Application of Escherichia coli flagella-specific ATP synthase gene fliI and its mutants in L-amino acid production

Abstract

The present invention discloses the application of the Escherichia coli flagella-specific ATP synthase gene fliI and its mutants in the production of L-amino acids. The sequence of the gene fliI disclosed in the present invention is SEQ ID No.1, encoding the protein shown in SEQ ID No.2, and the sequence of the fliI mutant is SEQ ID No.4, encoding the protein shown in SEQ ID No.5. Experiments have shown that the gene fliI and its mutants and related biomaterials of the present invention can increase the production of L-amino acids, especially L-threonine, L-tryptophan, L-arginine and L-valine, and can be used to produce L-amino acids, with good application prospects.

Description

Technical Field

[0001] The invention relates to the field of biotechnology and application of an Escherichia coli flagella-specific ATP synthase gene fliI and a mutant thereof in L-amino acid production. Background Art

[0002] The basic unit of life structure and life activities is the cell. The ATP synthase, a membrane protein complex in the cell that is closely related to respiration, is the core enzyme for energy conversion in organisms and a typical rotary molecular motor. They rotate continuously to synthesize ATP and maintain the large amount of energy needed for cell metabolism.

[0003] Another typical rotary molecular motor is the bacterial flagellum, which is an ingenious and complex machine, a thin and long filament that grows from the inside of a bacterium and is a masterpiece of molecular evolution in nature.

[0004] Therefore, the study of bacterial flagella and ATP synthase is of great significance to the biological evolution and energy production of cells. Summary of the invention

[0005] The object of the present invention is to provide a protein which can be used for preparing L-amino acids.

[0006] The protein provided by the present invention is named fliI, and fliI is any one of the following A1)-A3):

[0007] A1) the protein shown in SEQ ID No. 2, or a mutant protein obtained by mutating the threonine residue at position 171 of SEQ ID No. 2 to an isoleucine residue, an asparagine residue, a serine residue, an alanine residue, a methionine residue, a proline residue, an arginine residue, an aspartic acid residue, a cysteine ​​residue, a glutamine residue, a glutamic acid residue, a glycine residue, a histidine residue, a leucine residue, a lysine residue, a phenylalanine residue, a tryptophan residue, a tyrosine residue or a valine residue;

[0008] A2) a protein having the same function as the protein of A1) except for position 171, wherein one or more amino acid residues are substituted and / or deleted and / or added;

[0009] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] The mutant protein in A1) may be the protein shown in SEQ ID No.5.

[0011] In order to facilitate the purification of the protein in A1), a tag as shown in the following table may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 5 or SEQ ID No. 2.

[0012] Table: Sequence of tags

[0013]

[0014]

[0015] The protein in A2) is a protein having an amino acid sequence identity of 75% or more to the protein in A1) and having the same function. The identity of 75% or more is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%.

[0016] The protein in A2) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0017] The coding gene of the protein in A2) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID No.4 or SEQ ID No.1, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in the above table to its 5' end and / or 3' end. Among them, the DNA molecules shown in SEQ ID No.4 and SEQ ID No.1 encode the proteins shown in SEQ ID No.5 and SEQ ID No.2 respectively.

[0018] The present invention also provides a biomaterial related to fliI, wherein the biomaterial is any one of the following B1) to B4):

[0019] B1) a nucleic acid molecule encoding fliI;

[0020] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0021] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0022] B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

[0023] In the above biological material, the nucleic acid molecule described in B1) may be the following b11) or b12) or b13) or b14):

[0024] b11) the DNA molecule shown in SEQ ID No.4 in the sequence list;

[0025] b12) the DNA molecule shown in SEQ ID No. 1 in the sequence list;

[0026] b13) a DNA molecule that has 75% or more identity with the nucleotide sequence defined in b11) or b12) and encodes fliI;

[0027] b14) A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in b11) or b12) or b13) and encodes fliI.

[0028] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0029] Those skilled in the art can easily mutate the nucleotide sequence encoding the fliI protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the fliI protein of the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the fliI protein and have the function of the fliI protein.

[0030] The term "identity" as used herein refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID No.5 or SEQ ID No.2. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0031] In the above biological material, the stringent conditions may be as follows: 50°C, hybridization in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4 and 1mM EDTA, rinsed at 50°C, 2×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, rinsed at 50°C, 1×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, rinsed at 50°C, 0.5×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, rinsed at 50°C, 0.5×SSC, 0.1% SDS; it may also be: 50°C, 7% SDS, 0.5M NaPO4 and 1mM Hybridize in a mixed solution of EDTA, rinse in 0.1×SSC, 0.1% SDS at 50°C; or: 50°C, in 7% SDS, 0.5M NaPO4 and 1mM The membrane can be hybridized in a mixed solution of EDTA and rinsed in 0.1×SSC, 0.1% SDS at 65°C. It can also be hybridized in a solution of 6×SSC, 0.5% SDS at 65°C, and then washed once with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS. It can also be hybridized in a solution of 2×SSC, 0.1% SDS at 68°C and washed twice for 5 minutes each time, and then hybridized in a solution of 0.5×SSC, 0.1% SDS at 68°C and washed twice for 15 minutes each time. It can also be hybridized and washed in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS at 65°C.

[0032] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0033] In the above biological material, the expression cassette containing the nucleic acid molecule encoding the fliI protein (fliI gene expression cassette) described in B2) refers to a DNA capable of expressing the fliI protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the fliI gene, but also a terminator for terminating transcription of the fliI gene. Further, the expression cassette may also include an enhancer sequence.

[0034] In the above biological material, the expression cassette in B2) can be a DNA molecule shown in positions 37-1624 of SEQ ID No.3, or a DNA molecule obtained by mutating position 762 from C to T among positions 37-1624 of SEQ ID No.3.

[0035] Existing expression vectors can be used to construct a recombinant vector containing the fliI gene expression cassette.

[0036] In the above biological materials, the vector can be a plasmid, a cosmid, a phage or a virus vector. Specifically, the plasmid can be a pET-28a(+) vector.

[0037] B3) The recombinant vector may be the recombinant vector pET28(a)-fliI or pET28(a)-T171I;

[0038] pET28(a)-fliI is a recombinant vector obtained by inserting the fliI gene expression cassette shown at positions 37 to 1624 of sequence 3 into the multiple cloning site of the pET-28a(+) vector.

[0039] pET28(a)-T171I is a recombinant vector obtained by replacing the DNA fragment shown in SEQ ID No. 1 in pET28(a)-fliI with the DNA fragment shown in SEQ ID No. 4.

[0040] In the above-mentioned biological material, the microorganism can be yeast, bacteria, algae, fungi, plant cells or animal cells. Among them, the bacteria can be Escherichia coli, Corynebacterium glutamicum, Brevibacterium lactofermentum, Corynebacterium pekinense, Brevibacterium ammoniaphagoides, Corynebacterium scutellariae, Pantoea, Pantoea ananatis, Bacillus brevis, Brevibacterium lactis or Brevibacterium flavum. The yeast can be Saccharomyces cerevisiae or Pichia pastoris.

[0041] In one embodiment of the present invention, the Escherichia coli is Escherichia coli W3110, Escherichia coli YP0158 (whose deposit number in the China National Microorganism Culture Collection Center is CGMCC No. 25404), Escherichia coli YP006D (whose deposit number in the China National Microorganism Culture Collection Center is CGMCC No. 25403), Escherichia coli YP004-8 (whose deposit number in the China National Microorganism Culture Collection Center is CGMCC No. 25402) or Escherichia coli YP045 (whose deposit number in the China National Microorganism Culture Collection Center is CGMCC No. 22721).

[0042] B4) The recombinant microorganism is a recombinant microorganism obtained by replacing the fliI gene in a microorganism containing the fliI gene shown in SEQ ID No.1 with a DNA molecule shown in SEQ ID No.4, or a recombinant microorganism obtained by introducing a DNA molecule shown in SEQ ID No.4 or SEQ ID No.1 into a microorganism and expressing it.

[0043] In an embodiment of the present invention, the recombinant microorganism is W3110-pET28(a)-T171I, YPThr11, YPTrp001, YPR-061, YPV-099, YPThr12, YPTrp002, YPR-062, YPV-100, YPThr13, YPTrp003, YPR-063, YPV-101, YPThr15, YPThr16, YPTrp005, YPTrp006, YPR-065, YPR-066, YPV-103 or YPV-104;

[0044] W3110-pET28(a)-T171I is a recombinant bacterium obtained by introducing pET28(a)-T171I into Escherichia coli W3110;

[0045] YPThr11 is a recombinant bacterium obtained by replacing the DNA fragment shown in SEQ ID No. 1 of the L-threonine producing bacterium CGMCC25404 (Escherichia coli YP0158) with the DNA fragment shown in SEQ ID No. 4;

[0046] YPTrp001 is a recombinant bacterium obtained by replacing the DNA fragment shown in SEQ ID No. 1 of the L-tryptophan-producing bacterium CGMCC25403 (Escherichia coli YP006D) with the DNA fragment shown in SEQ ID No. 4;

[0047] YPR-061 is a recombinant bacterium obtained by replacing the DNA fragment shown in SEQ ID No. 1 of the L-arginine-producing bacterium CGMCC25402 (Escherichia coli YP004-8) with the DNA fragment shown in SEQ ID No. 4;

[0048] YPV-099 is a recombinant bacterium obtained by replacing the DNA fragment shown in SEQ ID No. 1 of the L-valine-producing bacterium CGMCC22721 (Escherichia coli YP045) with the DNA fragment shown in SEQ ID No. 4;

[0049] YPThr12, YPTrp002, YPR-062 and YPV-100 are recombinant bacteria obtained by replacing the yaiT coding region on the genomes of L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721 with the fliI gene and its promoter (SEQ ID No. 3), while keeping other nucleotides in the genome unchanged;

[0050] YPThr13, YPTrp003, YPR-063 and YPV-101 are obtained by replacing the yaiT coding region on the genomes of L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721 with mutant fliI T171I A recombinant bacterium obtained by replacing the C at position 762 of SEQ ID No. 3 with T and keeping other nucleotides in the genome unchanged;

[0051] YPThr15, YPTrp005, YPR-065, and YPV-103 are recombinant strains obtained by introducing pET28(a)-fliI into L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402, and L-valine-producing bacteria CGMCC22721, respectively;

[0052] YPThr16, YPTrp006, YPR-066 and YPV-104 were respectively introduced into the L-threonine-producing bacteria CGMCC25404, the L-tryptophan-producing bacteria CGMCC25403, the L-arginine-producing bacteria CGMCC25402 and the L-valine-producing bacteria CGMCC22721 by introducing pET28(a)-fliI T171I The obtained recombinant bacteria.

[0053] The present invention also provides a method for preparing L-amino acids, which comprises: expressing fliI in a receptor biological cell, or increasing the content or activity of fliI in the receptor biological cell, or increasing the content or activity of fliI in the receptor biological cell to obtain a recombinant biological cell; and culturing the recombinant biological cell to obtain L-amino acids.

[0054] In the above method, the biological cell may be a yeast, bacterium, algae, fungus, plant cell or animal cell that can synthesize L-amino acids and / or contains a fliI encoding gene.

[0055] The biological cell is any biological cell that can synthesize the target amino acid.

[0056] Further, the bacterium can be Escherichia coli, Corynebacterium glutamicum, Brevibacterium lactofermentum, Corynebacterium pekinense, Brevibacterium ammoniae, Corynebacterium dentata, Pantoea, Pantoea ananatis, Bacillus brevis, Brevibacterium lactis or Brevibacterium flavum. The yeast can be Saccharomyces cerevisiae or Pichia pastoris.

[0057] In one embodiment of the present invention, the Escherichia coli is Escherichia coli W3110, Escherichia coli YP0158 (whose deposit number in the China National Microorganism Culture Collection Center is CGMCC No. 25404), Escherichia coli YP006D (whose deposit number in the China National Microorganism Culture Collection Center is CGMCC No. 25403), Escherichia coli YP004-8 (whose deposit number in the China National Microorganism Culture Collection Center is CGMCC No. 25402) or Escherichia coli YP045 (whose deposit number in the China National Microorganism Culture Collection Center is CGMCC No. 22721).

[0058] In the above method, the method can be achieved by introducing the fliI encoding gene into the recipient biological cell and expressing it, or increasing the copy number of the fliI encoding gene in the recipient biological cell;

[0059] Alternatively, the recipient biological cell contains the DNA molecule shown in SEQ ID No. 1, and the method is achieved by replacing the DNA molecule shown in SEQ ID No. 1 in the recipient biological cell with the DNA molecule shown in SEQ ID No. 4.

[0060] In the above method, the recombinant biological cell is cultured using a culture medium capable of growing the recombinant biological cell;

[0061] And / or, culturing the recombinant biological cell is performed using conditions that enable the recombinant biological cell to grow.

[0062] The culture medium may be a rich culture medium, the solvent of the rich culture medium is water, and the solutes and their concentrations in the rich culture medium are: glucose 30 g / L, (NH4)2SO4 2 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.05 g / L, MnSO4·H2O 0.05 g / L, FM902 yeast powder 1.5 g / L, corn syrup 5 g / L, molasses 17 g / L, betaine 0.5 g / L, citric acid 2 g / L, VH (vitamin H) 20 mg / L, VB1 1.5 mg / L, VB3 1.5 mg / L VB 12 1.5 g / L, sodium hydroxide was used to adjust the pH to 7.0.

[0063] The L-amino acid is L-threonine, the culture medium is an L-threonine fermentation medium, the solvent of the L-threonine fermentation medium is water, the solutes and their concentrations are 13 g / L of glucose, 1 g / L of (NH4)2SO4, 0.5 g / L of H3PO4, 0.8 g / L of KCl, 0.8 g / L of MgSO4·7H2O, 0.01 g / L of FeSO4·7H2O, 0.01 g / L of MnSO4·H2O, 1.5 g / L of FM902 yeast powder, 5 g / L of corn steep liquor, 17 g / L of molasses, and ammonia is added to adjust the pH to 7.0.

[0064] The L-amino acid is L-threonine, the culture medium is L-tryptophan fermentation medium, the solvent of the L-tryptophan fermentation medium is water, the solutes and their concentrations are glucose 7g / L, FM902 yeast powder 1g / L, (NH4)2SO4 1.2g / L, citric acid 1.2g / L, MgSO4·7H2O 1.5g / L, K2HPO4·3H2O 5.5g / L, defoamer 0.2mL / L, and ammonia is used to adjust the pH to 7.0.

[0065] The L-amino acid is L-threonine, the culture medium is L-arginine fermentation medium, the solvent of the L-arginine fermentation medium is water, the solutes and their concentrations are glucose 8g / L, FM902 yeast powder 3g / L, K2HPO4·3H2O 6g / L, MgSO4·7H2O 1g / L, FeSO4·7H2O 0.05g / L, betaine 0.5g / L, VB 12 0.005g / L, defoamer 0.3mL / L, ammonium sulfate 3g / L, pH 7.2.

[0066] The L-amino acid is L-threonine, the culture medium is L-valine fermentation medium, the solvent of the L-valine fermentation medium is water, the solutes and their concentrations are yeast extract powder 4g / L, corn steep liquor powder 2g / L, peptone 4g / L, methionine 2g / L, KH2PO4·3H2O 7g / L, MgSO4·7H2O 2g / L, CoCl2 20mg / L, (NH4)2SO4 3g / L, citric acid 2g / L, FeSO4·7H2O 50mg / L, MnSO4·7H2O 30mg / L, VH 20mg / L, VB1 1.5mg / L, VB31.5mg / L VB 12 1.5g / L, defoamer 0.3mL / L, (NH4)2SO4 3g / L, pH 7.0.

[0067] The present invention also provides a product for preparing L-amino acid, wherein the product contains (or its active ingredient is) fliI or the biological material.

[0068] In the present invention, the L-amino acid may be L-threonine, L-tryptophan, L-arginine or L-valine.

[0069] In the present invention, overexpression and point mutation of the flagella-specific ATP synthase gene fliI of Escherichia coli can increase the production of L-amino acids in Escherichia coli.

[0070] The fliI or the biomaterial of the present invention can be used to produce a variety of products, including but not limited to L-threonine, L-tryptophan, L-arginine or L-valine in the examples, and the products produced can also be glycine, alanine, leucine, isoleucine, methionine, proline, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, aspartic acid, histidine, shikimic acid, protocatechuic acid, succinic acid, alpha-ketoglutaric acid, citric acid, ornithine, citrulline, etc.

[0071] The fliI gene promoter is mutated, and the use of the obtained mutant promoter in the preparation of L-amino acids also falls within the protection scope of the present invention.

[0072] Experiments have shown that the fliI and related biomaterials of the present invention can increase the yield of L-amino acids, especially L-threonine, L-tryptophan, L-arginine and L-valine, and can be used to produce L-amino acids, having good application prospects.

[0073] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0074] Description of biological material deposit.

[0075] Classification name: Escherichia coli.

[0076] Strain number: YP0158.

[0077] Name of depository unit: General Microbiology Center of China Microbiological Culture Collection Administration.

[0078] Abbreviation of the depository: CGMCC.

[0079] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101.

[0080] Date of preservation: July 25, 2022.

[0081] The registration number of the Collection Center is: CGMCC No.25404.

[0082] Description of biological material deposit.

[0083] Classification name: Escherichia coli.

[0084] Strain number: YP006D.

[0085] Name of depository unit: General Microbiology Center of China Microbiological Culture Collection Administration.

[0086] Abbreviation of the depository: CGMCC.

[0087] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101.

[0088] Date of preservation: July 25, 2022.

[0089] The registration number of the Collection Center is: CGMCC No.25403.

[0090] Description of biological material deposit.

[0091] Classification name: Escherichia coli.

[0092] Strain number: YP004-8.

[0093] Name of depository unit: General Microbiology Center of China Microbiological Culture Collection Administration.

[0094] Abbreviation of the depository: CGMCC.

[0095] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101.

[0096] Date of preservation: July 25, 2022.

[0097] The registration number of the Collection Center is: CGMCC No.25402.

[0098] Description of biological material deposit.

[0099] Classification name: Escherichia coli.

[0100] Strain number: YP045.

[0101] Name of depository unit: General Microbiology Center of China Microbiological Culture Collection Administration.

[0102] Abbreviation of the depository: CGMCC.

[0103] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101.

[0104] Date of preservation: June 15, 2021.

[0105] The registration number of the Collection Center is: CGMCC No.22721. DETAILED DESCRIPTION

[0106] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The quantitative tests in the following examples were set up for three repeated experiments, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0107] In the following embodiments, the L-threonine producing bacteria CGMCC25404 is Escherichia coli YP0158, which has been deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration on July 25, 2022, with a deposit number of CGMCC No.25404.

[0108] In the following embodiments, the L-tryptophan-producing bacteria CGMCC25403 is Escherichia coli YP006D, which has been deposited in the General Microbiological Center of China National Culture Collection Administration on July 25, 2022, with a deposit number of CGMCC No.25403.

[0109] In the following embodiments, the L-arginine producing bacteria CGMCC25402 is Escherichia coli YP004-8, which has been deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration on July 25, 2022, with a deposit number of CGMCC No.25402.

[0110] In the following embodiments, the L-valine-producing bacterium CGMCC22721 is Escherichia coli YP045, which has been deposited in the General Microbiology Center of China National Culture Collection Administration on June 15, 2021, with a deposit number of CGMCC No.22721.

[0111] Example 1: Construction of a fliI mutant W3110 strain containing flagella-specific ATP synthase activity

[0112] 1. Construction of fliI mutant plasmid with flagellar-specific ATP synthase activity

[0113] For the convenience of research, the wild-type fliI gene (sequence as SEQ ID No. 1, encoding fliI protein as shown in SEQ ID No. 2) and its promoter were first cloned into the expression vector pET-28a (+). The genome sequence of Escherichia coli W3110 was used as a template, and PCR amplification was performed with primers pET28-PF / fliI-PF and fliI-PR / pET28-PR to obtain the wild-type fliI gene and its promoter fragment. The two PCR products were recovered and then connected to the expression vector backbone of pET-28a(+) (TaKaRa, containing kanamycin resistance) digested with EcoR I / Hind III using NEBuilder enzyme (NEB) at 50°C for 30 minutes. The ligation product was transformed into DH5α and spread on a 2-YT agar plate containing kanamycin (50 mg / L) and cultured at 37°C to obtain the pET-28a(+) transformant pET28(a)-fliI (the sequence of the fliI gene and its promoter is shown in SEQ ID No. 3) containing the correct sequence of the fliI gene and its promoter. The single clone grown in the culture was identified using primers T7t / T7 and r Taq PCR, and the pET-28a(+) positive transformant pET28(a)-fliI containing fliI and its promoter was amplified by PCR containing a fragment of 1874 bp.

[0114] In SEQ ID No. 3, positions 37 to 250 are the sequence of the fliI gene promoter, and positions 251 to 1624 are the sequence of the fliI gene.

[0115] In order to obtain a mutant of the flagellar-specific ATP synthase gene fliI, a fliI mutant gene plasmid was prepared using a random mutagenesis kit (Agilent Technologies, USA). Using plasmid pET28(a)-fliI as a template, PCR amplification was performed with primers pET28-PF / pET28-PR, respectively, to obtain a 1660bp fliI gene fragment containing random point mutations, pET-28a(+) positive transformant pET28(a)-fliI (sequence as SEQ ID No.3, but there are random point mutations in the fliI coding region).

[0116] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, Primer (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0117] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0118] The recovered DNA fragment was connected to the expression vector backbone of pET-28a (+) (TaKaRa, containing kanamycin resistance) after EcoR I / HindIII digestion using NEBuilder enzyme (NEB) at 50°C for 30 minutes, and the ligation product was transformed into DH5α, and spread on 2-YT agar plates containing kanamycin (50 mg / L) and cultured at 37°C. The single clones grown in the culture were identified using primers T7t / T7 and r Taq PCR, and the PCR amplified fragment containing a size of 1874bp (random point mutations in the fliI coding region) was a pET-28a (+) positive transformant containing random mutations in fliI.

[0119] PCR amplification system: 2×PremixrTaq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O to a total volume of 25 μL.

[0120] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0121] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0122] pET28-PF:5'- CGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTGC TCTCGTCTCCCGGATAATTT-3' (the underlined nucleotide sequence is the pET-28a (+) homology arm sequence),

[0123] fliI-PF:5'-CGAGTCAGGC GCGTGGTCATCGCGCACCTC GTGGCTGATT-3',

[0124] fliI-PR:5'-AATCAGCCAC GAGGTGCGCGATGACCACGC GCCTGACTCG-3',

[0125] pET28-PR:5'- TAGCATGACTGGTGGACAGCAAATGGGTCGCGGATC TTATGACACTGTCGGGAAAA-3' (the underlined nucleotide sequence is the pET-28a (+) homology arm sequence),

[0126] T7t: 5'-GCTAGTTATT GCTCAGCGG-3',

[0127] T7: 5'-TAATACGACTCACTATAGGG-3'.

[0128] 2. Construction of fliI mutant strain with flagella-specific ATP synthase activity

[0129] In order to identify the L-amino acid production performance of the mutant vector constructed in step 1, specifically, the fliI random mutant plasmid constructed in step 1 was introduced into the Escherichia coli W3110 strain (identification was the same as step 1), and the positive transformants were continuously subcultured three times on a 2-YT agar plate containing kanamycin (50 mg / L), and then inoculated into a 500 mL Erlenmeyer flask containing 30 mL of rich culture medium and fermented at 37°C for 24 h. The fermentation culture cells grew to OD 600 =0.2, IPTG was added at a final concentration of 0.1 mM to induce overexpression of flagella-specific ATP synthase, and fermentation broth was obtained after fermentation was completed. Escherichia coli W3110 was used as a control.

[0130] After the fermentation culture was completed, the concentration of L-amino acids in the fermentation broth was analyzed by high performance liquid chromatography (HPLC), as shown in Table 1. The strain with superior L-amino acid production capacity compared with the W3110 control was selected, namely the W3110-fliI mutant.

[0131] Rich medium: The solvent is water, and the solutes and their concentrations are: glucose 30g / L, (NH4)2SO42g / L, H3PO40.5g / L, KCl 0.8g / L, MgSO4·7H2O 0.8g / L, FeSO4·7H2O 0.05g / L, MnSO4·H200.05g / L, FM902 yeast powder 1.5g / L, corn syrup 5g / L, molasses 17g / L, betaine 0.5g / L, citric acid 2g / L, VH (vitamin H) 20mg / L, VB1 1.5mg / L, VB3 1.5mg / L VB 12 1.5 g / L, sodium hydroxide was used to adjust the pH to 7.0.

[0132] Table 1 Results of HPLC analysis of L-amino acids in the W3110-fliI mutant

[0133]

[0134] As shown in Table 1, the obtained Escherichia coli W3110-fliI mutant strain has the ability to produce some L-amino acids, among which the ability of W3110-fliI mutant strain 2 to produce L-threonine, L-arginine and L-valine is superior. This indicates that fliI mutant strain 2 has the activity of synthesizing L-threonine, L-arginine and L-valine.

[0135] By extracting the plasmid from W3110-fliI mutant strain 2 and sequencing the fliI gene, it was confirmed that the 512th cytosine (C) in the nucleotide sequence of the fliI mutant was mutated to thymine (T), and the 171st threonine (T) in the amino acid sequence of its mutant protein fliI was mutated to isoleucine (I). This plasmid is pET28(a)-T171I (containing a DNA fragment in which the 762nd position of the sequence such as SEQ ID No.3 is mutated to T), and W3110-fliI mutant strain 2 is recorded as W3110-pET28(a)-T171I.

[0136] Among them, the DNA sequence shown in SEQ ID No.1 is the wild-type fliI gene, and the amino acid sequence of the encoded protein is SEQ ID No.2 (the protein name is recorded as the wild-type fliI protein); the DNA sequence shown in SEQ ID No.4 is the mutant fliI T171I Gene, mutant fliI T171I In the gene sequence (SEQ ID No.4), the thymine (T) at position 512 is mutated to cytosine (C), and the amino acid sequence of the encoded protein is SEQ ID No.5 (the name of the mutant protein is mutant fliI T171I protein), mutant protein fliI T171I The isoleucine (I) at position 171 in the amino acid sequence (SEQ ID No. 5) was mutated from threonine (T).

[0137] 3. Construction of fliI mutant plasmid with flagellar-specific ATP synthase activity

[0138] W3110-fliI mutant 2 was obtained by random mutation of wild-type Escherichia coli W3110. In order to obtain more fliI mutants to improve their L-amino acid production capacity, mutants in which the amino acid at the above-mentioned fliI mutation position was replaced with different amino acids were constructed. Specifically, using the plasmid sequenced in step 2 (i.e., pET28(a)-T171I) as a template, 5 mutants in which the amino acid at position 171 of fliI was replaced with different amino acids were constructed. The amino acids replaced by the mutants and the names of the primers used in each mutant are shown in Table 2.

[0139] Table 2. Amino acids substituted by fliI mutants and primer names used in each mutant

[0140]

[0141] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0142] N-PR:5'-CCAACGtTAA GCAGGGCATT GATTGGGCGC ACGC-3',

[0143] N-PF:5'-GCGTGCGCCC AATCAATGCC CTGCTTAaCG TTGG-3',

[0144] S-PR:5'-CCAACGcTAA GCAGGGCATT GATTGGGCGC ACGC-3',

[0145] S-PF:5'-GCGTGCGCCC AATCAATGCC CTGCTTAgCG TTGG-3',

[0146] A-PR:5'-CCAACGgcAA GCAGGGCATT GATTGGGCGC ACGC-3',

[0147] A-PF:5'-GCGTGCGCCC AATCAATGCC CTGCTTgcCG TTGG-3',

[0148] M-PR:5'-CCAACcaTAA GCAGGGCATT GATTGGGCGC ACGC-3',

[0149] M-PF:5'-GCGTGCGCCC AATCAATGCC CTGCTTAtgG TTGG-3',

[0150] P-PR:5'-CCAACGggAA GCAGGGCATT GATTGGGCGC ACGC-3',

[0151] P-PF:5'-GCGTGCGCCC AATCAATGCC CTGCTTccCG TTGG-3'。

[0152] The plasmid pET28(a)-T171I sequenced in step 2 was used as a template, and PCR amplification was performed using the primers in Table 2 and KAPA HiFiHotStart, respectively, to obtain two Up DNA fragments of 768 bp and Down DNA fragments of 926 bp, each carrying a fliI mutant nucleotide. After the PCR reaction, a column DNA gel recovery kit was used to perform agarose gel electrophoresis to recover the Up and Down DNA fragments. The recovered DNA fragments were connected to the expression vector backbone recovered by EcoR I / Hind III digestion of pET-28a(+) using NEBuilder enzyme (NEB) at 50°C for 30 minutes, and the ligation product was transformed into DH5α, and coated on a 2-YT agar plate containing kanamycin (50 mg / L) and cultured at 37°C. The single clones grown in culture were identified using primers T7t / T7PCR, and the positive transformants containing a fragment of 1874 bp in size, which were fliI mutant pET-28a(+), were amplified using rTaqPCR. The five fliI mutant vectors in which the threonine at position 171 was replaced with the amino acids in Table 2 were named as listed in Table 2.

[0153] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPAHiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0154] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0155] PCR amplification system: 2×Premix r Taq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O, total volume 25 μL.

[0156] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0157] The difference between pET28(a)-T171N and pET28(a)-fliI is that pET28(a)-T171N replaces the wild-type fliI gene in pET28(a)-fliI with a mutant fliI gene. T171N The recombinant vector obtained by gene sequence, pET28(a)-T171N, can express fliI T171NMutant protein; wild-type fliI gene and mutant fliI T171N The only difference between the genes is that the 511-513th position of the wild-type fliI gene is ACC, and the mutant fliI T171N The 511-513th position of the gene is AAC; the wild-type fliI protein and fliI T171N The mutant proteins differ only in that the wild-type fliI protein has a threonine residue T at position 171. T171N The mutant protein has an asparagine residue N at position 171;

[0158] The difference between pET28(a)-T171S and pET28(a)-fliI is that pET28(a)-T171S replaces the wild-type fliI gene in pET28(a)-fliI with a mutant fliI T171S The recombinant vector obtained by gene sequence, pET28(a)-T171S, can express fliI T171S Mutant protein; wild-type fliI gene and mutant fliI T171S The only difference between the genes is that the 511-513th position of the wild-type fliI gene is ACC, and the mutant fliI T171S The 511-513th position of the gene is AGC; the wild-type fliI protein is similar to fliI T171S The mutant proteins differ only in that the wild-type fliI protein has a threonine residue T at position 171. T171S The 171st position of the mutant protein is a serine residue, S;

[0159] The difference between pET28(a)-T171A and pET28(a)-fliI is that pET28(a)-T171A replaces the wild-type fliI gene in pET28(a)-fliI with a mutant fliI T171A The recombinant vector obtained by gene sequence, pET28(a)-T171A, can express fliI T171A Mutant protein; wild-type fliI gene and mutant fliI T171A The only difference between the genes is that the 511-513th position of the wild-type fliI gene is ACC, and the mutant fliI T171A The 511-513th position of the gene is GCC; the wild-type fliI protein is similar to fliI T171A The mutant proteins differ only in that the wild-type fliI protein has a threonine residue T at position 171. T171A The mutant protein has an alanine residue A at position 171;

[0160] The difference between pET28(a)-T171M and pET28(a)-fliI is that pET28(a)-T171M replaces the wild-type fliI gene in pET28(a)-fliI with a mutant fliI T171M The recombinant vector obtained by gene sequence, pET28(a)-T171M, can express fliI T171M Mutant protein; wild-type fliI gene and mutant fliI T171M The only difference between the genes is that the 511-513th position of the wild-type fliI gene is ACC, and the mutant fliI T171M The 511-513th position of the gene is ATG; the wild-type fliI protein is similar to fliI T171M The mutant proteins differ only in that the wild-type fliI protein has a threonine residue T at position 171. T171M The 171st position of the mutant protein is a methionine residue M;

[0161] The difference between pET28(a)-T171P and pET28(a)-fliI is that pET28(a)-T171P replaces the wild-type fliI gene in pET28(a)-fliI with a mutant fliI T171P The recombinant vector obtained by gene sequence, pET28(a)-T171P, can express fliI T171P Mutant protein; wild-type fliI gene and mutant fliI T171P The only difference between the genes is that the 511-513th position of the wild-type fliI gene is ACC, and the mutant fliI T171P The 511-513th position of the gene is CCC; the wild-type fliI protein is similar to fliI T171P The mutant proteins differ only in that the wild-type fliI protein has a threonine residue T at position 171. T171P The 171st position of the mutant protein is a proline residue P.

[0162] 4. Construction of a fliI mutant strain with flagellar-specific ATP synthase activity

[0163] In order to identify the production performance of the mutant vector constructed in step 3 for L-amino acids, specifically, the plasmid constructed in step 3 was introduced into the Escherichia coli W3110 strain (identification was the same as step 1), and the positive transformants were successively subcultured three times on 2-YT agar plates containing kanamycin (50 mg / L), and then inoculated into a 500 mL Erlenmeyer flask containing 30 mL of rich culture medium and fermented at 37°C for 24 h. The fermentation culture cells grew to OD 600=0.2, IPTG was added at a final concentration of 0.1 mM to induce overexpression of flagellar-specific ATP synthase.

[0164] After the fermentation culture was completed, the concentration of L-amino acids in the fermentation broth was analyzed by high performance liquid chromatography (HPLC), as shown in Table 3. The ability of the mutant strain W3110-pET28(a)-T171I to produce L-threonine, L-arginine and L-valine was superior to that of W3110-pET28(a)-T171N, W3110-pET28(a)-T171S, W3110-pET28(a)-T171A, W3110-pET28(a)-T171M and W3110-pET28(a)-T171P.

[0165] Table 3 Results of HPLC analysis of L-amino acids of W3110-fliI mutant

[0166]

[0167] Example 2: Construction of fliI mutant engineered strain containing flagella-specific ATP synthase activity

[0168] Based on the genome sequence of Escherichia coli W3110 published by NCBI, the CRISPR / Cas9 gene editing method was used to perform point mutations on the fliI gene of the L-amino acid high-producing strain, in order to further study the fliI gene and mutant fliI in the high-producing strain. T171I Effects of genes on the production of L-amino acids such as L-threonine, L-tryptophan, L-valine and L-arginine.

[0169] A point mutation was introduced into the fliI gene coding region (SEQ ID No. 1), wherein the 512th cytosine (C) in the nucleotide sequence of the fliI gene (SEQ ID No. 1) was mutated to thymine (T) to obtain a DNA molecule shown in SEQ ID No. 4 (mutant fliI gene, named mutant fliI T171I Gene).

[0170] The amino acid sequence of the protein encoded by the DNA molecule shown in SEQ ID No.1 is SEQ ID No.2 (wild-type fliI protein). The amino acid sequence of the protein encoded by the DNA molecule shown in SEQ ID No.4 is SEQ ID No.5 (the name of the mutant protein is mutant fliI T171I protein), mutant protein fliI T171IThe isoleucine (I) at position 171 in the amino acid sequence (SEQ ID No. 5) was mutated from threonine (T).

[0171] 1. Construction of sgRNA

[0172] Based on the Escherichia coli W3110 genome sequence published by NCBI, CRISPR RGEN Tools ( http: / / www.rgenome.net / cas-designer / ) Design the sgRNA target sequence. After selecting the appropriate sgRNA target sequence, add the linearized pGRB cloning vector end sequence to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0173] To amplify the sgRNA fragment, no template is required, only the PCR annealing process is required. The system and procedure are as follows. PCR reaction system: sgRNA-1F 10μL, sgRNA-1R 10μL; PCR reaction procedure: 95℃ denaturation for 5min, 50℃ annealing for 1min. After annealing, the target fragment (i.e., sgRNA) was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100ng / μL.

[0174] Extract pGRB plasmid (Addgene) and digest with SpeI and dephosphorylate to prevent pGRB plasmid from self-ligation. Enzyme digestion system: 10xBuffer 5μL, Spe I 2.5μL, pGRB plasmid DNA 3000-5000ng, supplemented with ddH2O to 50μL. After 37℃ digestion for 3h, agarose gel electrophoresis was performed and the gel was recovered and dephosphorylated. The dephosphorylation system: 10xBuffer 5μL, linearized pGRB plasmid DNA 1000-2000ng, CIAP 2.5μL, supplemented with ddH2O to 50μL. After 37℃ treatment for 1h, the linear pGRB plasmid was recovered using a DNA purification kit. The Gibson Assembly Kit (New England) was used to reconstitute sgRNA and pGRB plasmid. Recombination system: NEB assembly enzyme 2.5μL, linear pGRB plasmid 2μL, sgRNA 0.5μL. After assembling at 50°C for 30 min, the product was transformed into DH5α competent cells, the plasmid was extracted, and sequencing was performed using sequencing primers sgRNA-PF / sgRNA-PR. The constructed plasmid was named pGRB-sgRNA-1.

[0175] The primers used in this experiment were designed as follows (synthesized by Shanghai Invitrogen). The underlined nucleotides are the homology arm sequences of the pGRB cloning vector, and the nucleotides in lowercase are the sgRNA sequences:

[0176] sgRNA-1F:5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT tcgttggctt taacggtcaa GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG -3',

[0177] sgRNA-1R:5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC ttgaccgtta aagccaacga A CTAGTATTATACCTAGGACTGAGCTAGCTGTCA -3',

[0178] sgRNA-PF:5'-GTCTCATGAGCGGATACATATTTG-3',

[0179] sgRNA-PR:5'-ATGAGAAAGCGCCACGCT-3'.

[0180] 2. Gene mutant fliI T171I Amplification of DNA

[0181] Using W3110 genomic DNA as a template, PCR amplification was performed with primers P1 / P2, P3 / P4 and KAPA HiFi HotStart to obtain two fliI fragments with mutant nucleotides of 607 bp and 697 bp, respectively. T171I DNA fragment (fliI T171I Up and fliI T171I After the PCR reaction was completed, agarose gel electrophoresis was used to recover fliI T171I Up and fliI T171I The recovered DNA was PCR-generated with primers P1 / P4 overlap to obtain the point mutation integration homology arm DNA fragment Up-fliI T171I -Down (SEQ ID No. 6) 1270 bp.

[0182] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0183] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0184] The primers were designed as follows (synthesized by Shanghai Invitrogen Company). The nucleotides in lowercase bold font are the mutation positions:

[0185] P1:5'-AAAGTCTCCG CCGATGAAGG-3',

[0186]

[0187]

[0188] P4:5'-AGCTGTTTGA AGGTGCGCAC-3'.

[0189] 3. Preparation and transformation of competent cells

[0190] The pREDCas9 plasmid (containing the spectinomycin resistance gene) (Addgene) was extracted and transformed into the competent cells of L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721, respectively. The competent cells were spread on 2-YT agar plates containing spectinomycin (100 mg / L) and cultured at 32°C. Single colonies resistant to spectinomycin (100 mg / L) were selected and identified by r Taq PCR with primers pRedCas9-PF / pRedCas9-PR, and 943 bp were obtained, which were L-threonine CGMCC25404-Cas9, L-tryptophan CGMCC25403-Cas9, L-arginine CGMCC25402-Cas9 and L-valine CGMCC22721-Cas9 transformants containing the pREDCas9 plasmid.

[0191] Prepare L-threonine CGMCC25404-Cas9, L-tryptophan CGMCC25403-Cas9, L-arginine CGMCC25402-Cas9 and L-valine CGMCC22721-Cas9 competent cells. 600 =0.1Add IPTG at a final concentration of 0.1 mM to induce λ-Red-mediated homologous recombination. 600 =0.6, collect the bacteria to prepare competent cells, and transform the pGRB-sgRNA-1 plasmid and the point mutation recombinant DNA fragment Up-fliI T171I-Down, spread on 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and cultured at 32°C. The transformants were identified by PCR using primers P5 / P6 and r Taq, and the resulting 265 bp PCR product was denatured at 95°C for 10 min and ice-bathed for 5 min before SSCP (Single-Strand Conformation Polymorphism) electrophoresis (using Up-fliI T171I -Down amplified PCR fragment as a positive control, W3110 amplified PCR fragment as a negative control, water as a blank control). Due to the different fragment structures and electrophoretic positions, the strains whose PCR fragment electrophoretic positions were inconsistent with the negative control fragment positions and consistent with the positive control fragment positions were strains with successful allelic replacement.

[0192] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0193] P5:5'-GTTATTAGGT CGCGTTCTGG-3',

[0194] P6:5'-GACATCGGCG CGGGTGTAAC-3',

[0195] pRedCas9-PF:5'-GCAGTGGCGGTTTTCATG-3',

[0196] pRedCas9-PR:5'-CCTTGGTGATCTCGCCTTTC-3'.

[0197] PCR amplification system: 2×Premix r Taq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O, total volume 25 μL.

[0198] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0199] Preparation and electrophoresis conditions of SSCP electrophoresis PAGE: 8 mL of 40% acrylamide, 4 mL of glycerol, 2 mL of 10×TBE, 40 μL of TEMED, 600 μL of 10% APS, and 26 mL of ddH2O; place the electrophoresis tank in ice and perform electrophoresis in 1×TBE buffer at a voltage of 120 V for 10 h.

[0200] The transformants with successful point mutation were inoculated in 2-YT medium containing spectinomycin (100 mg / L) and arabinose at a final concentration of 0.2% to eliminate the plasmid pGRB-sgRNA-1, and colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected, and then these colonies were transferred to 2-YT medium and cultured at 42°C to eliminate the pREDCas9 plasmid. Colonies that did not grow on spectinomycin (100 mg / L) but grew on 2-YT without resistance were selected, and the point mutation sequence was amplified by primer P5 / P6 PCR again, and the sequencing results were compared with the W3110 genome sequence to determine that the mutation of nucleotide C at position 512 of the fliI gene to nucleotide T was the gene mutant fliI T171I Positive transformants. T171I The L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721 were named YPThr11, YPTrp001, YPR-061 and YPV-099, respectively.

[0201] The difference between YPThr11 and L-threonine-producing strain CGMCC25404 is only in the 512th nucleotide of the fliI gene, which is C in L-threonine-producing strain CGMCC25404 and T in YPThr11;

[0202] The only difference between YPTrp001 and L-tryptophan-producing strain CGMCC25403 is the nucleotide 512 of the fliI gene, which is C in L-tryptophan-producing strain CGMCC25403 and T in YPTrp001;

[0203] The difference between YPR-061 and L-arginine-producing strain CGMCC25402 is only in the 512th nucleotide of the fliI gene, which is C in L-arginine-producing strain CGMCC25402 and T in YPR-061;

[0204] The only difference between YPV-099 and the L-valine producing bacterium CGMCC22721 is the 512th nucleotide of the fliI gene, which is C in the L-valine producing bacterium CGMCC22721 and T in YPV-099.

[0205] Example 3: Construction of fliI and fliI containing flagellar-specific ATP synthase activity overexpressed on the genome T171I Engineered strains

[0206] Based on the Escherichia coli W3110 genome sequence published by NCBI, the wild-type fliI gene and mutant fliI were respectively integrated into the yaiT gene coding region of L-threonine-producing strain CGMCC25404, L-tryptophan-producing strain CGMCC25403, L-arginine-producing strain CGMCC25402 and L-valine-producing strain CGMCC22721 (sequencing confirmed that the wild-type yaiT and fliI genes were retained on the chromosomes of these amino acid-producing strains) using the CRISPR / Cas9 gene editing method. T171I gene, in order to further study the fliI gene and mutant fliI in high-yield strains T171I The effect of genes on the synthesis of L-amino acids such as L-threonine, L-tryptophan, L-valine and L-arginine.

[0207] 1. Construction of sgRNA

[0208] Based on the Escherichia coli W3110 genome sequence published by NCBI, CRISPR RGEN Tools ( http: / / www.rgenome.net / cas-designer / ) Design the sgRNA target sequence. After selecting the appropriate sgRNA target sequence, add the linearized pGRB cloning vector end sequence to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0209] To amplify the sgRNA fragment, no template is required, only the PCR annealing process is required. The system and procedure are as follows. PCR reaction system: sgRNA-2F 10μL, sgRNA-2R 10μL; PCR reaction procedure: 95℃ denaturation for 5min, 50℃ annealing for 1min. After annealing, the target fragment was recovered using a DNA purification kit, its DNA concentration was determined, and the concentration was diluted to 100ng / μL.

[0210] Extract the pGRB plasmid and digest it with SpeI and dephosphorylate it to prevent the pGRB plasmid from self-ligating. Enzyme digestion system: 10xBuffer 5μL, Spe I 2.5μL, pGRB plasmid DNA 3000-5000ng, supplemented with ddH2O to 50μL. After 37℃ digestion for 3h, agarose gel electrophoresis was performed to cut the gel and then dephosphorylated. The dephosphorylation system: 10xBuffer 5μL, pGRB plasmid DNA 1000-2000ng, CIAP 2.5μL, supplemented with ddH2O to 50μL. After 37℃ treatment for 1h, the linear pGRB plasmid was recovered using a DNA purification kit. The Gibson Assembly Kit (New England) was then used for the recombination of sgRNA and pGRB plasmid. Recombination system: NEB assembly enzyme 2.5μL, linearized cloning vector 2μL, sgRNA 0.5μL. After assembling at 50°C for 30 min, the product was transformed into DH5α competent cells, the plasmid was extracted, and sequencing was performed using sequencing primers sgRNA-PF / sgRNA-PR. The constructed plasmid was named pGRB-sgRNA-2.

[0211] The primers used in this experiment were designed as follows (synthesized by Shanghai Invitrogen). The underlined nucleotides are the homology arm sequences of the pGRB cloning vector, and the nucleotides in lowercase highlighted fonts are the sgRNA sequences:

[0212] sgRNA-2F:5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT ggcaactatgtaaactatag GT TTTAGAGCTAGAAATAGCAAGTTAAAATAAGG -3',

[0213] sgRNA-2R:5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC ctatagtttacatagttgcc AC TAGTATTATACCTAGGACTGAGCTAGCTGTCA -3',

[0214] sgRNA-PF: 5'-GTCTCATGAGCGGATACATATTTG-3',

[0215] sgRNA-PR: 5'-ATGAGAAAGCGCCACGCT-3'.

[0216] 2. PCR amplification of genomic overexpressed DNA sequences

[0217] Based on the Escherichia coli W3110 genome sequence published by NCBI, four pairs of upstream and downstream homology arm sequences and fliI or fliI were designed and synthesized. T171IPrimers for the gene coding region and promoter region were used to introduce fliI gene or fliI into the yaiT coding region of L-amino acid producing bacteria by CRISPR / Cas9 gene editing. T171I Gene.

[0218] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0219] P7:5'-AAGAGAATGG AAGAGAGGCC-3',

[0220] P8:5'-AAATTATCCG GGAGACGAGACCCAATCAAG TGCTGTAACG-3',

[0221] P9:5'-CGTTACAGCA CTTGATTGGGTCTCGTCTCC CGGATAATTT-3',

[0222] P10:5'-CGAGTCAGGC GCGTGGTCATCGCGCACCTC GTGGCTGATT-3',

[0223] P11:5'-AATCAGCCAC GAGGTGCGCGATGACCACGC GCCTGACTCG-3',

[0224] P12:5'-CGGTAGTGTA GGTTTCGTTGTTATGACACT GTCGGGAAAA-3',

[0225] P13:5'-TTTTCCCGAC AGTGTCATAACAACGAAACC TACACTACCG-3',

[0226] P14:5'-CGACCTGTAG TATCCCATTC-3'.

[0227] Using W3110 genomic DNA as a template, primers P7 / P8 and P13 / P14 and KAPA HiFi HotStart PCR amplification were used to obtain 590 bp of upper homology arm (1-590 of SEQ ID No.7) and 605 bp of lower homology arm fragment (2139-2743 of SEQ ID No.7); using W3110 genomic DNA as a template, primers P9 / P10 and KAPA HiFi HotStart PCR amplification of 254 bp of fliI promoter fragment (551-804 of SEQ ID No.7); using W3110 genomic DNA and plasmid pET28(a)-fliI T171IAs template, primers P11 / P12 and KAPA HiFi HotStart were used to PCR amplify fliI (765-2178 of SEQ ID No. 7) and fliI T171I After the PCR reaction, the DNA was recovered by agarose gel electrophoresis using a column DNA gel recovery kit. The recovered DNA was PCR-generated with primers P7 and P14 overlap PCR to obtain the genomic overexpressed DNA recombinant fragments Up-fliI-Down (SEQ ID No.7) and Up-fliI T171I -Down (SEQ ID No. 8) 2743 bp.

[0228] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0229] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0230] 3. Preparation and transformation of competent cells

[0231] Prepare L-threonine CGMCC25404-Cas9, L-tryptophan CGMCC25403-Cas9, L-arginine CGMCC25402-Cas9 and L-valine CGMCC22721-Cas9 competent cells. 600 =0.1Add IPTG at a final concentration of 0.1 mM to induce λ-Red-mediated homologous recombination. 600 =0.6, collect the bacteria to prepare competent cells, and transform the pGRB-sgRNA-2 plasmid and the genomic overexpression DNA fragment Up-fliI-Down or Up-fliI T171I-Down, spread on 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and cultured at 32°C. The single colonies produced by the culture were identified by r Taq PCR using primers P15 / P16. The fragment containing 1482 bp (the sequence without point mutation is shown in SEQ ID No.9, the 1408th position of the sequence containing point mutation is T, and the rest is as shown in SEQ ID No.9) amplified by PCR was a positive transformant, and the fragment that could not be amplified was the original bacterium.

[0232] The positive transformants were inoculated in 2-YT medium containing spectinomycin (100 mg / L) and arabinose with a final concentration of 0.2% to eliminate the plasmid pGRB-sgRNA-2, and colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected, and then these colonies were transferred to 2-YT medium and cultured at 42°C to eliminate the pREDCas9 plasmid. Colonies that did not grow on spectinomycin (100 mg / L) but grew on 2-YT without resistance were selected and identified by r Taq PCR using primers P17 / P18. The PCR amplified sequences containing 1958 bp in size (the sequence without point mutations is shown in SEQ ID No. 10, the 320th position of the sequence containing point mutations is T, and the rest are as shown in SEQ ID No. 10) are positive transformants, and the ones that could not amplify the fragments are the original bacteria.

[0233] The wild-type fliI gene and mutant fliI gene were overexpressed in the genomes of L-threonine-producing strain CGMCC25404, L-tryptophan-producing strain CGMCC25403, L-arginine-producing strain CGMCC25402, and L-valine-producing strain CGMCC22721. T171I The genes were named YPThr12 (without mutation point) and YPThr13 (with mutation point), YPTrp002 (without mutation point) and YPTrp003 (with mutation point), YPR-062 (without mutation point) and YPR-063 (with mutation point), YPV-100 (without mutation point) and YPV-101 (with mutation point).

[0234] The recombinant bacteria YPThr12, YPTrp002, YPR-062 and YPV-100 contain double copies of the fliI gene shown in SEQ ID No. 1; specifically, the recombinant bacteria YPThr12, YPTrp002, YPR-062 and YPV-100 are obtained by replacing the yaiT partial coding region on the genomes of L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721 with the fliI gene and its promoter, while keeping other nucleotides in the genome unchanged. The recombinant bacteria containing double copies of the fliI gene can significantly and stably increase the expression level of the fliI gene.

[0235] The recombinant bacteria YPThr13, YPTrp003, YPR-063 and YPV-101 contain the mutated fliI shown in SEQ ID No.3 T171I Specifically, the recombinant bacteria YPThr13, YPTrp003, YPR-063 and YPV-101 are L-threonine producing bacteria CGMCC25404, L-tryptophan producing bacteria CGMCC25403, L-arginine producing bacteria CGMCC25402 and L-valine producing bacteria CGMCC22721 The yaiT part of the coding region on the genome is replaced with a mutant fliI T171I The recombinant bacteria obtained by removing the fliI gene and its promoter and keeping the other nucleotides in its genome unchanged. These recombinant bacteria all contain the fliI gene and its promoter, and also contain the fliI T171I Genes and their promoters.

[0236] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0237] P15:5'-GGGCGTTGGA TTAAGTCTGT-3',

[0238] P16:5'-CCATCATCCC CAGCAGCACA-3',

[0239] P17:5'-GTAGAAAGCG AAGTCGTTGG-3',

[0240] P18:5'-CCCACCCAGT AGATTCGGTC-3'.

[0241] PCR amplification system: 2×Premix r Taq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O, total volume 25 μL.

[0242] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0243] Example 4: Construction of an engineered strain of fliI lacking flagellar-specific ATP synthase activity in the genome

[0244] Based on the Escherichia coli W3110 genome sequence published by NCBI, the CRISPR / Cas9 gene editing method was used to knock out the fliI gene in L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402 and L-valine-producing bacteria CGMCC22721 (sequencing confirmed that the wild-type fliI gene was retained on the chromosomes of these amino acid-producing strains). In this way, the effect of the Escherichia coli fliI gene on the synthesis of L-amino acids such as L-threonine, L-tryptophan, L-valine and L-arginine was further studied in high-yield strains.

[0245] 1. Construction of sgRNA

[0246] Based on the Escherichia coli W3110 genome sequence published by NCBI, CRISPR RGEN Tools ( http: / / www.rgenome.net / cas-designer / ) Design the sgRNA target sequence. After selecting the appropriate sgRNA target sequence, add the linearized pGRB cloning vector homology arm sequence to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid through recombination.

[0247] To amplify the sgRNA fragment, no template is required, only the PCR annealing process is required. The system and procedure are as follows: PCR reaction system: sgRNA-3F 10μL, sgRNA-3R 10μL; PCR reaction procedure: 95℃ denaturation for 5min, 50℃ annealing for 1min. After annealing, the target fragment is recovered using a DNA purification kit, its DNA concentration is determined, and the concentration is diluted to 100ng / μL.

[0248] Extract the pGRB plasmid and digest it with SpeI and dephosphorylate it to prevent the pGRB plasmid from self-ligating. Enzyme digestion system: 10xBuffer 5μL, Spe I 2.5μL, pGRB plasmid DNA 3000-5000ng, supplemented with ddH2O to 50μL. After 37℃ digestion for 3h, agarose gel electrophoresis was performed to cut the gel and then dephosphorylated. The dephosphorylation system: 10xBuffer 5μL, linearized pGRB plasmid DNA 1000-2000ng, CIAP 2.5μL, supplemented with ddH2O to 50μL. After 37℃ treatment for 1h, the linearized pGRB plasmid was recovered using a DNA purification kit. The Gibson Assembly Kit (New England) was used to reconstitute the sgRNA and pGRB plasmid. Recombination system: NEB assembly enzyme 2.5μL, linearized cloning vector 2μL, sgRNA 0.5μL. After assembling at 50°C for 30 min, the product was transformed into DH5α competent cells, the plasmid was extracted, and sequencing was performed using sequencing primers sgRNA-PF / sgRNA-PR. The constructed plasmid was named pGRB-sgRNA-3.

[0249] The primers used in this experiment were designed as follows (synthesized by Shanghai Invitrogen). The underlined nucleotides are the homology arm sequences of the pGRB cloning vector, and the nucleotides in lowercase highlighted fonts are the sgRNA sequences:

[0250] sgRNA-3F:5'- TGACAGCTAGCTCAGTCCTAGGTATAATACTAGT caaaatggcgcagttgcctg GT TTTAGAGCTAGAAATAGCAAGTTAAAATAAGG -3',

[0251] sgRNA-3R:5'- CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC caggcaactgcgccattttg AC TAGTATTATACCTAGGACTGAGCTAGCTGTCA -3',

[0252] sgRNA-PF:5'-GTCTCATGAGCGGATACATATTTG-3',

[0253] sgRNA-PR:5'-ATGAGAAAGCGCCACGCT-3'.

[0254] 2. PCR amplification of the missing DNA recombinant fragments in the genome

[0255] Based on the Escherichia coli W3110 genome sequence published by NCBI, two pairs of primers for amplifying upstream and downstream homology arm sequences were designed and synthesized, and the fliI gene of L-amino acid producing bacteria was knocked out by CRISPR / Cas9 gene editing.

[0256] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0257] P19:5'-GCGGCGAGGA TACCTATGTC-3',

[0258] P20:5'-ATCTGCCGTT ATCTCCTGGG TACACCACTC CTGGTGCTGC-3',

[0259] P21:5'-GCAGCACCAG GAGTGGTGTA CCCAGGAGAT AACGGCAGAT-3',

[0260] P22:5'-GCGCGTCGGA AACAATATCG-3'.

[0261] Using W3110 genomic DNA as a template, primers P19 / P20, P21 / P22 and KAPA HiFi HotStart PCR were used to amplify the fragments of upper homology arm and lower homology arm with sizes of 721 bp and 695 bp respectively; after the PCR reaction, the fragments were recovered by agarose gel electrophoresis using a column DNA gel recovery kit. The recovered DNA was subjected to overlap PCR with primers P19 / P22 to obtain a recombinant DNA fragment ΔfliI-Up-Dwon (SEQ ID No.11) of 1376 bp lacking fliI in the genome.

[0262] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0263] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0264] 3. Preparation and transformation of competent cells

[0265] Prepare L-threonine CGMCC25404-Cas9, L-tryptophan CGMCC25403-Cas9, L-arginine CGMCC25402-Cas9 and L-valine CGMCC22721-Cas9 competent cells. 600=0.1Add IPTG at a final concentration of 0.1 mM to induce λ-Red-mediated homologous recombination. 600 =0.6, the bacteria were collected to prepare competent cells, and the pGRB-sgRNA-3 plasmid and the recombinant DNA fragment ΔfliI-Up-Dwon with genomic deletion of fliI were transformed respectively, and spread on 2-YT agar plates containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and cultured at 32°C. The single colonies produced by the culture were identified by PCR with r Taq using primers P19 / P22. The PCR amplified fragment containing 1376 bp (SEQ ID No. 11) was a positive transformant, and the amplified fragment containing 2750 bp was the original bacterium.

[0266] The positive transformants were inoculated into 2-YT medium containing spectinomycin (100 mg / L) and a final concentration of 0.2% arabinose to eliminate the plasmid pGRB-sgRNA-3, and colonies that grew on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L) were selected. These colonies were then transferred to 2-YT medium and cultured at 42°C to eliminate the pREDCas9 plasmid. Colonies that did not grow on spectinomycin (100 mg / L) but grew on 2-YT without resistance were selected and identified again using r Taq PCR with primers P19 / P22. The PCR amplified colonies containing 1376 bp (SEQ ID No.11) were positive transformants.

[0267] The positive transformants lacking the fliI gene in the genomes of L-threonine-producing bacteria CGMCC25404, L-tryptophan-producing bacteria CGMCC25403, L-arginine-producing bacteria CGMCC25402, and L-valine-producing bacteria CGMCC22721 were named YPThr14, YPTrp004, YPR-064, and YPV-102, respectively.

[0268] PCR amplification system: 2×Premix r Taq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O, total volume 25 μL.

[0269] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0270] Example 5: Construction of fliI and fliI containing flagellar-specific ATP synthase activity overexpressed on a plasmid T171I Engineered strains

[0271] According to the Escherichia coli W3110 genome sequence published by NCBI, the wild-type fliI gene and the mutant fliI gene were expressed in Escherichia coli using the pET-28a(+) expression vector (TaKaRa, containing kanamycin resistance). T171I The gene coding region and promoter region were introduced into L-threonine producing strain CGMCC25404, L-tryptophan producing strain CGMCC25403, L-arginine producing strain CGMCC25402 and L-valine producing strain CGMCC 22721 (sequencing confirmed that the wild-type fliI gene was retained on the chromosomes of these amino acid producing strains), so as to further study the multi-copy fliI gene and mutant fliI in high-yielding strains. T171I Effects of genes on the production of L-amino acids such as L-threonine, L-tryptophan, L-valine and L-arginine.

[0272] Prepare L-threonine CGMCC25404, L-tryptophan CGMCC25403, L-arginine CGMCC25402, and L-valine CGMCC22721 competent cells. 600 =0.6, the bacteria were collected to prepare competent cells, and the plasmids pET28(a)-fliI and pET28(a)-fliI constructed in Example 1 were transformed respectively. T171I , spread on 2-YT agar plates containing kanamycin (50 mg / L) and culture at 37°C. The single colonies produced by the culture were identified by primers T7t / T7 and r Taq PCR. The PCR amplified fragment containing 1874 bp (the 824th position of the sequence containing the point mutation is T) was a positive transformant, and the fragment that could not be amplified was the original bacterium.

[0273] PCR amplification system: 2×Premix r Taq 12.5 μL, primers (10 pM) 1 μL each, supplemented with ddH2O, total volume 25 μL.

[0274] PCR amplification program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s; 56°C annealing for 30 s; 72°C extension for 90 s (30 cycles), 72°C over-extension for 10 min.

[0275] The wild-type fliI gene and mutant fliI gene were overexpressed in the plasmids of L-threonine-producing strain CGMCC25404, L-tryptophan-producing strain CGMCC25403, L-arginine-producing strain CGMCC25402 and L-valine-producing strain CGMCC22721. T171IThe genes were named YPThr15 (without mutation point) and YPThr16 (with mutation point), YPTrp005 (without mutation point) and YPTrp006 (with mutation point), YPR-065 (without mutation point) and YPR-066 (with mutation point), YPV-103 (without mutation point) and YPV-104 (with mutation point).

[0276] The recombinant bacteria YPThr15, YPTrp005, YPR-065 and YPV-103 were obtained by introducing pET28(a)-fliI into L-threonine producing bacteria CGMCC25404, L-tryptophan producing bacteria CGMCC25403, L-arginine producing bacteria CGMCC25402 and L-valine producing bacteria CGMCC22721, respectively. The recombinant bacteria overexpressing pET28(a)-fliI can significantly and stably increase the expression level of the fliI gene.

[0277] The recombinant strains YPThr16, YPTrp006, YPR-066 and YPV-104 were introduced into the L-threonine-producing strain CGMCC25404, the L-tryptophan-producing strain CGMCC25403, the L-arginine-producing strain CGMCC25402 and the L-valine-producing strain CGMCC22721, respectively. T171I The obtained recombinant bacteria. pET28(a)-fliI T171I Overexpression of recombinant bacteria can significantly and stably increase fliI T171I The expression level of the gene.

[0278] Example 6, fermentation experiment

[0279] 1. L-threonine fermentation experiment

[0280] The Escherichia coli W3110 strain, the Escherichia coli W3110-pET28(a)-T171I in Example 1, the L-threonine producing bacteria CGMCC25404 strain, and the fliI engineered strains YPThr11, YPThr12, YPThr13, YPThr14, YPThr15 and YPThr16 obtained in the above examples were inoculated in a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) using L-threonine fermentation medium and culture conditions for fermentation experiments, and each strain was repeated three times. Among them, W3110-pET28(a)-T171I, YPThr15 and YPThr16 are strains containing pET-28a(+) overexpression, and IPTG induction is required during the fermentation process. The specific induction method is shown in Example 1 (i.e., the fermentation culture cells grow to OD 600 =0.2, IPTG was added at a final concentration of 0.1 mM). After the fermentation was completed, the L-threonine content was detected by high performance liquid chromatography (HPLC), and the results were taken as the average of three replicates, as shown in Table 4.

[0281] L-threonine fermentation medium: the solvent is water, the solutes and their concentrations are glucose 13 g / L, (NH4)2SO4 1 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.01 g / L, MnSO4·H2O 0.01 g / L, FM902 yeast powder 1.5 g / L, corn syrup 5 g / L, molasses 17 g / L, and ammonia is added to adjust the pH to 7.0.

[0282] L-Threonine fermentation conditions:

[0283] Calibration DO 100%: temperature 37℃, air volume 5L / min, speed 800rpm, tank pressure 0Mpa, calibration after 5min;

[0284] Inoculation amount 10%;

[0285] Initial conditions: pH 7.0, culture temperature 37°C, tank pressure 0 MPa, air volume 0.5 L / min, rotation speed 400 rpm;

[0286] Full process control: 1. When dissolved oxygen is less than 30%, the rotation speed is increased in sequence: 500rpm→600rpm→air volume 1L / min→700rpm→800rpm; 2. After 8h of fermentation, the tank pressure is increased by 0.01Mpa; after 12h of fermentation, the tank pressure is increased by 0.02Mpa→0.03Mpa→0.04Mpa→0.05Mpa;

[0287] Residual sugar control: 0.1-0.5% before F12h; after F12h, the residual sugar should be controlled at 0.1-0.3% in combination with DO requirements;

[0288] Feed materials: 25% ammonia water, 55% concentrated sugar, 10% sodium bicarbonate;

[0289] Fermentation cycle: about 30 hours, the control process uses 20-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0290] Table 4. L-threonine production of fliI engineered strains

[0291] strains L-Threonine concentration (g / L) W3110 0.008 W3110-pET28(a)-T171I 0.522 Escherichia coli CGMCC25404 98.400 YPThr11 99.860 YPThr12 100.256 YPThr13 101.670 YPThr14 94.850 YPThr15 100.480 YPThr16 102.320

[0292] As shown in the above fermentation results, compared with W3110, the L-threonine production of W3110-pET28(a)-T171I was significantly increased (p value <0.01); compared with the L-threonine producing bacteria CGMCC25404 strain (Escherichia coliCGMCC25404), the L-threonine production of YPThr11, YPThr12, YPThr13, YPThr15 and YPThr16 was significantly increased (p value <0.01), and the L-threonine production of YPThr14 was significantly decreased (p value <0.01); compared with YPThr12, the L-threonine production of YPThr13 was significantly increased (p value <0.01); compared with YPThr15, the L-threonine production of YPThr16 was significantly increased (p value <0.01);. This indicates that, for both the strain with high L-threonine production and the model strain W3110, the replacement of the 171st threonine in the amino acid sequence of the fliI gene by isoleucine is helpful to increase the L-threonine production; for the strain with high L-threonine production, the wild-type fliI gene and the mutant fliI T171I Overexpression of both fliI and fliI can improve L-threonine production, but the mutant fliI T171I The overexpression of fliI is more conducive to the increase of L-threonine production, while the knockout of fliI gene is not conducive to the increase of L-threonine production, but will reduce the L-threonine production.

[0293] 2. L-Tryptophan Fermentation Experiment

[0294] The Escherichia coli W3110 strain, the Escherichia coli W3110-pET28(a)-T171I of Example 1, the L-tryptophan producing strain CGMCC25403, and the fliI engineered strains YPTrp001, YPTrp002, YPTrp003, YPTrp004, YPTrp005 and YPTrp006 obtained in the above examples were inoculated in a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) with L-tryptophan fermentation medium and culture conditions for fermentation experiments, and each strain was repeated three times. Among them, W3110-pET28(a)-T171I, YPTrp005 and YPTrp006 are strains containing pET-28a(+) overexpression, and IPTG induction is required during the fermentation process. The specific induction method is shown in Example 1. After the fermentation was completed, the L-tryptophan content was detected by high performance liquid chromatography (HPLC), and the results were taken as the average of three replicates, as shown in Table 5.

[0295] L-tryptophan fermentation medium: the solvent is water, the solutes and their concentrations are glucose 7g / L, FM902 yeast powder 1g / L, (NH4)2SO4 1.2g / L, citric acid 1.2g / L, MgSO4·7H2O 1.5g / L, K2HPO4·3H2O 5.5g / L, defoaming agent 0.2mL / L, and ammonia is added to adjust the pH to 7.0.

[0296] L-Tryptophan Culture Conditions:

[0297] Calibration DO 100%: temperature 35°C, speed 800rpm, air volume 5L / min, tank pressure 0.00Mpa;

[0298] Inoculation amount 10%;

[0299] Initial conditions: temperature 35°C, pH 7.0, air volume 1.0 L / min, speed 350 rpm;

[0300] Full process control: before the end of the basal sugar consumption, when the dissolved oxygen is ≤20%, increase →400rpm→450rpm in sequence; after the end of the basal sugar consumption, add sugar to control the dissolved oxygen to 15-30%; pH F7.0 before 24h, F6.7 after 24h;

[0301] Residual sugar control: 0.1-0.5% before F12h; after F12h, the residual sugar should be controlled at 0.1-0.3% in combination with DO requirements;

[0302] Feed materials: 25% ammonia water, 55% concentrated sugar, 10% sodium bicarbonate;

[0303] Fermentation cycle: about 34 hours, the control process uses 15-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0304] Table 5. L-tryptophan production of engineered bacteria

[0305] strains L-Tryptophan concentration (g / L) W3110 0.006 W3110-pET28(a)-T171I 0.136 L-Tryptophan Producing Bacteria CGMCC25403 38.630 YPTrp001 39.870 YPTrp002 38.930 YPTrp003 40.630 YPTrp004 34.650 YPTrp005 39.570 YPTrp006 41.370

[0306] As shown in the above fermentation results, compared with W3110, the L-tryptophan production of W3110-pET28(a)-T171I was significantly increased (p value < 0.01); compared with the L-tryptophan producing bacteria CGMCC25403 strain (Escherichia coliCGMCC25403), the L-tryptophan production of YPTrp001, YPTrp002, YPTrp003, YPTrp005 and YPTrp006 was significantly increased (p value < 0.01), and the L-tryptophan production of YPTrp004 was significantly decreased (p value < 0.01); compared with YPTrp002, the L-tryptophan production of YPTrp003 was significantly increased (p value < 0.01); compared with YPTrp005, the L-tryptophan production of YPTrp006 was significantly increased (p value < 0.01). This indicates that, for both the high-L-tryptophan-producing strain and the model strain W3110, the replacement of the 171st threonine in the amino acid sequence of the fliI gene by isoleucine is helpful to increase the L-tryptophan production. T171I Overexpression of both fliI and fliI can improve L-tryptophan production, but the mutant fliI T171I Overexpression of fliI is more conducive to the increase of L-tryptophan production, while knocking out the fliI gene is not conducive to the increase of L-tryptophan production, but will reduce the L-tryptophan production.

[0307] 3. L-arginine fermentation experiment

[0308] The Escherichia coli W3110 strain, the Escherichia coli W3110-pET28(a)-T171I in Example 1, the L-arginine producing bacteria CGMCC25402 strain, and the fliI engineering strains YPR-061, YPR-062, YPR-063, YPR-064, YPR-065 and YPR-066 obtained in the above examples were inoculated in a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) with L-arginine fermentation medium and culture conditions for fermentation experiments, and each strain was repeated three times. Among them, W3110-pET28(a)-T171I, YPR-065 and YPR-066 are strains containing pET-28a(+) overexpression, and IPTG induction is required during the fermentation process. The specific induction method is shown in Example 1. After the fermentation was completed, the L-arginine content was detected by high performance liquid chromatography (HPLC), and the results were taken as the average of three replicates, as shown in Table 6.

[0309] L-arginine fermentation medium: the solvent is water, the solutes and their concentrations are glucose 8g / L, FM902 yeast powder 3g / L, K2HPO4·3H2O 6g / L, MgSO4·7H2O 1g / L, FeSO4·7H2O 0.05g / L, betaine 0.5g / L, VB 12 0.005g / L, defoamer 0.3mL / L, ammonium sulfate 3g / L, pH 7.2.

[0310] L-arginine fermentation culture conditions: Corrected DO 100%: temperature 35°C, pH 7.2, rotation speed 100 rpm, air volume 6 L / min, tank pressure 0.00 MPa;

[0311] Inoculation amount 10%;

[0312] Initial conditions: temperature 35°C, pH 7.2, tank pressure 0.01 MPa, air volume 1.5 L / min, speed 350 rpm;

[0313] Full process control: control DO at 20-30%; when dissolved oxygen ≤ 25%, increase the speed each time: 300rpm→400rpm→2.0L / min→500rpm→0.02Mpa→600rpm→3.0L / min→0.03Mpa→700rpm→3.5L / min→0.04Mpa→800rpm→900rpm→4.0L / min→0.05Mpa→1000rpm;

[0314] Residual sugar control: The residual sugar is controlled at 0.05-0.1% throughout the process;

[0315] Feed materials: 25% ammonia water, 80% concentrated sugar, 10% sodium bicarbonate;

[0316] Fermentation cycle: about 50h, the control process uses 20-30% dissolved oxygen as the standard for increasing and decreasing air volume.

[0317] Table 6. L-arginine production of engineered bacteria

[0318] strains L-Tryptophan concentration (g / L) W3110 0.001 W3110-pET28(a)-T171I 0.241 L-arginine producing bacteria CGMCC25402 75.760 YPR-061 78.660 YPR-062 76.350 YPR-063 79.970 YPR-064 73.750 YPR-065 77.780 YPR-066 80.480

[0319] As shown in the above fermentation results, compared with W3110, the L-arginine production of W3110-pET28(a)-T171I was significantly increased (p value < 0.01); compared with the L-arginine producing bacteria CGMCC25402 strain (Escherichia coliCGMCC25402), the L-arginine production of YPR-061, YPR-062, YPR-063, YPR-065 and YPR-066 was significantly increased (p value < 0.01), and the L-arginine production of YPR-064 was significantly decreased (p value < 0.01); compared with YPR-062, the L-arginine production of YPR-063 was significantly increased (p value < 0.01); compared with YPR-065, the L-arginine production of YPR-066 was significantly increased (p value < 0.01). This indicates that, for both the high-yield L-arginine strain and the model strain W3110, the replacement of the 171st threonine in the amino acid sequence of the fliI gene by isoleucine is helpful to increase the L-arginine production; for the high-yield L-arginine strain, the wild-type fliI gene and the mutant fliI T171I Overexpression of both fliI and fliI can improve L-arginine production, but the mutant fliI T171I Overexpression of fliI is more conducive to the increase of L-arginine production, while knocking out the fliI gene is not conducive to the increase of L-arginine production, but will reduce the L-arginine production.

[0320] IV. L-valine fermentation experiment

[0321] The Escherichia coli W3110 strain, the Escherichia coli W3110-pET28(a)-T171I of Example 1, the L-valine producing bacteria CGMCC22721 strain, and the fliI engineered strains YPV-099, YPV-100, YPV-101, YPV-102, YPV-103 and YPV-104 obtained in the above examples were inoculated in a 5L fermenter of the BLBIO-5GC-4-H model (Shanghai Bailun Biotechnology Co., Ltd.) with L-arginine fermentation medium and culture conditions for fermentation experiments, and each strain was repeated three times. Among them, W3110-pET28(a)-T171I, YPV-103 and YPV-104 are strains containing pET-28a(+) overexpression, and IPTG induction is required during the fermentation process. The specific induction method is shown in Example 1. After the fermentation was completed, the L-valine content was detected by high performance liquid chromatography (HPLC), and the results were taken as the average of three replicates, as shown in Table 7.

[0322] L-valine fermentation medium: the solvent is water, the solutes and their concentrations are yeast extract powder 4g / L, corn steep liquor powder 2g / L, peptone 4g / L, methionine 2g / L, KH2PO4·3H2O 7g / L, MgSO4·7H2O 2g / L, CoCl2 20mg / L, (NH4)2SO4 3g / L, citric acid 2g / L, FeSO4·7H2O 50mg / L, MnSO4·7H2O 30mg / L, VH 20mg / L, VB11.5mg / L, VB3 1.5mg / L VB 12 1.5g / L, defoamer 0.3mL / L, (NH4)2SO4 3g / L, pH 7.0.

[0323] L-valine fermentation culture conditions: Dissolved oxygen electrode calibration method: calibrate the zero point in saturated sodium sulfite solution and calibrate the hundred point in air;

[0324] L-valine fermentation includes two stages of aerobic-limited oxygen fermentation. The cells are first cultured under aerobic fermentation. The air volume, speed and sugar addition rate are adjusted in the early stage to control the dissolved oxygen at about 25%. 600 When the value reaches 50-60, the speed is reduced to 400rpm and the air volume is reduced to 2L / min; and the aerobic fermentation is converted to oxygen-limited fermentation.

[0325] Table 7. L-valine production of engineered bacteria

[0326] strains L-Valine concentration (g / L) W3110 0.006 W3110-pET28(a)-T171I 0.136 L-Valine-producing strain CGMCC22721 78.420 YPV-099 79.880 YPV-100 79.420 YPV-101 81.120 YPV-102 75.430 YPV-103 80.22 YPV-104 82.470

[0327] The above fermentation results showed that compared with W3110, the L-arginine production of W3110-pET28(a)-T171I was significantly increased (p value < 0.01); compared with the L-valine-producing bacteria CGMCC22721 strain (Escherichia coliCGMCC22721), the L-valine production of YPV-099, YPV-100, YPV-101, YPV-103 and YPV-104 was significantly increased (p value < 0.01), and the L-valine production of YPV-102 was significantly decreased (p value < 0.01); compared with YPV-100, the L-valine production of YPV-101 was significantly increased (p value < 0.01); compared with YPV-103, the L-valine production of YPV-104 was significantly increased (p value < 0.01). This indicates that, for both the high-yield L-valine strain and the model strain W3110, the replacement of the 171st threonine in the amino acid sequence of the fliI gene by isoleucine is helpful to increase the L-valine yield; for the high-yield L-valine strain, the wild-type fliI gene and the mutant fliI T171I Overexpression of both fliI and fliI can improve the production of L-valine, but the mutant fliI T171I The overexpression of fliI is more conducive to the increase of L-valine production, while the knockout of fliI gene is not conducive to the increase of L-valine production, but will reduce the L-valine production.

[0328] From the above fermentation results, it can be seen that for both the high-yield L-amino acid strain and the model strain W3110, the replacement of the 171st threonine in the amino acid sequence of the fliI gene by isoleucine is helpful to increase the production of L-threonine, L-tryptophan, L-arginine and L-valine; for the high-yield L-amino acid strain, the wild-type fliI gene and the mutant fliI T171I Overexpression of fliI gene helps to increase the production of L-threonine, L-tryptophan, L-arginine and L-valine, while knocking out fliI gene is not conducive to increasing their production.

[0329] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Protein, as follows: A1) or A2): A1) a mutant protein obtained by mutating the threonine residue at position 171 of SEQ ID No. 2 to an isoleucine residue, an asparagine residue, a serine residue, an alanine residue, a methionine residue or a proline residue; A2) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of A1).

2. The biological material related to the protein according to claim 1, which is any one of the following B1) to B4): B1) a nucleic acid molecule encoding the protein according to claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

3. The biomaterial according to claim 2, characterized in that: B1) The nucleic acid molecule is as follows (b11) or (b12): b11) a DNA molecule shown in SEQ ID No. 4 in the sequence listing; b12) The DNA molecule shown in SEQ ID No. 1 in the sequence listing.

4. The biomaterial according to claim 2 or 3, characterized in that: B2) the expression cassette is a DNA molecule shown in positions 37-1624 of SEQ ID No.3, or a DNA molecule obtained by mutating position 762 of positions 37-1624 of SEQ ID No.3 from C to T; B4) The recombinant microorganism is a recombinant microorganism obtained by replacing the fliI gene in a microorganism containing the fliI gene shown in SEQ ID No. 1 with the DNA molecule shown in SEQ ID No. 4, or a recombinant microorganism obtained by introducing the DNA molecule shown in SEQ ID No. 4 or SEQ ID No. 1 into the microorganism and expressing it.

5. A method for preparing L-amino acids, comprising: The protein of claim 1 is expressed in a receptor biological cell, or the content or activity of the protein of claim 1 in the receptor biological cell is increased to obtain a recombinant biological cell; the recombinant biological cell is cultured to obtain L-amino acid; the L-amino acid is L-threonine, L-tryptophan, L-arginine or L-valine.

6. The method according to claim 5, characterized in that: The biological cell is a yeast, bacterium, algae, fungus, plant cell or animal cell that can synthesize L-amino acids and / or contains the gene encoding the protein according to claim 1.

7. The method according to claim 6, characterized in that: The bacteria is Escherichia coli ( Escherichia coli ) or Corynebacterium glutamicum ( Corynebacterium glutamicum ).

8. The method according to any one of claims 5 to 7, characterized in that: The method is achieved by introducing the gene encoding the protein of claim 1 into the cells of the recipient organism and expressing it, or by increasing the copy number of the gene encoding the protein of claim 1 in the cells of the recipient organism; Alternatively, the recipient biological cell contains the DNA molecule shown in SEQ ID No. 1, and the method is achieved by replacing the DNA molecule shown in SEQ ID No. 1 in the recipient biological cell with the DNA molecule shown in SEQ ID No.

4.

9. The method according to any one of claims 5 to 7, characterized in that: The recombinant biological cell is cultured using a culture medium capable of growing the recombinant biological cell; And / or, culturing the recombinant biological cell is performed using conditions that enable the recombinant biological cell to grow.

10. A product for preparing L-amino acids, comprising the protein of claim 1 or the biological material of any one of claims 2 to 4; the L-amino acid is L-threonine, L-tryptophan, L-arginine or L-valine.

11. Use of overexpressing the protein shown in SEQ ID No. 2 in Escherichia coli or Corynebacterium glutamicum to increase the production of L-amino acids, wherein the L-amino acids are L-threonine, L-tryptophan, L-arginine or L-valine.

Images