A method for producing chimeric silk using silkworms via Autographa californica nuclear polyhedrosis virus

Abstract

The present invention discloses a method for producing chimeric silk using silkworms by using Autographa californica nuclear polyhedrosis virus, and constructs a chimeric silk containing FibL-MaSp-c-polyA FibL The plasmid pFAST‑FibL‑MaSp‑c of the fragment is transformed into Escherichia coli containing AcBacmid DH10Ac, and recombinant AcBacmid‑FibL‑MaSp‑c is obtained by screening. The recombinant virus AcNPV‑FibL‑MaSp‑c is transfected into Sf‑9 cells to obtain the recombinant virus AcNPV‑FibL‑MaSp‑c, which is inoculated into 5-instar silkworm larvae, and the larvae are fed with cool-dried fresh mulberry leaves soaked or sprayed with antibiotic liquid for one day, and then fed with fresh mulberry leaves until they mature. The mature silkworms are fed with fresh mulberry leaves soaked or sprayed with ecdysteroid liquid; or the mature silkworms are directly sprayed with ecdysteroid liquid, and the mature silkworms are moved to a cocooning machine, cocoons are harvested after cocooning, and the cocoons are dried and reeled to obtain chimeric silk, thereby meeting the demand for diversity of silk protein in the preparation of various biomaterials.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a method for producing chimeric silk containing golden web-weaving spider ampullate silk using silkworms through the use of Autographa californica nuclear polyhedrosis virus. Background Art

[0002] Spider silk has excellent mechanical properties and low immunogenicity, offering broad application prospects in the textile, biomedical, and defense industries. Unlike common silk-spinning insects, spiders possess multiple silk glands, producing major ampullate silk, minor ampullate silk, flagellar silk, gelatinous silk, grape-shaped silk, tubular silk, and polymeric glandular mucin. Different spider silks or silk proteins have distinct biological functions and distinct properties. Spider silk proteins possess three functional regions: the N-terminal and C-terminal domains, each composed of non-repeating amino acid sequences, at either end of the amino acid sequence. The central region of the spider silk protein amino acid sequence is composed of highly repeating simple amino acids. The properties of spider silk proteins and the resulting fiber properties are primarily determined by the structural characteristics of these repeating sequences. Major ampullate silk (MaSp), also known as index or dragline silk, is the strongest spider silk. Major ampullate silk is primarily classified as MaSp-1 and -2. The main characteristic motifs of the repeat region of MaSp-1 are (GA)n(n:6-14) or (A)n(n:6-14) and GGX, which can form β-pleated crystal structure and 3-fold doublet structure, respectively. 10 The former is related to the tensile strength of the silk, while the latter is related to its ductility. The characteristic motifs of MaSp-2 are GPX, QQ, and GSG, which can form a β-turn helical structure, which is related to the elasticity of the silk.

[0003] In the wild, spiders produce less than 1mg of silk per day, a very low amount that is difficult to meet the human demand for spider silk. Furthermore, spiders are non-social animals and have a cannibalistic lifestyle. To date, humans have not been able to obtain spider silk through large-scale group farming. In recent years, with advances in biotechnology, researchers have attempted to use genetic engineering techniques to express spider silk proteins in bacteria, yeast, mammalian cultured cells, insect cells, and even transgenic animals and plants, and to use purified recombinant proteins to produce artificial spider-like silk or other biomaterials. Significant progress has been made in this area. The prior art discloses a single polyprotein molecule with improved mechanical properties and its application method. This single polyprotein molecule utilizes one of the four tandem protein sequences, type 1 to type 4, of the spider ampullate silk protein I molecule as a single polyprotein molecule. An exogenous gene vector corresponding to this single polyprotein sequence is constructed, and molecular biology techniques are used to integrate the single polyprotein sequence into the silkworm genome. Ultimately, a new silkworm strain with excellent composite silk properties that can be stably inherited is obtained, and composite silk is produced using this new silkworm strain. Existing technologies utilize the silkworm's natural spinning ability to produce chimeric silk containing spider silk protein components, improving the silk fiber's mechanical properties to a certain extent. However, due to limitations in the introduction of exogenous genes into silkworm eggs and the artificial incubation of these eggs, genetic modification of silkworms via microinjection has been largely limited to polyvoltine silkworm varieties, which have no practical production value. As a general rule, practical varieties used in production are all divoltine, producing older eggs that often require prolonged low-temperature stimulation (refrigeration) or immediate acidification (hydrochloric acid) treatment, or a combination of refrigeration and acidification, to break diapause and promote embryonic development. The optimal time for microinjection is a few hours after egg laying, and immediate acidification treatment is typically performed around 24 hours after egg laying. Microinjected eggs can die from acidification, so existing technologies often target polyvoltine silkworm varieties that do not require acidification. Consequently, there is still hope for new strategies and technologies to produce chimeric silk containing spider silk proteins using conventional silkworm varieties. Summary of the Invention

[0004] The present invention aims to provide a method for producing chimeric silk containing spidroin silk from the ampullate gland of the golden web-weaving spider using silkworms. This method not only produces silk with improved mechanical properties, particularly by preventing an excessive decrease in silk length, but is also applicable to all silkworm species. This method utilizes recombinant Autographa californica nuclear polyhedrosis virus-mediated expression of golden web-weaving spider glandular silk in the posterior silk gland of the silkworm to produce chimeric silk containing spider silk proteins. This related technical solution has not been reported.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] A method for producing chimeric silk using silkworms by using Autographa californica nuclear polyhedrosis virus comprises the following steps:

[0007] (1) FibL-MaSp-c-polyA FibL The fragment was cloned into the multiple cloning site of pFAST-Bac-Dual to construct the plasmid pFAST-FibL-MaSp-c; the FibL-MaSp-c-polyA FibL The sequence of the fragment is SEQ ID NO: 1;

[0008] (2) The plasmid pFAST-FibL-MaSp-c was transformed into Escherichia coli containing AcBacmid DH10Ac, and then spread on LB agar medium for culture. Then white colonies were picked and recombinant AcBacmid-FibL-MaSp-c DNA was extracted. Preferably, the LB agar medium contains tetracycline, kanamycin, gentamicin, IPTG and X-gal; the culture temperature was 37°C.

[0009] (3) Transfecting the recombinant AcBacmid-FibL-MaSp-c DNA into cultured Spodoptera frugiperda cells, culturing the cells until they become diseased, taking the cell culture supernatant and inoculating the cultured cells again, culturing the cells until they become diseased, collecting the cell culture supernatant, and purifying by centrifugation to obtain the recombinant Spodoptera californica baculovirus particles AcNPV-FibL-MaSp-c. Preferably, the cultured cells are Sf9 cultured cells, and the culture temperature is 26-27°C;

[0010] (4) The cell culture supernatant or the recombinant Autographa californica baculovirus particles AcNPV-FibL-MaSp-c collected in step (3) is inoculated into silkworm larvae, which are then reared until they are placed on cocoons; cocoons are then made, harvested, and reeled to obtain chimeric silk. The cocoons are made at 25°C and harvested after 7 days. Preferably, the silkworm larvae are 5th instar silkworm larvae, which are reared until they mature, and then treated with molting hormones before being placed on cocoons; further preferably, the silkworm larvae are treated once with antibiotics during the process of being raised until they mature.

[0011] The method of producing chimeric silk using silkworms by using Autographa californica nuclear polyhedrosis virus is further described as follows:

[0012] (1) Synthesize the golden spider gland silk protein expression cassette FibL-MaSp-c-polyA controlled by the silk fibroin light chain gene promoter with a coding signal peptide sequence at the 5' end and a tailing signal at the 3' end FibL , the sequence of which is as shown in SEQ ID NO: 1;

[0013] (2) FibL-MaSp-c-polyA FibL Fragment cloned into pFAST-Bac Tm-Dual multiple cloning site to construct plasmid pFAST-FibL-MaSp-c;

[0014] (3) pFAST-FibL-MaSp-c was transformed into Escherichia coli containing AcBacmid DH10Ac, and then spread on LB agar plates containing 10 μg / ml, 50 μg / ml, 7 μg / ml, 40 μg / ml, and 100 μg / ml of tetracycline, kanamycin, gentamicin, IPTG, and X-gal, respectively. The plates were cultured at 37°C, and white colonies were picked to extract the recombinant AcBacmid-FibL-MaSp-c DNA.

[0015] (4) The recombinant AcBacmid-FibL-MaSp-c DNA was transfected into Spodoptera frugiperda Sf9 cultured cells and cultured at 26-27°C until the cells became diseased. The cell culture supernatant was then collected and inoculated into the cultured cells again. After the cells became diseased, the cell culture supernatant was collected and purified by centrifugation to obtain the recombinant Autographa californica baculovirus particles AcNPV-FibL-MaSp-c.

[0016] (5) The recombinant virus AcNPV-FibL-MaSp-c was inoculated into 5th-instar silkworm larvae, which were then fed with dried fresh mulberry leaves soaked or sprayed with an antibiotic solution (500 mg / L) at 24°C to 25°C for 1 day. The larvae were then fed with fresh mulberry leaves until they matured. Preferably, the ratio of the antibiotic solution to the mulberry leaves was 5-7 L:100 kg.

[0017] (6) Feed mature silkworms with fresh mulberry leaves soaked or sprayed with ecdysone solution once; or directly spray mature silkworms with ecdysone solution once;

[0018] (7) Move the mature silkworms to the cocoon maker and make cocoons at 25°C. Harvest the cocoons after 7 days.

[0019] (8) After the cocoons are dried, they are reeled to produce chimeric silk containing golden spider gland silk.

[0020] In the above technical solution, in step (5), the amount of the recombinant virus AcNPV-FibL-MaSp-c inoculated into the 5th instar silkworm larvae is 10 4 ~10 7 Copy / silkworm; the antibiotic solution is ciprofloxacin, norfloxacin, or florfenicol solution; the concentration of the ecdysone solution is 22.5 mg / L, and the dosage ratio of the antibiotic solution to mulberry leaves is 5-7 L:100 kg; if the method of spraying mature silkworms is selected, the amount of ecdysone solution is sufficient to wet the body surface of the silkworms.

[0021] In the method of the present invention, FibL-MaSp-c-polyA is constructed FibLThe preferred embodiment of the expression cassette is to adopt a fully chemical synthesis method based on the sequence of SEQ ID NO: 1. FibL The expression cassette can also be prepared by PCR cloning strategy. FibL Fragment cloned into pFAST-Bac Tm -Dual multiple cloning site constructed plasmid pFAST-FibL-MaSp-c, FibL-MaSp-c-polyA FibL Fragment cloned into pFAST-Bac Tm -Dual (Invitrogen product) multiple cloning site can be used by enzyme ligation or seamless cloning; pick white colonies and extract recombinant AcBacmid-FibL-MaSp-c DNA. AcBacmid-FibL-MaSp-c can be identified by PCR using lightF (SEQ ID NO: 2) and LightR: (SEQ ID NO: 3) primers; when preparing recombinant virus, the purified AcNPV-FibL-MaSp-c DNA is amplified by PCR and confirmed by sequencing of the PCR product. 50 Or quantitative PCR is used to detect the virus titer in the supernatant. If the virus titer in the cultured cell supernatant is low, the cultured cells can be further inoculated to obtain a cell culture supernatant with a high virus titer. The optimized solution is to purify the virus particles from the pathogenic cell culture supernatant by ultracentrifugation to further increase the virus titer.

[0022] In the present invention, the silkworm varieties are preferably silkworm varieties that are practical for silk cocoon breeding, such as "Jingsong × Haoyue", and the original silkworm species can also be selected, such as "75 New". The existing method of silkworm egg injection cannot be applied to good varieties such as silkworm varieties that are practical for silk cocoon breeding, and will cause acid immersion and death. The present invention adopts a new method to successfully solve this problem, and is applicable to all silkworm varieties, especially silkworm varieties that are practical for silk cocoon breeding. The development period of the inoculated 5th-instar silkworm larvae is 1-3 days after the 5th-instar molt. When inoculating the virus, the collected cell culture supernatant or the centrifuged purified virus can be used with a No. 4 insect needle to puncture and inoculate the silkworm larvae. The optimized scheme is to press 10 6 copies / silkworm injected with the recombinant virus AcNPV-FibL-MaSp-c.

[0023] In the present invention, in order to reduce the occurrence of bacterial septicemia caused by bacteria contaminating the inoculation wound during virus inoculation, the antibiotics selected are ciprofloxacin, norfloxacin or florfenicol; the method of using ecdysone is preferably that, when the humidity is high, fresh mulberry leaves soaked or sprayed with ecdysone liquid are dried and then fed to silkworms; when the climate is relatively dry, the ecdysone liquid can be directly sprayed on the silkworms.

[0024] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:

[0025] 1. It is difficult to obtain spider silk in large quantities by directly breeding spiders. The technology of the present invention can utilize the high-level protein synthesis capacity of the silk gland of the silkworm and the biological learning ability of the silkworm to spin silk and cocoon to obtain large quantities of chimeric silk containing the large ampullate gland silk of the golden silk weaving spider.

[0026] 2. Existing technologies can express spider silk proteins through E. coli, yeast, animal cells, or transgenic plants and animals. However, obtaining spider silk fibers requires tedious steps to purify the recombinant protein and then artificially spin the fibers. This process is not only time-consuming and costly, but also difficult to scale up with current technology. The mechanical properties of the resulting silk fibers are still significantly inferior to those of natural spider silk. The technology of this invention directly leverages the efficient protein synthesis capacity of silkworm silk glands and the silkworm's natural ability to spin and cocoon, allowing for the large-scale production of chimeric silk containing the large ampullate gland silk of the golden web spider. This chimeric silk combines the advantages of both silkworm silk and spider index silk.

[0027] 3. Silk protein materials are widely used in various fields. The repeating units of spider silk protein genes have been multiplied multiple times and expressed in Escherichia coli, yeast, animal cells, or transgenic plants and animals using genetic engineering techniques. However, due to the highly repetitive amino acid sequences of spider silk proteins, expression levels are often extremely low, and the molecular weight of the expressed products is lower than that of natural ones. Therefore, the cost of purifying recombinant spider silk proteins is very high, making mass production difficult. The present invention uses recombinant Autographa californica nuclear polyhedrosis virus-mediated expression of the golden web-weaving spider's major ampullate gland silk protein in the posterior silk gland of the silkworm. The recombinant major ampullate gland silk protein is then spun into the cocoon layer to form chimeric silk. This method, used to prepare silk protein materials, eliminates the need for complex purification steps and facilitates mass production. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Identification of the recombinant AcBacmid-FibH-MaSp-c described in Example 1. Recombinant AcBacmid-FibL-MaSp-c DNA was extracted and identified by PCR using primers lightF (SEQ ID NO: 2) and lightR (SEQ ID NO: 3). PCR products were separated by 1% agarose gel electrophoresis. M, DNA molecular weight standard; lanes C-C, wild-type bacmid; lanes 1 and 2, recombinant AcBacmid-FibL-MaSp-c.

[0029] Figure 2 The relative expression level of MaSp-c in silk glands infected with AcNPV-FibL-MaSp-c was detected by RT-qPCR in Example 1.6 Fifth-instar silkworms of the "Jingsong × Haoyue" strain were inoculated with the recombinant virus AcNPV-FibL-MaSp-c. Posterior silk glands were harvested on days 3, 4, and 5 post-inoculation, and total RNA was extracted. After reverse transcription into cDNA, the relative expression level of MaSp-c was determined by quantitative PCR using primers qc-F (SEQ ID NO: 4) and qc-R (SEQ ID NO: 5). The expression of the internal reference gene, eukaryotic initiation factor 4A, was also detected using primers eIF4-1 (SEQ ID NO: 6) and eIF4-2 (SEQ ID NO: 7).

[0030] Figure 3 This is the Western blot analysis of MaSp-c expression in the posterior silk gland of silkworms (Jingsong x Haoyue) infected with the AcNPV-FibL-MaSp-c recombinant virus 3 days after Example 1. CK, control silk gland (uninfected); Lane 1, 5th instar day 3 injected with 10 4 Lane 2, 10 copies of AcNPV-FibL-MaSp-c virus were injected on the 4th day of the 5th instar. 4 Lane 3, 10 copies of AcNPV-FibL-MaSp-c virus injected on the second day of the 5th instar 6 Lane 4, 5-year-old injected with 10 copies of AcNPV-FibL-MaSp-c virus on the 3rd day 6 Lane 5, 10 copies of AcNPV-FibL-MaSp-c virus were injected on the 4th day of the 5th instar. 6 Lane 6, 10 copies of AcNPV-FibL-MaSp-c virus injected on the second day of the 5th instar 5 Lane 7, 10 copies of AcNPV-FibL-MaSp-c virus were injected on the 3rd day of the 5th instar. 5 Lane 8, 10 copies of AcNPV-FibL-MaSp-c virus injected on the 4th day of the 5th instar 6 The primary antibody is anti-MaSp-c antibody, and the secondary antibody is HRP-conjugated goat anti-rabbit IgG.

[0031] Figure 4 Western blot analysis of MaSp-c in cocoon silk using the method described in Example 1. Lane M, standard molecular weight DNA; Lane Ck, silk from silkworms uninfected with AcNPV-FibL-MaSp-c virus; Lane 1, silk from silkworms infected with AcNPV-FibL-MaSp-g virus. The primary antibody used was anti-MaSp-c, and the secondary antibody was HRP-labeled goat anti-rabbit IgG.

[0032] Figure 5Immunohistochemical analysis of MaSp-c secretion in silk glands infected with AcNPV-FibL-MaSp-c in Example 2. A, Silk gland of a control silkworm uninfected with AcNPV-FibL-MaSp-c; B and C, Silk glands of 5th-instar silkworms infected with AcNPV-FibL-MaSp-c for 48 and 72 hours. The primary antibody was anti-MaSp-c, and the secondary antibody was HRP-conjugated goat anti-rabbit IgG.

[0033] Figure 6 This is the Western blot detection of MaSp-c expression in the posterior silk gland of silkworms (75 new) 3 days after infection with the AcNPV-FibL-MaSp-c recombinant virus in Example 2.

[0034] Figure 7 This is the SDS-PAGE analysis of silk fibroin in Example 2. Lane M, standard molecular weight DNA; Lanes 1-4, silk fibroin from 5th-instar silkworms infected with AcNPV-FibL-MaSp-c virus; CK, control silk fibroin.

[0035] Figure 8 shows Western blot analysis of MaSp-c in silk in Example 2. Lane M, standard molecular weight DNA; Lanes 1-4, fibroin from 5th-instar silkworms infected with AcNPV-FibL-MaSp-c virus; CK, control fibroin. DETAILED DESCRIPTION

[0036] Autographa californica nuclear polyhedrosis virus (AcNPV) is the model species of baculovirus. Baculoviruses primarily host insects, and they play a vital role in controlling insect populations. With increasing research, baculoviruses have been widely used in the development of biopesticides, expression of exogenous proteins, and gene delivery into vertebrate cells. There are numerous baculoviruses, each with varying host domains, infectivity, and pathogenicity. The specific preparation procedures of the present invention are conventional in the art and can also be performed according to commercial specifications, such as sequence synthesis, cloning, transformation, transfection, infection, silkworm rearing, cocooning, cocoon harvesting, and silk reeling.

[0037] The present invention will be further described below with reference to the accompanying drawings and embodiments:

[0038] Example 1: Method for producing chimeric silk containing golden web spider ampullate gland silk protein by using the "Jingsong x Haoyue" variety of silkworms

[0039] 1. Chemical synthesis of expression cassette FibL-MaSp-c-polyA FibL Sequence, add on both sides of the sequence Xho I and SphI site, and then commissioned a commercial company to perform chemical synthesis. The synthesized sequence is shown in SEQ ID NO: 1.

[0040] 2. Construction of plasmid pFAST-FibL-MaSp-c: FibL-MaSp-c-polyA FibL Fragment cloned into pFAST-Bac Tm -Dual (Invitrogen product) Xho I and Sph I site to construct plasmid pFAST-FibL-MaSp-c.

[0041] 3. Screening of recombinant bacmid AcBacmid-FibL-MaSp-c: pFAST-FibL-MaSp-c was transformed into Escherichia coli containing AcBacmid DH10Ac and then plated on LB agar plates containing 10 µg / ml, 50 µg / ml, 7 µg / ml, 40 µg / ml, and 100 µg / ml of tetracycline, kanamycin, gentamicin, IPTG, and X-gal, respectively. After incubation at 37°C for 12 hours, white colonies were picked and inoculated into LB medium containing 10 µg / ml, 50 µg / ml, and 7 µg / ml of tetracycline, kanamycin, and gentamicin, respectively. The culture was shaken for 8 hours, and the recombinant AcBacmid-FibL-MaSp-c DNA was extracted and identified by PCR using primers lightF (SEQ ID NO: 2) and LightR (SEQ ID NO: 3). The amplified products were analyzed by agarose gel electrophoresis as shown in Figure 2. Figure 1 As shown, a specific band of about 2 kb consistent with the theoretical molecular weight can be amplified from AcBacmid-FibL-MaSp-c DNA, but not from wild-type AcBacmid DNA, indicating that the recombinant Bacmid was successfully constructed.

[0042] 4. Construction of recombinant virus AcNPV-FibL-MaSp-c: 2 μg of recombinant AcBacmid-FibL-MaSp-c DNA was mixed with liposome Lipofectamine 2000 (Invitrogen) and transfected into Spodoptera frugiperda Sf9 cultured cells. The cells were cultured at 27°C for 4 days, and then the cell culture supernatant was taken and inoculated into the cultured cells again. After the cells became diseased, the cells and cell culture supernatant were collected.

[0043] 5. Purification of AcNPV-FibL-MaSp-c Virus Particles and Determination of Viral Copy Number: The cell culture supernatant in step 4 was centrifuged at 8000 rpm for 10 minutes at 4°C, repeated twice; the supernatant was removed and centrifuged at 30,000 rpm for 30 minutes, the precipitate was removed, and the precipitate was dissolved in phosphate buffer to obtain a stock solution of recombinant virus, which was stored at -20°C for later use; the virus stock solution was taken, its TCID50 was determined, and the copy number of the virus in the stock solution was calculated.

[0044] 6. RT-qPCR detection of the relative expression level of MaSp-c in silk glands of silkworms infected with AcNPV-FibL-MaSp-c: 10 6 The recombinant virus AcNPV-FibL-MaSp-c was inoculated into 5-instar silkworms of the strain "Jingsong×Haoyue". The posterior silk glands were collected on days 3, 4, and 5 after inoculation, and total RNA was extracted. After reverse transcription into cDNA, the relative expression level of MaSp-c was detected by quantitative PCR using primers qc-F (SEQ ID NO: 4) and qc-R (SEQ ID NO: 5). The expression of the internal reference gene eukaryotic initiation factor 4A was also detected using primers eIF4-1 (SEQ ID NO: 6) and eIF4-2 (SEQ ID NO: 7). The results are shown in Figure 2. Figure 2 As shown, AcNPV-FibL-MaSp-c enters the posterior silk gland tissue and transcribes MaSp-c, and its transcription level is significantly increased with viral infection.

[0045] 7. Western blot detection of MaSp-c expression in the posterior silk gland of silkworms (Jingsong×Haoyue) infected with the recombinant virus AcNPV-FibL-MaSp-c for 3 days: 10 4 Copy, 10 injections on the 2nd, 3rd and 4th days of 5 years old 6 Copy, 10 injections on the 2nd and 3rd days of 5 years old 5 Copy and inject 10 on the 4th day of the 5th instar 6 Three days later, the posterior silk gland tissue was taken for Western blot detection. The primary antibody was anti-MaSp-c antibody and the secondary antibody was HRP-labeled goat anti-rabbit IgG. Figure 3 As shown, specific bands representing MaSp-c expression were detected in all the groups inoculated with the recombinant virus.

[0046] 8. Inoculation of silkworms with the recombinant virus AcNPV-FibL-MaSp-c (stock solution): Silkworms of the "Jingsong x Haoyue" variety were reared conventionally until the fifth instar (autumn silkworms), and each silkworm was inoculated with 10 6Virus copies. Add the antibiotic ciprofloxacin to the inoculated silkworms: Prepare a 500mg / L ciprofloxacin solution and spray evenly on mulberry leaves at a rate of 6L / 100kg, wetting both sides. After the fresh mulberry leaves sprayed with ciprofloxacin solution have dried, feed the silkworms for one day. Then, feed them with fresh mulberry leaves at approximately 24°C until they mature.

[0047] 9. Feed silkworms with molting hormone: prepare 22.5mg / L molting hormone solution, spray it evenly on the mulberry leaves at 6L / 100Kg, wet both sides of the mulberry leaves, and feed them to the mature silkworms mentioned above once after they are dried. Then move them to the cocooning machine and make cocoons at 25℃. Harvest the cocoons after 7 days.

[0048] 10. Fresh cocoons are dried and stored. Before reeling, the dried cocoons are routinely degummed and then reeled to obtain chimeric silk. The protein solution of the chimeric silk is dissolved in lithium bromide solution and added to the dialysis membrane. After dialysis for 72 hours, Western blot analysis is performed. The results are as follows: Figure 4 As shown, MaSp-c signals can be observed, indicating that the cocoon silk contains MaSp-c.

[0049] Conventional testing of the chimeric silk fabrics involved strength-elongation curves to assess their mechanical properties, with silk from uninfected AcNPV-FibL-MaSp-c silkworms used as a control. The results, shown in Table 1, demonstrate improved strength and elongation for the chimeric silk fabrics, while decreasing single cocoon length. However, compared to existing methods, the single cocoon length of the present invention remains at least 60% of that of uninfected silk, a significant improvement.

[0050]

[0051] Example 2: Method for producing chimeric silk containing golden web spider ampullate gland silk protein by using "75 new" variety of silkworm

[0052] 1. Preparation of the recombinant virus AcNPV-FibL-MaSp-c: Same as steps 1-5 of Example 1;

[0053] 2. Detection of the secretory expression of MaSp-c in the posterior silk gland of the "75 new" silkworm variety infected with the recombinant virus AcNPV-FibL-MaSp-c: Inoculate 10 6 After 48 and 72 hours, the silk glands were sliced ​​and the secretion and expression of MaSp-c in the silk glands infected with AcNPV-FibL-MaSp-c were detected by immunohistochemistry. The primary antibody used was anti-MaSp-c antibody, and the secondary antibody used was HRP-labeled goat anti-rabbit IgG. Figure 6 As shown, brown signals representing MaSp-c can be observed in the lumen of infected silk glands, indicating that MaSp-c is expressed and secreted into the glandular lumen.

[0054] 3. Western blot detection of MaSp-c expression in the posterior silk glands of 75 new silkworms infected with the recombinant virus AcNPV-FibL-MaSp-c for 3 days: 10 6 After 48 and 72 hours, the silk glands were harvested and the expression of MaSp-c was detected by Western blot. Figure 7 As shown in Figure 3, specific signal bands representing MaSp-c can be observed in the virus-infected silk gland samples, indicating that MaSp-c has been successfully expressed.

[0055] 4. Inoculation of silkworms with the recombinant virus AcNPV-FibL-MaSp-c: The "75 New" silkworms were reared to the fifth instar, and each silkworm was inoculated with 10 6 Virus copies. Add the antibiotic florfenicol to the inoculated silkworms: Prepare a 500mg / L florfenicol solution and spray evenly on mulberry leaves at a rate of 6L / 100kg, wetting both sides. After the fresh mulberry leaves sprayed with florfenicol solution have dried, feed the silkworms for one day. Then, feed them with fresh mulberry leaves at approximately 24°C until they mature.

[0056] 5. Spraying molting hormone on silkworms: Prepare a 22.5 mg / L molting hormone solution and spray it on the silkworms' bodies until they are moist. The cocooning, cocooning, and cocoon harvesting procedures are the same as in step 9 of Example 1.

[0057] 6. Fresh cocoons are dried and stored. Before reeling, the dried cocoons are stored and degummed, and then reeled to obtain chimeric silk containing the golden silk spider's ampullate gland silk protein. SDS-PAGE and Western blot routinely detect chimeric silk protein, and the results are as follows: Figure 8 As shown, bands representing MaSp-c were observed in cocoon silk samples from virus-infected silkworms. Western blot analysis revealed MaSp-c signal bands in cocoon silk samples from virus-infected silkworms, indicating the presence of MaSp-c in the silk. The length of a single cocoon silk from infected silkworms was at least 58% of that of a single cocoon silk from uninfected silkworms.

[0058] Existing techniques for transgenic silkworms mediated by piggyBac can produce chimeric silk containing spidroin components, improving the mechanical properties of silk fibers to a certain extent. However, the spidroin content of these chimeric silks is very limited. Using TALEN-mediated homologous end recombination, the silkworm heavy chain gene has been replaced with a spider major ampullate gland silk protein gene with multiple repeats. This genetically modified silkworm produces chimeric silk with significantly increased levels of spidroin. While this chimeric silk exhibits increased elongation, its strength is reduced. Furthermore, due to technical limitations in microinjecting genes into silkworm eggs, current genetic modification of silkworms is largely limited to polymorphic silkworms, which have no practical production value. The present invention's technology can leverage the high productivity of practical silkworm varieties to produce chimeric silk with the excellent properties of both silkworm and spider silk. Crucially, existing methods for producing chimeric spider silk using silkworms significantly reduce silk length. Experimental studies have found that the length of the recombined silk can be up to 41% of the original silk length. The existing technology uses the method of silkworm transgenic to introduce spider silk protein genes into the silkworm genome, which requires a relatively complex procedure for screening and identifying transgenic silkworms, and further hybridization screening to obtain transgenic pure lines, which takes 1 to 2 years. The technology of the present invention can obtain recombinant viruses in a shorter time, and by inoculating 5-year-old silkworms with the virus, chimeric silk containing spider silk proteins can be obtained in about a week, achieving significant technological progress.

[0059] SEQ ID NO: 1:

[0060]

[0061] SEQ ID NO: 2 (lightF)

[0062] ATGAAACCTATCTTCCTCGTTCTG

[0063] SEQ ID NO: 3 (lightR)

[0064] TCCTAAAGCCTGGTAGACTGACTG

[0065] SEQ ID NO: 4(qc-F)

[0066] AGAGTGAGCTCCGCTGTTTC

[0067] SEQ ID NO: 5(qc-R)

[0068] TCAAGGCTGACACGACTTCC

[0069] SEQ ID NO: 6 eIF4-1

[0070] GAATGGACCCTGGGACACTT

[0071] SEQ ID NO: 7 eIF4-2

[0072] CTGACTGGGCTTGAGCGATA Sequence Listing <110> Soochow University <120> A method for producing chimeric silk using silkworms via Autographa californica nuclear polyhedrosis virus <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2999 <212> DNA <213> Artificial Sequence <400> 1 ctcgaggtac ggttcgtaaa gttcacctgc ggctatattc cgactcgcca agttacgtca 60 gtcgtattgt aatgagcgat ttagtgggca acttcattct gttaattttg tgtcacggtg 120 cgcgcgcatc gtaaaacttc actctcatag atttttcata acgcgcctaa agaagtataa 180 cttcaataat ttaatttaa aaaaaaacat gcatagaata attattatga ttattaaaa 240 tgtcatttac cgacattgac atacagacg acgttaacac tacaaacat ttttattcca 300 cattgttaca tattcacag ttaaatttgc gttaattctc gatgcgaaca atatagaa 360 caatcggatc aattagatcg ctttgttttcg aaaacactt agtttaacta gaggcgtaca 420 cctcaagaaa tcatctcat tagaactaa accttaaaat cgcaataata aagcatagtc 480 aattttaact gaatgcaa gtcttttgaa cgttagatgc tgtcagcgtt cgttggtaca 540 gttgtttgat attatttta attgtcttttt tatatataaa tagtggaaca ttaatcacgg 600 aatcctgtat agtatatacc gattggtcac atacagacc actaaaatga aacctactt 660 cctcgttctg ctggtggcta catctgccta tgccgcccca tggtcttcga cggagttggc 720 cgacgctttt atcaacgctt tcccaatga agccggaaga actggcgctt tcaccgccga 780 ccaactcgac gatatgtcta ccattggtga caccctgaa acagctatgg ataagatggc 840 cagatccaac aaatcatctc aatcgaagct ccaggctctg aatatggctt tcgcttcatc 900 aatggctgaa atcgctgccg tggaacaagg tggattgagc gttgctgaaa aaacaaacgc 960 tattgccgat tccctcaatt cggctttcta ccaaacaact ggagccgtta acgtccagtt 1020 cgtcaatgaa atagaagtc tcatctcaat gttcgctcag gccagcgcta agaagctag 1080 ctacggcggt ggatacggcg gtggacaagg cggtcaatct gctggtgctg ccgctgccgc 1140 tggtgctgga caaggtggtt acggtggact gggcggtcaa ggtgctggta gtgccgctgc 1200 cgctgccgct tcaggagcag gtcaaggtgg ttatggtgga gtgggaaacc agggtgctgg 1260 aagaggcgcc ggagccgctg ccgctgccgc tggcggtgct ggtcaaggtg gttacaatgg 1320 tggcaagga ccttctgccg ctgccgctgc cgctgccagc ggagctggcc agggcggtta 1380 cggaggccct ggttcccaag gtgctggca aggagctgga gctgccgctg ccgctgccgg 1440 tggagctggga caaggcggtt acggaggctt gggtggacag ggagctggaa gaggcggtgc 1500 tgccgctgcc gctgccgctg ccggtgtggc tggacaaggt ggtctgggtt cgcagggtgc 1560 tggagaggt ggactcggcg gtcagggtgc aggcgctgcc gctgccgctg gaggcgccgg 1620 acagggtgga tacggtggtc tgggacaagg tgctggtcaa ggagctggag tcgccgctgc 1680 cgctgccgct ggaggcgctg gccaaggtgg atacggcggt ttcggttccc agggagcagg 1740 aagaggtggt caaggtggac aaggttcggc cgctgccgct ggcggtgctg ggcaaagagg 1800 ttacggaggc cagggtgctg gtcagggtgg attgggcggt ggagaacagg gagctggcga 1860 agaaggttct ggtgccagcg ctggcgctgg tgccgctgcc ggaagaggcg ctggcggtgg 1920 aggcaagggt ggactgggcg gtcaaggtgg tagtgctgcc gctgccgctg ccggtggagc 1980 tgggcaaggc ggtttgggag gctcaagagg tgctggacaa ggtgctggag ctgccgctgc 2040 cgctgccggt ggagctggtc agggcggtta tggaggcctg ggctcacaag gagctggtag 2100 aggtggacaa ggcgctgggtg ctgccgctgc cgctgccggc ggtgctggcc aaggtggtta 2160 cggtggactg ggcggtcagg gcgttggtag aggtggtctg ggtggtcaag gtgcaggtgc 2220 tgccgctgcc gtcggtgctg gacagggcgg ttacggaggc gtgggatctg gtgcttcggc 2280 tgccagtgct gccagatcta gattgtcgag tcctcaagct tcatctagct tggctccgc 2340 tgtttcgaac ctcgtcgcca gtgtccac aaattcagct gccctgtcga gtactatttc 2400 aaacgtggtt tctcaatag gagctctaa tcctggactg agcggctgcg acgttttgat 2460 acaggctctg ttggagtcg tgtcagcctt gatccaaatt ctcggttcat ctagcatcgg 2520 acaggtcaat tacggctcag cgggacaggc tacgcaata gtgggacagt cagtctacca 2580 ggctttagga taaatagaa ctgtaataa tgtatatata taattatata aagatatat 2640 ataccatat acacatat attack aagacaatct acctatata aacacata 2700 aaattaataa ttgtatac tttattgtg tttaggacat tttgcaaa ttgtgtttgc 2760 gttaggatttt ttttggaag ttttttagat tattttagaa tataataata atatacgtt 2820 atatatatat atattatata atcaacgac acggcttttc atttggtga tgatcaatct 2880 tattgttctt ctaattgatt ttttgtaca aaagatgt atccagtttt ccagataaag 2940 aatttagttt gttattctg gccccattaa ataagtacg gtattcgaca atagcatgc 2999 <210> 2 <211> twenty four <212> DNA <213> Artificial Sequence <400> 2 atgaaaccta tcttcctcgt tctg 24 <210> 3 <211> twenty four <212> DNA <213> Artificial Sequence <400> 3 tcctaaagcc tggtagactg actg 24 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 agagtgagct ccgctgtttc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 tcaaggctga cacgacttcc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 gaatggaccc tgggacactt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 ctgactgggc ttgagcgata 20

Claims

1. A method for producing chimeric silk using silkworms via Autographa californica nuclear polyhedrosis virus, characterized in that: The following steps are involved: (1) FibL-MaSp-c-polyA FibL The fragment was cloned into the multiple cloning site of pFAST-Bac-Dual to construct the plasmid pFAST-FibL-MaSp-c; the FibL-MaSp-c-polyA FibL The sequence of the fragment is SEQ ID NO: 1; (2) The plasmid pFAST-FibL-MaSp-c was transformed into Escherichia coli containing AcBacmid DH10Ac, and then spread on LB agar plates for culture. Then, white colonies were picked and recombinant AcBacmid-FibL-MaSp-c DNA was extracted; (3) The recombinant AcBacmid-FibL-MaSp-c DNA was transfected into cultured cells of Spodoptera frugiperda, and then cultured until the cells became diseased. The cell culture supernatant was then taken and inoculated into the cultured cells again, and then cultured until the cells became diseased. The cell culture supernatant was then collected and purified by centrifugation to obtain the recombinant california baculovirus particles AcNPV-FibL-MaSp-c; (4) The recombinant Autographa californica baculovirus particles AcNPV-FibL-MaSp-c prepared in step (3) are inoculated into silkworm larvae, which are then reared to cocoons; cocoons are then harvested and reeled to obtain chimeric silk.

2. The method for producing chimeric silk using silkworms by using Autographa californica nuclear polyhedrosis virus according to claim 1, characterized in that: LB agar medium contains tetracycline, kanamycin, gentamicin, IPTG and X-gal.

3. The method for producing chimeric silk using silkworms by using Autographa californica nuclear polyhedrosis virus according to claim 1, characterized in that: In step (2), the culture temperature is 37°C.

4. The method for producing chimeric silk using silkworms by using Autographa californica nuclear polyhedrosis virus according to claim 1, characterized in that: In step (3), the cultured cells are Sf9 cultured cells, and the culture temperature is 26-27°C.

5. The method for producing chimeric silk using silkworms by using Autographa californica nuclear polyhedrosis virus according to claim 1, characterized in that: The silkworm larvae were fifth-instar silkworm larvae.

6. The method for producing chimeric silk using silkworms by using Autographa californica nuclear polyhedrosis virus according to claim 1, characterized in that: Raise the silkworms until they are mature, then treat them with molting hormone and put them on the cocoon.

7. The method for producing chimeric silk using silkworms by using Autographa californica nuclear polyhedrosis virus according to claim 6, characterized in that: During the process of raising silkworm larvae until they mature, they are treated with antibiotics once.

8. The method for producing chimeric silk using silkworms by using Autographa californica nuclear polyhedrosis virus according to claim 1, characterized in that: Cocoons are grown at 25℃ and harvested after 7 days.

9. The chimeric silk produced by the method for producing chimeric silk using silkworms infected with Autographa californica nuclear polyhedrosis virus according to claim 1.

Images