBST (the secondary antibody is the antibody corresponding to the primary antibody. For example, if the primary antibody is mouse anti-rat, the secondary antibody is goat anti-rat; if the primary antibody is rabbit anti-rabbit, the secondary antibody is goat anti-rabbit). Dilute the secondary antibody according to the concentration in the antibody instructions and incubate at room temperature for 1 hour.

[0168] 2.11 Wash the membrane: Wash with TBST three times, 10 min each time;

[0169] 2.12 Development: Immerse the membrane in ultrasensitive ECL chemiluminescent substrate working solution (Sizhengbai Biotechnology) and place it in the Tianneng Gel Imaging System 4200 for development;

[0170] Western blot results of the changes in epithelial (E) / mesenchymal (M) related protein expression before and after keratin 5 knockdown in FaDu and CAL 27 cells are shown in Figure 2 :

[0171] from Figure 2 Results show that after keratin 5 knockdown in human head and neck squamous cell carcinoma cells FaDu and CAL 27, expression of the epithelial marker E-cadherin was significantly downregulated, while expression of the mesenchymal markers N-cadherin and Slug was significantly upregulated. This suggests that keratin 5 knockdown enables epithelial cells FaDu and CAL 27 to acquire mesenchymal-like characteristics while retaining epithelial properties, exhibiting protein expression characteristic of a hybrid E / M (mixed epithelial / mesenchymal phenotype) cell phenotype.

[0172] Example 3: Flow cytometry detection of stem cell surface markers before and after knockdown

[0173] 3.1 Sample preparation: Digest and collect cells into a 15 mL centrifuge tube, resuspend the cells in pre-cooled PBS, centrifuge at 800 rpm for 3 min and wash the cells three times. Resuspend the cells in PBS to adjust the concentration to 1×10 7 / mL, transfer the cells into flow cytometry tubes, add 100 μL of cell suspension to each tube, and transfer each sample into 4 flow cytometry tubes: negative control, PE-CD24 single staining, FITC-CD44 single staining, and PE-CD24 and FITC-CD44 double staining.

[0174] 3.2 Antibody Incubation: Add 5 μL of the corresponding fluorescent antibodies FITC Mouse IgG1 kisotype Ctrl (BioLegend: 400108), PE Mouse IgG2a kisotype Ctrl (BioLegend: 400212), PE anti-human CD24 (BioLegend: 311106), and FITC anti-human CD44 (BioLegend: 338804) to the flow cytometry tube and incubate at 4°C in the dark for 40 minutes. Wash three times by adding 1 mL of pre-chilled PBS and centrifuging at 1200 rpm for 3 minutes. Resuspend the cells in 500 μL of PBS.

[0175] 3.3 On-machine detection: The samples were detected on a BD FACSC CantoⅡ flow cytometer.

[0176] The results of flow cytometry analysis of stem cell surface markers before and after keratin 5 knockdown in FaDu and CAL 27 cells are shown in Figure 2. Figure 3 As shown, from Figure 3The results show that human head and neck squamous cell carcinoma cells FaDu and CAL 27 express the stem cell surface marker CD44 after keratin 5 knockdown. + CD24 - The proportion of phenotypic cell subpopulations increased significantly, from 5.17±2.71% and 30.63±5.83% to 19.37±8.29% and 69.03±1.07%, respectively, revealing that the stemness of FaDu and CAL 27 cells was significantly enhanced after keratin 5 knockdown.

[0177] Example 4: ELISA analysis of IL-6 in stem cell supernatants before and after knockdown, VEGFA expression, and Stat3 signaling pathway protein expression analysis

[0178] 4.1 Detection of IL-6 in stem cell supernatant before and after knockdown using Human IL-6 ELISA Kit (BOSTER: EK0410)

[0179] 4.1.1 Sample preparation: Digest and collect cells, count the cells, and inoculate the cells into 24-well plates at a rate of 1×10 cells per well. 5 After inoculation, the plate was placed in a 37°C, 5% CO2 cell culture incubator (Thermo) for 24 hours. The next day, the culture medium was replaced with 1 ml of serum-free medium and cultured for another 24 hours. The supernatant was collected by centrifugation.

[0180] 4.1.2 Sample dilution: FaDu supernatant was diluted 1:10, i.e., 10 μL supernatant was added to 90 μL sample diluent; CAL 27 supernatant was diluted 1:1, i.e., 100 μL sample diluent was added to 100 μL supernatant;

[0181] 4.1.3 Preparation of Standard: Take 1mL of sample diluent and add it to a 10ng standard tube. Cover and let it stand for 15 minutes. Invert repeatedly to help dissolve. After complete dissolution, you will get a 10000pg / mL standard. Take 30μL of 10000pg / mL standard and add it to an EP tube containing 970μL of sample diluent. Mix well to get a 300pg / mL standard. Prepare 6 EP tubes, add 300μL of sample diluent to each tube, and mark them as 150pg / mL,

[0182] 75pg / mL, 37.5pg / mL, 18.75pg / mL, 9.38pg / mL, 4.69pg / mL, take 300μL of 300pg / mL standard and add it to the tube marked 150pg / mL. After mixing, take out 300μL and add it to the next tube, and so on until the last sample tube;

[0183] 4.1.4 Determine the number of antibody-coated ELISA plate wells required for this test, and add one blank well for TMB development. Total = (number of samples + 9) * 3. Package the remaining wells and store in the refrigerator.

[0184] 100 μL of each standard at 300 pg / mL, 150 pg / mL, 75 pg / mL, 37.5 pg / mL, 18.75 pg / mL, 9.38 pg / mL, and 4.69 pg / mL were added to a row of 7 wells. One well was filled with only the sample diluent as the zero well. 100 μL of the diluted supernatant sample was added to the remaining wells.

[0185] 4.1.5 Add the labeled enzyme plate and seal it with film and incubate at 37°C for 90 minutes.

[0186] 4.1.6 Shake off the liquid in the plate and tap it against absorbent paper several times without washing;

[0187] 4.1.7 Add 100 μL of the prepared biotinylated anti-human IL-6 antibody working solution (1 μL biotinylated anti-human IL-6 plus 99 μL antibody diluent, gently mix) to each well (except for the TMB blank well). Seal the plate with film and incubate at 37°C for 60 minutes.

[0188] 4.1.8 Add 300 μL of 1× wash buffer to each well and wash three times;

[0189] 4.1.9 Add 100 μL of the prepared ABC working solution (1 μL of ABC avidin-peroxidase complex plus 99 μL of ABC diluent, mix gently) to each well (except for the TMB blank well). Seal the plate with film and incubate at 37°C for 30 minutes.

[0190] 4.1.10 Add 300 μL of 1× wash buffer to each well and wash five times;

[0191] 4.1.11 Add 90 μL of TMB colorimetric solution to each well and incubate at 37°C in the dark for 20 minutes.

[0192] 4.1.12 Add 100 μL of stop solution to each well to terminate the reaction. The blue solution will turn yellow.

[0193] 4.1.13 Measure the OD value at 450 nm using a microplate reader;

[0194] 4.1.14 Create a standard curve based on the OD values ​​of the standard samples;

[0195] 4.1.15 Based on the absorbance value of the sample, find the corresponding IL-6 concentration on the coordinates of the standard curve and multiply it by the corresponding dilution factor.

[0196] 4.2 Western Blot detection of VEGFA and Stat3 signaling pathway protein expression before and after knockdown

[0197] 4.2.1 Protein extraction: Digest and collect cells, resuspend them in pre-cooled 1× PBS, centrifuge at 600g for 5 min to collect cells, aspirate the supernatant as much as possible, add pre-cooled enhanced RIPA lysis buffer (BOSTER: AR0102-30) 5×10 6 Add 500 μL of lysis buffer to each cell, pipette several times, incubate on ice for 30 min, centrifuge at 12000 rpm for 20 min, and take the supernatant as the protein extract.

[0198] 4.2.2 Protein Concentration Detection Using the BCA Kit (BOSTER: AR0146) (Microplate Method): 25 μL of each standard and sample to be tested were added to a microplate. 200 μL of BCA working solution (Solution A:Solution B = 50:1) was added to each well and the working solution was shaken for 30 seconds to mix thoroughly. Cover the microplate and incubate at 37°C for 30 minutes. Cool to room temperature and measure absorbance at 570 nm on a microplate reader. Based on the absorbance of the BSA standard (subtract the OD value of the blank well from the standard well to obtain the final reading), a standard curve was constructed (X = protein concentration in μg / mL; Y = final OD value). Sample protein concentration was calculated based on the standard curve and the sample dilution factor.

[0199] 4.2.3 Protein Denaturation: Dissolve SDS-PAGE loading buffer (5×) at room temperature. Add 1 μL of 5× loading buffer for every 4 μL of protein sample. Mix the protein sample and loading buffer in a ratio of 1:1. Heat the mixture in a metal bath at 100°C for 5 minutes to fully denature the protein.

[0200] 4.2.4 Sample Loading: Mount an 8% SDS-PAGE precast gel (Biyuntian: P0688) in the electrophoresis apparatus and fill the apparatus with Running Buffer (weigh 14.4g Glycine, 3.02g Tris Base, and 1g SDS into a 1L beaker, add 0.8L distilled water, and stir on a blender to dissolve. Once fully dissolved, adjust the volume to 1L). Carefully remove the comb. Add 30μg of denatured protein sample to the sample well and 5μL of marker to the marker well.

[0201] 4.2.5 Electrophoresis: Connect the electrophoresis apparatus to the power supply and adjust the voltage (upper layer: 5% stacking gel voltage 80V, electrophoresis for 30 minutes; lower layer: 8% separation gel voltage 80V, electrophoresis for 90 minutes) until the bromophenol blue approaches the bottom of the separation gel, then turn off the power supply and remove the connected wires.

[0202] 4.2.6 Transfer (Wet Transfer): Carefully remove the electrophoresis gel, cut away the stacking gel, and place the gel in transfer buffer. Add Transfer Buffer (weigh 14.4g Glycine and 3.02g Tris Base into a 1L beaker, add 0.6L distilled water, and stir on a blender to dissolve. Once fully dissolved, add 0.2L methanol and bring the volume to 1L) to a large lunch box. Soak two sponges, two pieces of filter paper, and one PVDF membrane (pre-activate the PVDF membrane in methanol for 30 seconds, then remove and place in transfer buffer). Assemble the transfer apparatus in the following order: 1 layer of sponge + 1 layer of filter paper + gel + PVDF membrane + 1 layer of filter paper + 1 layer of sponge. Place the assembled apparatus in the electrophoresis tank, close the lid, connect the power supply, and conduct electrophoresis at 4°C, 180mA, for 70 minutes.

[0203] 4.2.7 Blocking: After transfer, remove the PVDF membrane and block it with blocking solution (5% skim milk powder) at room temperature for 2 hours.

[0204] 4.2.8 Incubation with primary antibodies: After blocking, cut the membrane according to the molecular weight of the target protein and add primary antibodies VEGFA Mouse Monoclonal antibody (Proteintech: 66828-1-Ig), P-Stat3 Rabbit mAb (CST: Y705), Stat3 Mouse mAb (CST: 124H6), GAPDH Rabbit mAb (BIOSS) diluted in 1X TBST and incubate overnight at 4°C.

[0205] 4.2.9 Wash the membrane: Wash three times with 1×TBST (weigh 2.42 g Tris Base and 8 g NaCl into a 1 L beaker, add 0.8 L distilled water, and stir on a blender to dissolve. After complete dissolution, add 1 mL Tween-20, adjust the pH to 7.6 with concentrated hydrochloric acid, and dilute to 1 L with water) for 10 min each time.

[0206] 4.2.10 Incubation with secondary antibodies (Goat Anti-Mouse IgG / HRP (BIOSS) and Goat Anti-Rabbit IgG / HRP (BIOSS)): Add secondary antibodies diluted in 1× TBST (the secondary antibody is the antibody corresponding to the primary antibody; for example, if the primary antibody is mouse anti-rat, the secondary antibody is goat anti-rabbit; if the primary antibody is rabbit anti-rabbit, the secondary antibody is goat anti-rabbit). Dilute the secondary antibody according to the concentration specified in the antibody instructions and incubate at room temperature for 1 hour.

[0207] 4.2.11 Wash the membrane: Wash with TBST three times, 10 min each time.

[0208] 4.2.12 Development: Immerse the membrane in ultrasensitive ECL chemiluminescent substrate working solution (Sizhengbai Biotechnology: 4AW011-100) and place it in the Tianneng Gel Imaging System 4200 for development.

[0209] ELISA analysis results of IL-6 in the supernatant of FaDu and CAL 27 cells before and after keratin 5 knockdown (***p<0.001), and western blot results of VEGFA expression and Stat3 signaling pathway protein expression are shown in Figure 2. Figure 4 As shown,

[0210] Figure 4 The results of ELISA experiments showed that along with the significant enhancement of the stemness of FaDu and CAL 27 cells after keratin 5 knockdown, the cytokine IL-6, which is closely related to the stemness of tumor cells, was significantly increased in the cell supernatant; Western blot results showed that the expression of vascular endothelial growth factor A (VEGFA) was significantly increased, and at the same time, the expression of Stat3 and phospho-Stat3, important proteins in the Stat3 signaling pathway closely related to IL-6, were significantly increased, suggesting that the signaling pathway was activated.

[0211] Example 5: In vitro migration scratch assay before and after knockdown

[0212] 5.1 Marking the culture plate: Use a marker pen and a ruler to draw horizontal lines on the back of the 6-well plate. Each well should have 5 lines passing through it, and each line should be even and parallel.

[0213] 5.2 Cell plating: 5×10 5 The cells were cultured in a 37°C, 5% CO2 incubator overnight.

[0214] 5.3 Cell streaking: After the cells have spread all over the bottom of the plate, use a 20 μL pipette tip to scratch the black line on the back of the well plate vertically so that the scratch intersects with the marked line;

[0215] 5.4 Wash cells and remove streaked cells: After streaking, wash the cells 2-3 times with sterile PBS to remove streaked cells, leaving gaps visible to the naked eye, and then replace with 1% low-serum medium.

[0216] 5.5 Cell Photography: Observe under a microscope and select 3-4 scratched areas for photography and record them (so that they can be matched one by one when taking photos 24 hours later).

[0217] 5.6 Cell culture and observation: Culture the cells in a 37°C, 5% CO2 incubator. After 24 hours, remove the well plate and observe under a microscope. Take photos of the scratched area corresponding to the scratched area before repair.

[0218] 5.7 Data Analysis: After opening the images using ImageJ software, calculate the scratch area before and after cell repair;

[0219] The results of in vitro migration scratch assay of FaDu and CAL 27 cells before and after keratin 5 knockdown are shown in Figure 2. Figure 5 As shown,

[0220] Figure 5 The results showed that compared with before knockdown, the in vitro migration ability of FaDu and CAL 27 cells was significantly enhanced after keratin5 knockdown (**p<0.01).

[0221] Example 6: In vitro invasion transwell assay before and after knockdown

[0222] 6.1 Matrigel: Dilute Matrigel with serum-free cell culture medium or PBS buffer at a ratio of 1:8 at 4°C (the dilution ratio needs to be determined; select a concentration that allows cells to penetrate the membrane). Apply 50 μL evenly to the polycarbonate membrane surface of the upper chamber and incubate at 37°C for 1 hour to allow it to polymerize into a gel.

[0223] 6.2 Cell culture: Take cells in the logarithmic growth phase and wash them twice with PBS. Then suspend the cells in serum-free medium and adjust the cell density to 10×10 5 / mL;

[0224] 6.3 Cell inoculation: Add 700 μL of culture medium containing 10% FBS to the lower chamber of a 24-well plate. Then, use tweezers to place the Transwell chamber into the 24-well plate. Add 150 μL of the cell suspension to the upper chamber. Finally, place the plate in a cell culture incubator (Thermo) and culture for 48 h.

[0225] 6.4 Cell Fixation: Remove the chamber, aspirate the culture medium, and gently wipe the Matrigel and cells in the upper chamber with a cotton swab. Add 600 μL of 4% paraformaldehyde to a new 24-well plate, place the chamber in the plate, and fix for 20-30 minutes.

[0226] 6.5 Cell Staining and Counting: Discard the fixative and stain with 0.1% crystal violet for 5-10 minutes. Wash three times with PBS to remove any crystal violet not bound to the cells. Gently wipe the upper side of the chamber with a cotton swab to remove any dye nonspecifically bound to the upper surface of the chamber for subsequent microscopic examination. After adequate air drying, observe and count the cells in five fields under a high-power microscope.

[0227] The results of in vitro invasion transwell assays of FaDu and CAL 27 cells before and after keratin 5 knockdown are shown in Figure 2. Figure 6 As shown,

[0228] Figure 6 The results of in vitro invasion transwell experiments showed that compared with before knockdown, the in vitro invasion ability of FaDu and CAL 27 cells was significantly enhanced after keratin 5 knockdown (**p<0.01).

[0229] Example 7: CCK-8 detection of tumor cell sensitivity to cisplatin before and after knockdown

[0230] 7.1 Cell inoculation: Digest and collect logarithmic phase cells, count the cells, and adjust the cell suspension concentration to 5×10 4 / mL, 100 μl of cell suspension was added to each well of a 96-well culture plate to make 5000 cells per well, and the culture plate was placed in a 37°C 5% CO2 cell culture incubator (Thermo) for culture;

[0231] 7.2 Grouping and Drug Addition: After 24 h of cell culture, the culture plates were divided into a zero-adjustment group, a control group, and an experimental group. The culture medium was aspirated, and 200 μL of different concentrations of drugs were added to the experimental group. 200 μL of drug-free culture medium was added to the zero-adjustment group and the control group. The cells were cultured in a 37°C 5% CO2 incubator.

[0232] 7.3 CCK-8 (FXP132-3000, Sizhengbai Biotechnology): After 48 hours of drug exposure and observing cell growth under a microscope, remove the culture medium and add 100 μL of 10% CCK-8 solution to each well. Incubate in a cell culture incubator (Thermo) for 1 hour. Measure absorbance at 450 nm using a microplate reader.

[0233] 7.4 Calculation and Analysis: The effect of cisplatin on the proliferation rate of FaDu and CAL 27 cells was calculated according to the formula: Cell proliferation inhibition rate = [1 - (OD value of experimental group - OD value of zero adjustment group) / (OD value of control group - OD value of zero adjustment group)] x 100%;

[0234] The results of CCK-8 assay on the sensitivity of FaDu and CAL 27 cells to cisplatin before and after keratin 5 knockdown are shown in Figure 2. Figure 7 As shown,

[0235] Figure 7 CCK-8 assay results showed that FaDu and CAL 27 cells showed significantly reduced sensitivity to cisplatin and enhanced drug resistance after keratin 5 knockdown. The IC50 values ​​increased from 1.79μM and 2.11μM to 2.54μM and 6.62μM, respectively, suggesting that enhanced cell stemness is accompanied by enhanced drug resistance.

[0236] Example 8: Expression of NF-κb signaling pathway proteins before and after knockdown and detection of tumor cell sensitivity to PDTC

[0237] 8.1 Detection of NF-κb signaling pathway protein expression before and after knockdown

[0238] 8.1.1 Protein extraction: Digest and collect cells, resuspend them in pre-cooled 1× PBS, centrifuge at 600 g for 5 min to collect cells, aspirate as much supernatant as possible, add pre-cooled enhanced RIPA lysis buffer (BOSTER: AR0102-30) 5×10 6 Add 500 μL of lysis buffer to each cell, pipette several times, incubate on ice for 30 min, centrifuge at 12000 rpm for 20 min, and collect the supernatant as the protein extract;

[0239] 8.1.2 BCA kit (BOSTER: AR0146) to detect protein concentration (microplate method): Take 25 μL of each standard and sample to be tested and add them to the microplate. Add 200 μL of BCA working solution to each well (A solution: B solution = 50:1 mixture is the working solution) and shake for 30 seconds to mix thoroughly. Cover the microplate and incubate at 37°C for 30 minutes. Cool to room temperature and detect the absorbance at 570nm on the microplate reader. According to the absorbance of the BSA standard (subtract the OD value of the blank well of the standard well to get the final reading), draw a standard curve (X-protein concentration ug / ml; Y-final OD value). Calculate the sample protein concentration based on the standard curve and the dilution multiple of the sample;

[0240] 8.1.3 Protein Denaturation: Dissolve SDS-PAGE loading buffer (5×) at room temperature. Add 1 μL of loading buffer (5×) to every 4 μL of protein sample. Mix the protein sample and loading buffer in a metal bath at 100°C for 5 minutes to fully denature the protein.

[0241] 8.1.4 Sample Loading: Mount an 8% SDS-PAGE precast gel (Biyuntian: P0688) in the electrophoresis apparatus and fill the apparatus with Running Buffer (weigh 14.4g Glycine, 3.02g Tris Base, and 1g SDS into a 1L beaker, add 0.8L distilled water, and stir on a blender to dissolve. Once fully dissolved, adjust the volume to 1L). Carefully remove the comb. Add 30μg of denatured protein sample to the sample well and 5μL of marker to the marker well.

[0242] 8.1.5 Electrophoresis: Connect the electrophoresis apparatus to the power supply and adjust the voltage (upper layer: 5% stacking gel voltage 80V, electrophoresis 30 minutes; lower layer: 8% separating gel voltage 80V, electrophoresis 90 minutes) until the bromophenol blue approaches the bottom of the separating gel. Then, turn off the power supply and remove the connected wires.

[0243] 8.1.6 Transfer (wet transfer): Carefully remove the electrophoresis gel, cut off the concentrated gel and place the gel in the transfer buffer. Place the Transfer Buffer (weigh 14.4g Glycine and 3.02g Tris Base into a 1L beaker, add 0.6L distilled water, place on a blender and stir to dissolve. After fully dissolved, add 0.2L methanol and adjust the volume to 1L) into a large lunch box, soak 2 sponges, 2 filter papers, and 1 PVDF membrane (the PVDF membrane was activated in methanol for 30S in advance, taken out and placed in the transfer buffer), and assemble the transfer device in the order of 1 layer of sponge + 1 layer of filter paper + gel + PVDF membrane + 1 layer of filter paper + 1 layer of sponge. Place the assembled device into the electrophoresis tank, close the lid, turn on the power, and perform electrophoresis at 4℃ and 180mA for 70min;

[0244] 8.1.7 Blocking: After transfer, remove the PVDF membrane and block with blocking solution (5% skim milk powder) at room temperature for 2 h.

[0245] 8.1.8 Incubation with primary antibody: After blocking, cut the membrane according to the molecular weight of the target protein and add the primary antibody diluted in 1× TBST (the dilution of the primary antibody should be based on the concentration specified in the antibody instructions) and block overnight at 4°C.

[0246] 8.1.9 Wash the membrane: Wash three times with 1×TBST (weigh 2.42 g Tris Base and 8 g NaCl into a 1 L beaker, add 0.8 L distilled water, and stir on a blender to dissolve. Once fully dissolved, add 1 mL Tween-20, adjust the pH to 7.6 with concentrated hydrochloric acid, and dilute to 1 L with water). Each wash is 10 min.

[0247] 8.1.10 Incubation with secondary antibody: Add secondary antibody diluted in 1× TBST (the secondary antibody should be the antibody corresponding to the primary antibody; for example, if the primary antibody is mouse, the secondary antibody should be goat anti-mouse; if the primary antibody is rabbit, the secondary antibody should be goat anti-rabbit). Dilute the secondary antibody to the concentration specified in the antibody instructions and incubate at room temperature for 1 hour.

[0248] 8.1.11 Wash the membrane: Wash with TBST three times, 10 min each time;

[0249] 8.1.12 Development: Immerse the membrane in ultrasensitive ECL chemiluminescent substrate working solution (Sizhengbai Biotechnology: 4AW011-100) and place it in the Tianneng Gel Imaging System 4200 for development.

[0250] 8.2 CCK-8 detection of tumor cell sensitivity to PDTC before and after knockdown

[0251] 8.2.1 Cell inoculation: Digest and collect logarithmic phase cells, count the cells, and adjust the cell suspension concentration to 5×10 4 / mL, 100 μL of cell suspension was added to each well of a 96-well culture plate to make 5000 cells per well, and the culture plate was placed in a 37°C 5% CO2 cell culture incubator (Thermo) for culture;

[0252] 8.2.2 Grouping and Drug Addition: After 24 hours of cell culture, the plates were divided into a zero-adjustment group, a control group, and an experimental group. The culture medium was aspirated, and 200 μL of each drug concentration gradient was added to the experimental group. 200 μL of drug-free culture medium was added to the zero-adjustment group and the control group. The cells were cultured at 37°C in a 5% CO2 cell culture incubator (Thermo).

[0253] 8.2.3 CCK-8 (Sizhengbai Biotechnology) Color Development: After the drug has been applied for 48 hours, observe cell growth under a microscope, aspirate the culture medium, add 100 μL of 10% CCK-8 solution to each well, and incubate in a cell culture incubator (Thermo) for 1 hour. Measure the absorbance at 450 nm using a microplate reader.

[0254] 8.2.4 Calculation and Analysis: Calculate the effect of PDTC on the proliferation rate of FaDu and CAL 27 cells according to the formula: Cell proliferation inhibition rate = [1 - (OD value of experimental group - OD value of zero adjustment group) / (OD value of control group - OD value of zero adjustment group)] × 100%;

[0255] Western blot results of NF-κB signaling pathway protein expression before and after keratin 5 knockdown in FaDu and CAL 27 cells and CCK-8 assay results of PDTC sensitivity are shown in Figure 2. Figure 8 As shown,

[0256] Figure 8 Western blot results showed that after knocking down keratin 5 in FaDu and CAL 27 cells, the expression of NF-κb signaling pathway proteins p65 and pp65 was upregulated, especially pp65 was significantly upregulated, confirming the activation of NF-κb signaling pathway. After the cells were treated with PDTC, an inhibitor of NF-κb signaling pathway, Figure 8 The CCK-8 assay results showed that knockdown of keratin 5 significantly enhanced the sensitivity of cells exhibiting a mixed E / M phenotype to PDTC, with the IC50 values ​​decreasing from 28.92 μM and 16.41 μM to 15.06 μM and 11.43 μM, respectively. This demonstrated that cells with a mixed E / M phenotype have an increased dependence on the NF-κb signaling pathway, consistent with the reported association between NF-κb signaling and stem cells.

[0257] Example 9: In vivo tumorigenesis experiments in nude mice using FaDu and CAL 27 cells before and after knockdown

[0258] 9.1 Experimental Preparation: 4-week-old BALB / c nude mice were purchased and housed in the animal room of the Sichuan Cancer Hospital and Cancer Research Institute. A control group of scrambled cell lines and a Krt5 gene knockdown cell line were cultured in 2D culture, and tumor cell morphology was closely observed under a microscope.

[0259] 9.2 Inoculation of mice (FaDu: 2×10 6 / 100μL / CAL 27: 1×10 7 / 100 μL / cell): Digest and collect cells, count, wash cells with sterile pre-cooled PBS, 800 rpm for 3 minutes, wash three times, and dilute the cells to 2×10 6 / 100μL or 1×10 7 Six-week-old BALB / c mice weighing 20±2 g were randomly divided into two groups: the control group and the KRT5 group. 100 μL of cell suspension was subcutaneously inoculated at the dorsal side of the right hind limb base of the mice.

[0260] 9.3 Measurement and Observation: Observe the tumor formation in mice. Once visible tumors appear, begin measuring with a vernier caliper 2-3 times per week and record tumor size. Tumor size is calculated using the following formula: V = (π / 6) * W² * I, where W and I are the minor and major diameters of the tumor, respectively.

[0261] 9.4 Remove, weigh and photograph the tumor: The mice were killed by cervical dislocation on a workbench, and the tumor was removed, weighed and photographed.

[0262] The results of the in vivo tumorigenesis experiment of FaDu and CAL 27 cells in nude mice before and after keratin 5 knockdown are as follows Figure 9 As shown,

[0263] Figure 9 In vivo tumorigenesis experiments in nude mice showed that knockdown of keratin 5 significantly enhanced the tumorigenicity of FaDu and CAL 27 cells. Compared with the scramble control group, the tumor weight and volume in the shKRT5 group were significantly increased, with statistical significance.

[0264] Example 10: In vivo invasion and metastasis experiments of FaDu and CAL 27 cells injected into the tail vein of nude mice before and after knockdown

[0265] 10.1 Experimental Preparation: 4-week-old BALB / c nude mice were purchased and housed in the animal room of the Sichuan Cancer Hospital and Cancer Research Institute. A control group of scrambled cell lines and a Krt5 gene knockdown cell line were cultured in 2D culture, and tumor cell morphology was closely observed under a microscope.

[0266] 10.2 Preparation of cell suspension: Digest and collect cells, count, wash cells with sterile pre-cooled PBS, 800 rpm for 3 minutes, wash three times, dilute cells to 2×10 6 / 300μL.

[0267] 10.3 Inoculation of nude mice (2×10 6 / 300μL / mouse): 6-week-old BALB / c mice weighing 20±2g were randomly divided into two groups: control group and KRT5 group. On a clean bench, the nude mice were fixed in a mouse restrainer. The base of the tail was pressed down. The tail was wiped with an alcohol cotton ball to disinfect and dilate the blood vessels. A 1mL syringe was used to draw up the single-cell suspension. The needle was inserted into the middle and outer third of the tail. The injection speed was controlled. Each mouse was injected with 300uL, i.e., 2×10 6 cells.

[0268] 10.4 Observation of Results: 21 days after tumor cell inoculation, mice were sacrificed and dissected to observe the presence of metastatic lesions in their organs. The number and size of metastatic lesions in each organ were counted.

[0269] The results of the in vivo invasion and metastasis experiments of FaDu and CAL 27 cells injected into the tail vein of nude mice before and after keratin 5 knockdown are shown in Figure 2. Figure 10 As shown,

[0270] Figure 10 The results of the in vivo invasion and metastasis experiment of nude mice injected with tail vein showed that keratin 5 knockdown significantly enhanced the liver metastasis ability of FaDu and CAL 27 cells. Compared with the scramble control group, the incidence of liver metastasis and the number of metastatic foci in nude mice in the shKRT5 group were significantly increased, and were statistically significant.

[0271] Example 11: Clinical Data Analysis and Verification

[0272] The gene expression data of head and neck squamous cell carcinoma patients in the dataset GSE65858 and TCGA database were analyzed using R software (version 3.5.1). The correlation between keratin 5 expression and lymph node metastasis in head and neck squamous cell carcinoma patients was analyzed using the GSE65858 dataset and TCGA head and neck squamous cell carcinoma sample data. Figure 11 As shown, from Figure 11 It can be seen that lymph node metastasis (N+) is significantly correlated with decreased expression of keratin 5 (p = 0.0135, p = 0.00418, respectively). This result is consistent with the results of the invasion and metastasis experiment in nude mice, further demonstrating the correlation between downregulation of keratin 5 expression and enhanced mesenchymal characteristics of epithelial cells and enhanced invasion and metastasis ability in head and neck squamous cell carcinoma.

[0273] The above are preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention are included in the scope of protection of the present invention.

Claims

1. A mixed epithelial-mesenchymal phenotype tumor cell model, characterized by: The model is obtained by knocking down epithelial cells using shRNA having a nucleotide sequence as shown in SEQ.ID NO: 2, the shRNA is shKRT5-1, and the tumor cells are head and neck squamous cell carcinoma cells FaDu and CAL 27.

2. The method for constructing a mixed epithelial-mesenchymal phenotype tumor cell model according to claim 1, characterized in that: The specific construction steps include: (1) Construction and identification of the shKRT5-1 plasmid; (2) Amplification of shKRT5-1 monoclonal bacterial solution; (3) Extraction of shKRT5-1 plasmid using Hispeed Plasmid Midi kit; (4) Lentiviral packaging; (5) Tumor cell transfection and positive screening.

3. The method for constructing a mixed epithelial-mesenchymal phenotype tumor cell model according to claim 2, characterized in that: The step (2) comprises: (1) Preparation of LB liquid medium: Weigh 0.5 g of yeast powder, 1 g of peptone, and 1 g of sodium chloride into a conical flask, add 100 mL of distilled water, wrap the mouth of the conical flask with gauze, sterilize at 121°C for 20 minutes, and add 100 μL of ampicillin after cooling; (2) Incubate the prepared LB liquid medium on a shaker at 250 rpm and 37°C for 0.5 h; (3) Take 200 μL of shKRT5-1 monoclonal bacterial solution; inoculate it into a conical flask containing LB liquid medium, place it on a shaker at 250 rpm and 37°C, and shake overnight.

4. The method for constructing a mixed epithelial-mesenchymal phenotype tumor cell model according to claim 2, characterized in that: The step (3) comprises: (1) Collect the bacterial suspension into a 50 mL centrifuge tube and centrifuge at 6000 g for 15 min at 4°C to remove the supernatant. (2) Add 6 mL of P1 solution and mix by pipetting repeatedly until the precipitate is completely dissolved. Add 6 mL of P2 solution, cover the centrifuge tube and mix by inverting 4-6 times. Let stand at room temperature for 5 min. Add LyseBlue liquid until the liquid turns blue. (3) Add 6 mL of P3 solution and mix thoroughly by inversion until the liquid becomes colorless. Pour the solution into the QIA filter cartridge and incubate at room temperature for 10 min. (4) Prepare a QIAGEN-tip column, add 4 mL of QBT buffer and let it flow naturally. After the QBT buffer has flowed out, The liquid in the filter cartridge is pressurized and filtered into the tip column to allow it to filter naturally; (5) Add 20 mL of QC to wash the tip filter column; (6) Add 5 mL of QF to elute and collect the plasmid DNA in a clean 15 mL centrifuge tube; (7) Add 3.5 mL of isopropanol, mix thoroughly, and let stand at room temperature for 5 min; (8) Filter the solution through a filter membrane to allow the plasmid DNA to adsorb onto the membrane. Add 2 mL of 70% ethanol to filter and wash the membrane. Repeat the washing process twice. (9) Add 800 μL of DEPC water to dissolve the DNA and detect the plasmid concentration using Nano Drop.

5. The method for constructing a mixed epithelial-mesenchymal phenotype tumor cell model according to claim 2, characterized in that: The step (4) comprises: (1) 293T cells were collected by centrifugation, counted, and seeded onto 10 cm dishes at a rate of 2 million cells per dish. The cells were cultured in a 37°C 5% CO2 cell culture incubator for 24 h before use. (2) Prepare a viral plasmid mixture at a ratio of 3:2.7:0.3 for viral plasmid:dR8.9:VSV-G. Then, add 580 μL of opti-MEM to the plasmid mixture and let it stand at room temperature for 5 minutes. Then add 18 μL of X-tremeGene HP DNA Transfection Reagent and incubate at room temperature for 15 minutes. After incubation, add the mixture to 293T cells and culture them in a 37°C 5% CO2 cell culture incubator for 10 hours. Then, replace the culture medium with 20% FBS complete medium. (3) After 24 hours, the supernatant was collected into a 15 mL centrifuge tube and frozen at -80°C. 9 mL of 20% FBS complete medium was added and cultured for another 48 hours. The supernatant was collected for the second time and mixed with the supernatant collected for the first time. The tube was centrifuged at 1500 rpm for 5 minutes, and the supernatant was collected and aliquoted. After aliquoting, the tube was frozen at -80°C for later use.

6. The method for constructing a mixed epithelial-mesenchymal phenotype tumor cell model according to claim 2, characterized in that: The step (5) comprises: (1) Digest and collect tumor cells, count the cells, and seed the cells onto 10 cm dishes at a rate of 200,000 cells per dish. After adding complete culture medium, culture the cells in a 37°C 5% CO2 cell culture incubator for 24 h. (2) Take a 15 mL centrifuge tube, add 9 mL of culture medium without double-antibody 10% FBS, 1 mL of packaged virus, and 10 μL of 10 μg / mL polybrene, mix well, add to the culture dish containing tumor cells, and incubate; (3) 24 h after transfection, the culture medium was replaced with fresh complete culture medium containing penicillin-streptomycin sulfate and puromycin 2 μg / mL for screening.

Images