A SNP molecular marker associated with the yellow-green trait of pepper leaves and its application
By developing the SNP molecular marker Cap_K_760388 related to the yellow-green traits of pepper leaves, and combining KASP reaction detection technology, the problems of extended breeding years and difficult to guarantee parental purity in pepper breeding were solved, and rapid identification and improvement of breeding efficiency were achieved.
Patent Information
- Application Number
- CN202310039118.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-12
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2043-01-12
AI Technical Summary
The prior art is difficult to quickly and effectively apply recessive genetic markers of yellow-green seedlings in pepper breeding, resulting in the extension of breeding years and the difficulty in ensuring parental purity.
A SNP molecular marker Cap_K_760388 related to the yellow-green traits of pepper leaves was developed, and the yellow-green seedling traits of pepper leaves were quickly identified through KASP reaction detection technology.
Through the application of this SNP molecular marker, the breeding period of peppers can be greatly shortened, the purity of the parent, the production cost can be reduced, and an efficient and accurate method can be provided for the breeding and improvement of pepper varieties.
Smart Images

Figure CN115976268B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of pepper breeding, and in particular relates to a SNP molecular marker related to the yellow-green trait of pepper leaves and an application thereof. Background Art
[0002] The yellow-green seedling mutant of pepper is a recessive mutant of yellow-green leaf color of pepper. At present, the crops that use the recessive mutant of yellow-green leaf color for scientific research and genetic breeding include cotton, watermelon, cucumber, tomato, etc., and they have all been applied in genetic breeding. The use of the recessive genetic marker of yellow-green seedling can greatly shorten the breeding period and help improve the purity of parents. Parents with the genetic marker of yellow-green seedlings can effectively avoid the interference of biological and mechanical mixing by using their recessive trait of yellow leaves during breeding. The removal of all the impure plants at the seedling stage can completely ensure the improvement of the purity of the original seed and greatly reduce the production cost of the original seed. The Jiangsu Zhenjiang Agricultural Science Institute has carried out hybridization, self-pollination, backcrossing and other work on the yellow-green seedlings of pepper and the sterile sources of cytoplasmic male sterile plants 98-1A and 98-3A in the self-pollination segregation generation of H97643, and has basically achieved the organic combination of the yellow-green leaf marker trait of pepper and the male sterile line. The mutant has excellent characteristics such as strong resistance to weak light and high temperature, which provides an effective means for the research of pepper in male sterility, creation of excellent germplasm resources, breeding of excellent varieties, photosynthetic system structure and function and its regulatory mechanism, and rapid identification of hybrid purity. The present invention discloses a molecular marker that can quickly identify the yellow-green seedlings of pepper leaves, which is helpful for the rapid application of the yellow-green seedling trait of pepper in pepper breeding and improves pepper breeding efficiency.
[0003] SNP (Single Nucleotide Polymorphism) is a polymorphism of DNA sequence caused by single nucleotide variation, mainly the conversion and transversion of single bases, which is widely present in the genome. As a third-generation molecular marker, SNP is characterized by high density, widespread presence in human and plant genomes, and high representativeness. SNPs within some genes directly affect protein structure and expression levels, and are stable in genetics and easy to automate analysis. The KASP (competitive allele PCR) involved in the present invention has the advantages of high accuracy, fast detection speed, and low cost by carrying unused fluorescent groups to detect SNP sites. Summary of the invention
[0004] Purpose of the invention: In order to solve the above problems, the purpose of the present invention is to provide a SNP molecular marker related to the yellow-green trait of pepper leaves and its application.
[0005] Technical solution: The purpose of the present invention can be achieved through the following technical solution:
[0006] A SNP molecular marker associated with the yellow-green trait of pepper leaves, the SNP molecular marker is Cap_K_760388, the Cap_K_760388 is located at the 760388th base of chromosome 9 of pepper, the peppers with the base T at this position exhibit yellow leaves, and the peppers with the base G at this position exhibit green leaves; the sequence where the Cap_K_760388 is located is shown in SEQ ID NO.1.
[0007] TCACCAAGAACGCTTAATTGCCAATGCTTGAAAAGTTCAAAGAAATAG CTTATTCATGTAGTCTCTGG[T]TTTGCGGTACCTGATAACGTATATTGTTTACT ATGTTTAGGTGATCGCACT (SEQ ID NO. 1).
[0008] The specific primer combination of the SNP molecular marker related to the yellow-green trait of pepper leaves includes:
[0009] (1) Two specific primers, the sequences are as follows:
[0010] C09-760388-FAM:
[0011] GAAGGTGACCAAGTTCATGCTAAGAAATAGCTTATTCATGTAGT (SEQ ID NO. 2);
[0012] C09-760388-VIC:
[0013] GAAGGTCGGAGTCAACGGATTAAGAAATAGCTTATTCATGTAGG (SEQ ID NO. 3).
[0014] (2) A universal primer, the sequence of which is as follows:
[0015] C09-760388-R: GTTATCAGGTACCGCAAACCAG (SEQ ID NO. 4).
[0016] A kit comprises the specific primers.
[0017] The application of the SNP molecular marker, the specific primer or the kit in pepper molecular marker-assisted breeding.
[0018] The application of the SNP molecular marker, the specific primer or the kit in detecting the yellow-green trait of leaves of pepper varieties.
[0019] A method for detecting the yellow-green trait of leaves of pepper varieties, the method comprising the steps of applying the SNP molecular marker, the specific primer or the kit.
[0020] Specifically, the method for detecting the yellow-green trait of leaves of pepper varieties comprises the following steps:
[0021] (1) extracting pepper genomic DNA to be tested;
[0022] (2) using pepper genomic DNA as a template and using the specific primers described in claim 2 or the kit described in claim 3 to perform KASP reaction detection;
[0023] (3) When detecting the yellow-green seedling trait of pepper leaves, if only the fluorescent signal corresponding to the fluorescent sequence connected to primer C09-760388-FAM is detected, the pepper to be tested exhibits yellow leaves and its genotype is TT; if only the fluorescent signal corresponding to the fluorescent sequence connected to primer C09-760388-VIC is detected, the pepper to be tested is judged to have green leaves and its genotype is GG; if both fluorescence are detected at the same time, the pepper is judged to be heterozygous and its genotype is heterozygous TG.
[0024] Beneficial effects: The present invention constructs suitable population materials through a large number of experimental explorations and analyses, and then further constructs a yellow pepper seedling pool for genome resequencing, and then performs BSA positioning analysis, and finally obtains SNP molecular markers that can be used to detect the yellow pepper seedling trait.
[0025] The present invention utilizes the recessive genetic marker of yellow-green seedlings, which can greatly shorten the breeding period and is conducive to improving the purity of parents. When breeding, parents with the yellow-green seedling genetic marker trait can utilize their recessive trait of yellow leaves to be easily stable and effectively avoid the interference of biological and mechanical mixing. The impure plants can be removed at one time during the seedling stage, which can completely ensure the improvement of the purity of the original seed and greatly reduce the production cost of the original seed.
[0026] The KASP (competitive allele PCR) involved in the present invention detects SNP sites by carrying different fluorescent groups and has the advantages of high accuracy, fast detection speed, low cost, etc. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 This is a schematic diagram of locating the yellow-green trait of pepper leaves at the 760388th base on pepper chromosome 9 according to an embodiment of the present invention.
[0028] Figure 2 This is a genotyping test diagram of the SNP marker tightly linked to the yellow-green color of pepper leaves in the present invention in a population; wherein T:T is the yellow leaf genotype, G:G is the green leaf genotype, G:T is the heterozygous type, and NTC is the negative control.
[0029] Figure 3 This is a schematic diagram of the yellow-green color of pepper leaves. The left is the yellow pepper seedling, and the right is the green pepper seedling. DETAILED DESCRIPTION
[0030] The present invention is further explained below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. After reading the present invention, various equivalent forms of modifications to the present invention by those skilled in the art all fall within the scope defined by the claims attached to this application.
[0031] Example 1: Development of SNP molecular markers linked to the yellow seedling trait of pepper
[0032] The Jiangsu Zhenjiang Agricultural Science Institute conducted hybridization and self-pollination on the yellow and green pepper seedlings H97643 and obtained F 2 There were 300 plants in the segregation population. Phenotypic observation showed that 102 plants had yellow leaves and 298 plants had green leaves, which was consistent with the 3:1 segregation ratio. The yellow seedlings were recessive traits. 2 The yellow seedling gene pool was constructed from 50 yellow seedlings in the population, the green seedling gene pool was constructed from 50 green seedlings, and the parental gene pool was resequenced. Then, BSA positioning analysis was performed, and a SNP molecular marker closely linked to the yellow-green seedling trait was obtained at the 760388th base of chromosome 9 of pepper. Figure 1 shown.
[0033] KASP marker primers were designed based on the upstream and downstream sequences of the SNP site (as shown in SEQ ID NO.1).
[0034] The 5' end of the competitive primer F1 of the SNP site: GCTAAGAAATAGCTTATTCATGTAGT was added with the FAM fluorescent label sequence GAAGGTGACCAAGTTCAT to obtain C09-760388-FAM, the sequence of which is shown in SEQ ID NO.2; the 5' end of the competitive primer F2 of the SNP site: AAGAAATAGCTTATTC ATGTAGG was added with the VIC fluorescent label sequence GAAGGTCGGAGTCAACGGATT to obtain C09-760388-VIC, the sequence of which is shown in SEQ ID NO.3, and a universal primer GTTATCA GGTACCGCAAACCAG to obtain C09-760388-R, the sequence of which is shown in SEQ ID NO.4. The pepper to be tested was subjected to KASP reaction detection. The nucleotide sequences of the two specific primers and the universal primer sequence are shown in the sequence table.
[0035] Example 2: Detection of KASP reaction of developed SNP molecular markers
[0036] Primers are designed for the molecular markers of the present invention, and the yellow color trait of pepper can be detected with high throughput using the KASP reaction, using the primer combination designed in Example 1.
[0037] The modified CTAB method was used to extract DNA from young leaves of plants. The specific method is as follows: 1. Take 0.1 g of young leaves of the selected variety, put them in a sampling tube, put them into liquid nitrogen and then grind them.
[0038] 2. Add 600 μl of CTAB to the sample tube and vortex for 2-3 minutes.
[0039] 3.65℃ water bath for 30min. Manually shake 2-3 times during the water bath.
[0040] 4. Add 600 μl of chloroform:isoamyl alcohol (24:1) and shake manually for 5 minutes.
[0041] 5. Centrifuge at room temperature, 12000rpm, 5min.
[0042] 6. Pipette 400 μl of supernatant, add 800 μl of anhydrous ethanol, shake well, and cool at -20℃ for 20 min.
[0043] 7. Centrifuge the sample at 12000rpm for 5 minutes at room temperature. Pour out the supernatant and let it dry.
[0044] 8. After drying, add 100 μl of ddH2O to the sample and measure the concentration and OD value of the extracted DNA. Dilute the extracted DNA to 20 ng / μl, using a 5 μl system, KASP Master Mix 2.5 μl, DNA 1 μl, F1 0.1 μl, F2 0.1 μl, R 0.3 μl, ddH2O 1.25 μl.
[0045] PCR amplification was performed on a BIORAD real-time quantitative instrument. The PCR amplification program was as follows: 95°C pre-denaturation for 10 min; 95°C denaturation for 20 s, 61°C-55°C annealing and extension for 60 s, for a total of 10 Touch Down cycles (0.6°C reduction per cycle); the second round of PCR reaction, 95°C denaturation for 20 s, 55°C annealing and extension for 60 s, for a total of 36 cycles. Finally, the genotyping data was read at 25°C for 30 sec. The results are shown in Figure 2 , which is a genotyping test diagram of SNP markers closely linked to the yellow-green color of pepper leaves in the population; T:T is the homozygous genotype of yellow leaves, G:G is the homozygous genotype of green leaves, T:G is the heterozygous type, and NTC is the no-template control. Figure 2 The results showed that the typing effect was good.
[0046] Example 3: F 2Identification of leaf color phenotypes of segregating populations and analysis of correlation between molecular markers and phenotypes
[0047] The present invention has confirmed through population experiments that the above molecular markers are closely related to the trait of yellow pepper seedlings. 2 In the population, the base type of the parent material yellow seedling at the Cap_K_760388 test site is T:T, which is manifested as yellow seedlings with leaves, and the base type of the green seedling test site is G:G, which is manifested as green seedlings with leaves. 2 The results of the association analysis between the genotype of the individual plants in the population and the yellow-green color of the leaves are shown in Table 2. 37 plants were detected with G:G, and 45 plants were detected with medium T:T, all showing homozygous yellow-green seedlings; 107 plants were detected with heterozygous T:G, which were green seedlings; 2 plants had no genotype detected, and 11 plants had genotypes that did not match the color of the pepper leaves. Therefore, the comprehensive accuracy of the marker selection was 94.5%. As shown in Table 2:
[0048] Table 2 Leaf color phenotype identification of parents and F2 populations
[0049]
[0050] F 2 The t-test analysis of the genotype and phenotype correlation of the population showed that p = 0.001 (p < 0.05), indicating that the Cap_K_760388 marker was closely related to the yellow-green seedling trait of pepper leaves.
[0051] Table 3. Cap_K_760388 is marked in F 2 Separation group detection results
[0052]
[0053]
[0054]
[0055] The present invention relates to a SNP molecular marker of a pepper leaf yellow seedling disease material, the marker is located at the 760388th base of chromosome 9, and the polymorphism of the SNP molecular marker is T / G. The present invention provides a specific primer combination and a detection method for detecting the SNP site, and the specific primer combination is shown in Table 1. The SNP molecular marker of the present invention can be used for the prediction of pepper yellow seedlings, and the use of the recessive genetic marker of yellow-green seedlings can greatly shorten the breeding period, which is conducive to improving the purity of parents. Parents with yellow-green seedling genetic markers can effectively avoid the interference of biological and mechanical mixing by using their yellow leaf recessive traits during breeding, and the impurities are removed at one time during the seedling stage, which can completely ensure the improvement of the purity of the original seed and greatly reduce the production cost of the original seed. The detection method provided by the present invention is accurate and reliable, easy to operate, suitable for the application of high-throughput commercial molecular breeding, and provides a scientific basis for the selection or improvement of pepper varieties.
Claims
1. Application of a specific primer combination in the preparation of a kit for detecting the yellow-green trait of leaves of pepper varieties, It is characterized in that The specific primer combination includes two specific primers and one universal primer, the specific primers are specific primer F1 and specific primer F2, the sequence of the specific primer F1 is shown in SEQ ID NO.2, the sequence of the specific primer F2 is shown in SEQ ID NO.3; the sequence of the universal primer is shown in SEQ ID NO.
4.
2. A method for detecting the yellow-green trait of leaves of pepper varieties, It is characterized in that The following steps are involved: (1) extracting pepper genomic DNA to be tested; (2) Using the pepper genomic DNA to be tested as a template, a specific primer combination is used to perform KASP reaction detection; the specific primer combination includes two specific primers and a universal primer, the two specific primers are a specific primer F1 and a specific primer F2, the sequence of the specific primer F1 is shown in SEQ ID NO.2, the sequence of the specific primer F2 is shown in SEQ ID NO.3; the sequence of the universal primer is shown in SEQ ID NO.4; (3) When detecting the yellow-green seedling trait of pepper leaves, if only the fluorescent signal corresponding to the fluorescent sequence connected to the specific primer F1 is detected, the pepper to be tested exhibits yellow leaves and its genotype is TT; if only the fluorescent signal corresponding to the fluorescent sequence connected to the specific primer F2 is detected, the pepper to be tested is judged to have green leaves and its genotype is GG; if both fluorescence are detected at the same time, the pepper is judged to be heterozygous and its genotype is heterozygous TG.
Citation Information
Patent Citations
Molecular marker linked with capsicum annuum leaf color etiolation gene and application
CN111500761A
Pepper plants with improved pest resistance
WO2018200550A1