Bacterial tryptophan-5-hydroxylase and its application

Abstract

The present invention discloses a bacterial tryptophan 5-hydroxylase and its application, belonging to the field of biotechnology. The amino acid sequence of the bacterial tryptophan 5-hydroxylase is shown in SEQ ID NO.1, SEQ ID NO.3 or SEQ ID NO.5, or has more than 50% homology and functional equivalence with the amino acid sequence shown in any one of them. The present invention identifies a new type of bacterial tryptophan 5-hydroxylase family that uses heme as a cofactor and can catalyze tryptophan to produce 5-hydroxytryptophan in vivo or in vitro. The enzyme can be used to catalyze tryptophan to prepare 5-hydroxytryptophan or to prepare melatonin. The present invention utilizes an engineered strain that heterologously expresses tryptophan 5-hydroxylase genes, methyltransferase genes and decarboxylase genes and lacks tryptophan dioxygenase genes as a fermentation strain, and specifically produces melatonin through a microbial fermentation method. The method is green, economical, efficient, and has industrial production prospects.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a novel bacterial tryptophan-5-hydroxylase and application thereof in the preparation of melatonin. Background Art

[0002] Melatonin is a human hormone with a chemical structure of N-acetyl-5-methoxytryptamine, as shown in Formula (I). In the human body, melatonin regulates circadian rhythms, sleep and body temperature, promotes milk secretion, and protects the skin. Melatonin can also protect lymphocytes and prevent ionizing radiation from damaging DNA. In addition, it has anti-inflammatory, antioxidant, and diabetes-reducing functions.

[0003]

[0004] Currently, the number of people suffering from circadian rhythm disorders is huge and is still increasing. In China, at least 300 million people suffer from sleep disorders; in the United States, about 50 to 70 million people suffer from insomnia or circadian rhythm disorders for a long time. Taking melatonin is an important way to treat circadian rhythm disorders. At present, the global sales of melatonin are rising rapidly, showing a trend of supply exceeding demand. Therefore, it is necessary to improve the industrial synthesis method of melatonin and increase its output.

[0005] The biosynthesis of melatonin in plants and animals is divided into four steps. In plants, tryptophan is decarboxylated to become tryptophan, then tryptophan-5-hydroxylase catalyzes tryptophan to form serotonin, acetyltransferase catalyzes serotonin to form N-acetylserotonin, and finally methyltransferase catalyzes the formation of melatonin. Under aging and environmental stress, the catalytic order of acetyltransferase and methyltransferase in plants will change. Animals cannot synthesize tryptophan by themselves and must ingest it through food, so the production of melatonin is low. In the biosynthetic pathway of melatonin in animals, tryptophan-5-hydroxylase first catalyzes the formation of 5-hydroxytryptophan from tryptophan, tryptophan decarboxylase catalyzes the decarboxylation to form serotonin, then serotonin is catalyzed by acetyltransferase to form N-acetylserotonin, and finally methyltransferase catalyzes the formation of melatonin.

[0006] Microorganisms have complex metabolic networks and a large number of secondary metabolites, but only a few microorganisms can produce melatonin, and their melatonin biosynthesis pathways are unknown. These microorganisms include several yeasts and Pseudomonas, but their melatonin production is very low. For example, Pseudomonas fluorescens synthesizes melatonin as a growth signal molecule and antioxidant, with a maximum production of only 1.32 micrograms per liter. In yeast, melatonin interacts with glycoproteins to enhance the yeast's tolerance to oxidative stress and ionizing radiation, with an average production of up to 90 micrograms per liter.

[0007] At present, the melatonin sold on the market is mainly chemically synthesized. The chemical synthesis of melatonin is mainly divided into four pathways, and the starting raw materials are p-substituted phenylhydrazine, C3 and C5 disubstituted indole, monoprotected cyclohexanedione, and N-allyl p-methoxyaniline. These chemical synthesis methods have many steps, high costs, and will cause serious environmental pollution. The efficiency of directly extracting melatonin from animals and plants is very low. Designing and optimizing the melatonin biosynthesis pathway in microorganisms is expected to become a cheap and environmentally friendly industrial production method for melatonin.

[0008] A research team from the Institute of Microbiology, Chinese Academy of Sciences, introduced pterosin-4α-carbinolamine dehydratase from Pseudomonas, phenylalanine-4-hydroxylase from Xanthomonas, decarboxylase from Streptomyces, caffeic acid 3-O-methyltransferase from rice and methyltransferase from Streptomyces into Escherichia coli, achieving the biosynthesis of melatonin (Zhang, Y., He, Y., Zhang, N., Gan, J., Zhang, S., & Dong, Z. Combining protein and metabolic engineering strategies for biosynthesis of melatonin in Escherichia coli. Microbial cell factories, 2021, 20(1), 170.).

[0009] In general, heterologous expression of melatonin biosynthetic enzymes in microbial hosts has problems such as very low expression, little soluble protein, and poor catalytic activity, especially tryptophan-5-hydroxylase. Animal-derived tryptophan-5-hydroxylase requires ferrous ions and tetrahydrobiopterin as coenzymes. The reaction catalyzed by this enzyme is the first step in the melatonin biosynthesis pathway and is the rate-limiting step. However, the expression level and enzyme activity of this enzyme in microorganisms are insufficient, and protein engineering and metabolic engineering methods need to be applied to transform it. Some researchers have also transformed the iron ion and tetrahydrobiopterin-dependent phenylalanine-4-hydroxylase in bacteria into tryptophan-5-hydroxylase for the biosynthesis of melatonin. In addition, in order to improve the catalytic efficiency of tryptophan-5-hydroxylase, it is necessary to introduce the tetrahydrobiopterin regeneration pathway at the same time.

[0010] Therefore, if we can find a tryptophan-5-hydroxylase that is highly expressed in microorganisms and has high catalytic efficiency, we can expect to further increase the production of melatonin. Analysis of microbial secondary metabolic pathways is an important method for discovering enzymes with novel structures and functions, and provides a valuable tool for metabolic engineering. Highly expressing heterologous combinations of specific genes and regulating metabolic flows to more efficiently synthesize melatonin will be a feasible solution. Summary of the invention

[0011] The purpose of the present invention is to develop a novel tryptophan 5-hydroxylase, and to achieve green and efficient preparation of melatonin by heterologously expressing the tryptophan 5-hydroxylase in microbial host cells and regulating metabolic flow.

[0012] To achieve the above object, the present invention adopts the following technical solution:

[0013] The present invention is verified by genomic analysis and molecular biological technology, and three novel bacterial tryptophan-5-hydroxylases with the activity of catalyzing tryptophan to generate 5-hydroxytryptophan are identified. The amino acid sequences of the three novel bacterial tryptophan-5-hydroxylases are shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5, which are respectively derived from Luz15 of Actinomadura sp. DSM 43766, PsmG of Streptomyces griseofuscus NRRL 5324, and KerI of Entotheonella factor.

[0014] Sequence alignment and spectral feature analysis of the bacterial tryptophan-5-hydroxylase show that the bacterial tryptophan-5-hydroxylase contains a tryptophan dioxygenase-like domain and a conserved and essential histidine residue (histidine at position 375 of Luz15, histidine at position 369 of PsmG, and histidine at position 363 of KerI). This conserved histidine residue binds heme (heme b). This type of enzyme uses heme as a cofactor to participate in catalyzing tryptophan to generate 5-hydroxytryptophan, and this mode of action is different from the existing reported tryptophan-5-hydroxylase using pterin and ferrous ions as cofactors.

[0015] Therefore, the present invention provides the use of bacterial tryptophan-5-hydroxylase in catalyzing the preparation of 5-hydroxytryptophan from tryptophan.

[0016] The amino acid sequence of the bacterial amino acid-5-hydroxylase is shown in SEQ ID NO.1, SEQ ID NO.3 or SEQ ID NO.5;

[0017] Alternatively, the amino acid sequence of the bacterial amino acid-5-hydroxylase has more than 50% homology and is functionally equivalent to the amino acid sequence shown in any one of SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5, and the sequence contains a conserved histidine residue, which corresponds to position 375 of the sequence shown in SEQ ID NO.1, position 369 of the sequence shown in SEQ ID NO.3, and position 363 of the sequence shown in SEQ ID NO.5.

[0018] Any polypeptide fragment or variant thereof obtained by deleting, inserting or replacing amino acids in the amino acid sequence shown in any one of SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5, as long as it has more than 50% homology with the amino acid sequence shown in any one of SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5, contains a tryptophan dioxygenase-like domain and conserved histidine residues in the sequence, and has the function of catalyzing tryptophan to produce 5-hydroxytryptophan, belongs to the protection scope of the present invention.

[0019] The present invention also provides a gene sequence encoding the bacterial amino acid-5-hydroxylase, and the nucleotide sequence can be modified according to the codon preference of the host cell.

[0020] Preferably, the nucleotide sequences of the genes encoding the bacterial amino acid-5-hydroxylases whose amino acid sequences are shown as SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5 are shown as SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.6 respectively.

[0021] Furthermore, the tryptophan is L-tryptophan. The present invention shows that the bacterial tryptophan-5-hydroxylase can catalyze L-tryptophan to produce L-5-hydroxytryptophan in vivo or in vitro.

[0022] Furthermore, the application includes: using wet bacteria obtained after fermentation and cultivation of engineered bacteria containing bacterial amino acid-5-hydroxylase encoding genes or enzymes extracted after wet bacteria crushing as biocatalysts, L-tryptophan as a substrate, hydrogen peroxide as an oxidant, a buffer solution with a pH of 6 to 9 as a reaction medium, reacting at 30 to 40°C, and separating and purifying the reaction solution after the reaction is completed to obtain L-5-hydroxytryptophan.

[0023] Preferably, the reaction medium uses HEPES buffer.

[0024] The present invention also provides the use of the bacterial tryptophan-5-hydroxylase in the preparation of melatonin. 5-Hydroxytryptophan is a precursor substance for the biosynthesis of melatonin. The biosynthesis of melatonin is achieved by introducing the bacterial tryptophan-5-hydroxylase encoding gene and downstream genes into a microbial host cell.

[0025] Furthermore, the application includes: using actinomycetes as starting bacteria, knocking down the gene encoding tryptophan dioxygenase by gene inactivation technology, and then introducing the coding gene of tryptophan-5-hydroxylase, methyltransferase gene and decarboxylase gene of the cell by gene heterologous expression technology to construct recombinant bacteria, fermenting and culturing the recombinant bacteria, separating and purifying the fermentation product, and obtaining melatonin.

[0026] The actinomycetes may be, but are not limited to, Streptomyces albus, Streptomyces coelicolor, Streptomyces venezuelae, and Corynebacterium glutamicum.

[0027] Preferably, Streptomyces albus J1074 is used as the starting strain. In the tryptophan degradation gene cluster of the strain, kynA is a gene encoding tryptophan dioxygenase, and its nucleotide sequence is shown in SEQ ID NO.7; and antN in the antimycin biosynthesis gene cluster ant is a gene encoding tryptophan dioxygenase, and the nucleotide sequence of the ant gene cluster is shown in SEQ ID NO.8.

[0028] The tryptophan dioxygenase gene kynA and the antimycin biosynthesis gene cluster ant in Streptomyces albus J1074 were destroyed by gene knockout or gene inactivation strategies to block the degradation of tryptophan.

[0029] The gene inactivation technology can be homologous recombination, CRISPR / Cas9 and other technologies to achieve gene deletion mutation encoding tryptophan dioxygenase in the host cell genome; or transposon mutagenesis, insertion mutation, point mutation and other technologies to inactivate the gene.

[0030] Preferably, the tryptophan dioxygenase gene kynA and the antimycin biosynthesis gene cluster in Streptomyces albus J1074 are inactivated by homologous double exchange method.

[0031] The heterologous expression technology can be achieved using tools such as integrating plasmids, transposing plasmids, and Streptomyces replicating plasmids.

[0032] Preferably, the gene encoding the cellular tryptophan 5-hydroxylase is luz15 from Actinomadura sp. DSM43766, and its nucleotide sequence is shown in SEQ ID NO.2.

[0033] Preferably, the methyltransferase gene is luz16 from Actinomadura sp. DSM43766, and its nucleotide sequence is shown in SEQ ID NO.9.

[0034] Preferably, the decarboxylase gene uses the decarboxylase gene SapsmH whose nucleotide sequence is shown in SEQ ID NO.10.

[0035] The invention provides an engineering strain of Streptomyces albus. The construction method thereof comprises the following steps: using Streptomyces albus J1074 as a starting bacterium, inactivating a tryptophan dioxygenase gene kynA and an antimycin biosynthesis gene cluster ant by gene inactivation technology, thereby obtaining a Streptomyces albus ΔkynAΔant strain; and then introducing a gene encoding a tryptophan-5-hydroxylase, a methyltransferase gene luz16 and a decarboxylase gene SapsmH of the bacteria into the ΔkynAΔant strain, thereby obtaining an engineering strain of Streptomyces albus that efficiently produces melatonin.

[0036] Specifically, the nucleotide sequence of the tryptophan dioxygenase gene kynA is shown in SEQ ID NO.7; the nucleotide sequence of the antimycin biosynthesis gene cluster ant is shown in SEQ ID NO.8; the nucleotide sequence of the methyltransferase gene luz16 is shown in SEQ ID NO.9; the nucleotide sequence of the decarboxylase gene SapsmH is shown in SEQ ID NO.10; the bacterial tryptophan-5-hydroxylase amino acid sequence is shown in SEQ ID NO.1, SEQ ID NO.3 or SEQ ID NO.5, or has more than 50% homology with the amino acid sequence shown in any one of SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5 and is functionally equivalent.

[0037] The present invention also provides a method for producing melatonin using the engineered strain, comprising the following steps: inoculating the engineered strain of Streptomyces albus into a fermentation medium, fermenting and culturing, separating and purifying the fermentation product, and producing melatonin.

[0038] Preferably, the fermentation medium comprises, per liter of medium, 3-6 g of peptone, 2-4 g of yeast powder, 2-4 g of malt extract, 5-20 g of glucose, 0.5-2 g of tryptophan, and the balance is water.

[0039] The fermentation culture condition is 27-37° C. for 7-9 days. Preferably, the fermentation culture condition is 30° C. for 7-9 days.

[0040] After the fermentation is completed, the fermentation product is diluted with methanol, and the mycelium and precipitated protein are removed by centrifugation to obtain a supernatant containing melatonin, which is then separated and purified to obtain melatonin.

[0041] Preferably, melatonin is purified by high performance liquid chromatography, with acetonitrile as the mobile phase, using a C18 chromatographic column, and gradient elution at 5% to 95% (acetonitrile + 0.05% formic acid) / (water + 0.05% formic acid) from 0 to 25 minutes, a flow rate of 0.6 mL / min, and a retention time of melatonin of 8 minutes.

[0042] The present invention has the following beneficial effects:

[0043] (1) The present invention identifies a novel bacterial tryptophan-5-hydroxylase family that uses heme (heme b) as a cofactor and can catalyze L-tryptophan to produce L-5-hydroxytryptophan in vivo or in vitro.

[0044] (2) The present invention utilizes an engineered strain heterologously expressing tryptophan 5-hydroxylase gene, methyltransferase gene and decarboxylase gene and lacking tryptophan dioxygenase gene as a fermentation strain to specifically produce melatonin through a microbial fermentation method. The method is green, economical, efficient and has industrial production prospects.

[0045] (3) The present invention provides an engineered strain of Streptomyces albus that specifically produces melatonin. The tryptophan dioxygenase gene kynA and the antimycin biosynthesis gene cluster ant of Streptomyces albus J1074 are inactivated by genetic engineering to block the tryptophan degradation process, and the tryptophan-5-hydroxylase gene, methyltransferase gene luz16 and decarboxylase gene SapsmH are introduced by genetic heterologous expression technology to biosynthesize and accumulate melatonin. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 This is the sodium dodecyl sulfate polyacrylamide gel electrophoresis detection diagram of tryptophan 5-hydroxylases from three bacteria.

[0047] Figure 2 UV-visible spectra of tryptophan 5-hydroxylases from three bacteria.

[0048] Figure 3 Results of HPLC determination of in vitro biochemical reactions of three bacterial tryptophan 5-hydroxylases.

[0049] Figure 4 The following is the sequence alignment result of three bacterial tryptophan 5-hydroxylases.

[0050] Figure 5This is the sodium dodecyl sulfate polyacrylamide gel electrophoresis detection diagram of Luz15 mutant (H375A).

[0051] Figure 6 UV-visible spectrum of Luz15 mutant (H375A).

[0052] Figure 7 The results of high performance liquid chromatography (HPLC) analysis of the in vitro biochemical reaction of Luz15 mutant (H375A).

[0053] Figure 8 This is a schematic diagram of the construction of the inactivated mutant strain of the tryptophan dioxygenase gene kynA, in which the small figure on the right is the gel electrophoresis detection diagram.

[0054] Fig. 9 Schematic diagram of the construction of the ΔkynAΔant strain, where the small figure on the right is the gel electrophoresis detection diagram.

[0055] Fig.10 It is a schematic diagram of the construction of mutant strain DS-1, and the small figure on the right is the gel electrophoresis detection diagram.

[0056] Fig.11 The results of HPLC determination of the components of the extract of mutant DS-1 in Example 2 are shown. DETAILED DESCRIPTION

[0057] The present invention will be further described below in conjunction with specific embodiments. The following embodiments are only used to illustrate the present invention and are not intended to limit the scope of application of the present invention. Without departing from the spirit and essence of the present invention, modifications or replacements made to the inventive method, steps or conditions all belong to the scope of the present invention.

[0058] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0059] The starting strain of mutant DS-1 in the following examples, Streptomyces albus J1074, is a laboratory-preserved strain, which was originally described in the literature KF Chater, LC Wilde, Microbiology, 1980, 116, 323-334.

[0060] LB medium consists of 1% tryptone, 0.5% yeast extract, 1% sodium chloride, and solid medium plus 2% agar powder;

[0061] YEMET medium consists of 0.5% peptone, 0.3% yeast powder, 0.3% malt extract, 1% glucose and 0.1% L-tryptophan.

[0062] Example 1

[0063] Identification of three novel bacterial tryptophan 5-hydroxylases

[0064] 1. Expression of bacterial tryptophan 5-hydroxylase based on the Escherichia coli protein expression vector pET22b.

[0065] 1. Using genomic DNA of Actinomadura sp. DSM43766 (purchased from German Microbial Culture Collection Center) as a template, luz15 (length 1254 bp, nucleotide sequence as shown in SEQ ID NO.2, part 37598 to 38851 in the sequence of NCBI accession number OM250071.1, corresponding amino acid sequence as shown in SEQ ID NO.1) was amplified by polymerase chain reaction, wherein the upstream primer was 15F (5'→3': aagaaggagatatacatatgcgagccacgacgaacg), and the downstream primer was 15R (5'→3': tggtggtggtggtgctcgagggcatgcgggcctcctggtgag).

[0066] Using the psmG gene synthesized by Beijing Qingke Biotechnology Co., Ltd. (length 1206 bp, nucleotide sequence as shown in SEQ ID NO.4, the part from 5864 to 7069 in the sequence of NCBI accession number KF201694.1, and the corresponding amino acid sequence as shown in SEQ ID NO.3) as a template, psmG was amplified by polymerase chain reaction, wherein the upstream primer was GF (5'→3': aagaaggagatatacatatgaccactccgactgagc) and the downstream primer was GR (5'→3': tggtggtggtggtgctcgagcaggagtggctcctcaaggtg).

[0067] Using the kerI gene (1278 bp in length, the nucleotide sequence is shown in SEQ ID NO.6, and the corresponding amino acid sequence is shown in SEQ ID NO.5) synthesized by Beijing Qingke Biotechnology Co., Ltd. as a template, kerI was amplified by polymerase chain reaction, wherein the upstream primer was IF (5'→3': aagaaggagatatacatATGTATGAACAGCATCTGATTC) and the downstream primer was IR (5'→3': tggtggtggtggtgctcgagATTACCAACACCAACCAGCGG).

[0068] 2. Use a seamless cloning kit (ClonExpress MultiS OneStep Cloning Kit from Nanjing Novogene Biotechnology Co., Ltd.) to insert the above three gene fragments into pET22b respectively to obtain three expression vectors, pET22b-luz15, pET22b-psmG and pET22b-kerI. After sequencing verification, the three expression vectors were introduced into the competent state of Escherichia coli strain Transetta (DE3) (purchased from TransGen Biotech) through transformation. A single colony was picked and inoculated into a test tube culture medium and cultured for 12 hours. After that, it was transferred to LB culture medium at a ratio of 1:50 and shaken at 37°C and 180 rpm for 5 hours. Isopropyl-β-D-thiogalactoside was added to a final concentration of 0.1 mM, 5-aminolevulinic acid solution was added to a final concentration of 1 mM, and ammonium ferrous sulfate hexahydrate was added to a final concentration of 1 mM. The cells were cultured at 18°C ​​and 140 rpm for 18 hours, and the Escherichia coli cells were collected by centrifugation at 5000 rpm for 8 min, washed once with water, and collected by centrifugation at 5000 rpm for 8 min.

[0069] 2. Purification of bacterial tryptophan 5-hydroxylase

[0070] The cells obtained in the first step were resuspended in about 20 mL of 10 mM imidazole buffer (containing 10 mM imidazole, 50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, pH 8.0) and ultrasonically disrupted using a JY92-IIDN ultrasonic cell disruptor (purchased from Ningbo Xinzhi Biotechnology Co., Ltd.). Ultrasonic conditions: No. 6 horn, 20% power, 2 minutes per round, 5 rounds in total, 2 minutes between each round. In each round of ultrasonication, ultrasonication was performed for 3 seconds and then stopped for 3 seconds, alternating between them.

[0071] After ultrasonic wall breaking, the liquid was transferred to a high-speed centrifuge tube and centrifuged at 15000rpm for 40min. The supernatant was mixed with 3 ml of Ni-NTA agarose resin (purchased from Shenggong Bioengineering Co., Ltd.) by inversion at 4°C for 1 hour, and then transferred to the chromatography column. After the Ni-NTA agarose resin was settled and the liquid was exhausted, it was washed with 30mM imidazole buffer (containing 30mM imidazole, 50mM sodium dihydrogen phosphate, 300mM sodium chloride, pH 8.0) and 50mM imidazole buffer (containing 50mM imidazole, 50mM sodium dihydrogen phosphate, 300mM sodium chloride, pH 8.0) in sequence, and finally eluted with 300mM imidazole buffer (containing 300mM imidazole, 50mM sodium dihydrogen phosphate, 300mM sodium chloride, pH 8.0). About 6 ml of the eluate was collected and eluted in a column containing 100mM sodium chloride, 25mM The solution was dialyzed against a solution of 4-hydroxyethylpiperazineethanesulfonic acid and 1 mM dithiothreitol at pH 8.0 at 4°C for 15 hours and concentrated using an ultrafiltration centrifuge tube.

[0072] The purified bacterial tryptophan-5-hydroxylase was verified by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Figure 1 shown.

[0073] 3. In vitro biochemical reaction of tryptophan 5-hydroxylase

[0074] 1. Using a solution containing 100 mM sodium chloride, 25 mM 4-hydroxyethylpiperazineethanesulfonic acid, and 1 mM dithiothreitol at pH 8.0 as a blank, scan the spectrum of tryptophan-5-hydroxylase obtained in the second step from 350 nm to 700 nm. Figure 2 As shown, Luz15, PsmG and KerI all have maximum absorption peaks around 425nm and also have absorption peaks around 550nm. These spectral features indicate that these enzymes contain heme.

[0075] Among the currently known tryptophan 5-hydroxylases, whether they are derived from animals or modified from bacterial phenylalanine 4-hydroxylase, the cofactors are pterin and ferrous ions. They have never been reported to contain heme, and their sequences have no similarities with the three new bacterial tryptophan 5-hydroxylases mentioned above.

[0076] The heme concentration of these bacterial tryptophan-5-hydroxylases was then measured using pyridinium heme spectrophotometry (see Barr, I. & Guo, F. Bio Protoc. 5, e1594 (2015).).

[0077] 2. The in vitro biochemical reaction system is 100 μl, including 10 μl 40 mM hydrogen peroxide, 20 μl 15 mM L-tryptophan (dissolved in 50 mM HEPES buffer) and 70 μl bacterial tryptophan-5-hydroxylase. The concentration of bacterial tryptophan-5-hydroxylase added (in terms of heme concentration) is: Luz15, 38 μM; PsmG, 44 μM; KerI, 4 μM. The reaction temperature is 30°C and the reaction time is 60 minutes. After the reaction is completed, 300 μl of methanol is added for quenching, and the reaction is centrifuged at 12000 rpm for 5 minutes. The supernatant is analyzed by high performance liquid chromatography (mobile phase ratio: 0-25 min, acetonitrile: water = 5:95-95:5. The mobile phase contains 0.05% formic acid, the chromatographic column is EC-C18 analytical column, the detector is a UV detector, the wavelength is 254 nm, and the flow rate is 0.6 mL / min).

[0078] like Figure 3 As shown, by comparing with the negative control and the L-5-hydroxytryptophan standard, it was demonstrated that these enzymes can catalyze the production of L-5-hydroxytryptophan from L-tryptophan and do not require the participation of pterin cofactor.

[0079] 4. Sequence Analysis of Bacterial Tryptophan 5-Hydroxylase

[0080] The Clustal Omega tool was used to align the sequences of four enzymes, Luz15, PsmG, KerI, and tryptophan dioxygenase (XcTDO, NCBI accession number WP_011035685.1), and it was found that the C-terminal domains of Luz15, PsmG, and KerI contain a tryptophan dioxygenase-like domain, which has homology with XcTDO, such as Figure 4 As shown, Luz15, PsmG, and KerI have a conserved histidine residue, which corresponds to the histidine residue at position 240 where XcTDO binds heme (references Forouhar, F., Anderson, JL, Mowat, CG, Vorobiev, SM, Hussain, A., Abashidze, M., Bruckmann, C., Thackray, SJ, Seetharaman, J., Tucker, T., Xiao, R., Ma, LC, Zhao, L., Acton, TB, Montelione, GT, Chapman, SK, & Tong, L. (2007). Molecular insights into substrate recognition and catalysis by tryptophan2,3-dioxygenase. Proceedings of the National Academy of Sciences of the United States of America, 104(2), 473–478.), suggesting that this conserved histidine residue in Luz15, PsmG, and KerI binds heme.

[0081] In vitro biochemical reaction results showed that these three enzymes did not have tryptophan dioxygenase activity.

[0082] 5. Site-directed mutagenesis of bacterial tryptophan 5-hydroxylase

[0083] 1. Using the pET22b-luz15 plasmid obtained in the first step as a template, the Luz15 expression vector containing the H375A mutation was amplified by polymerase chain reaction, wherein the upstream primer was H375AF (5'→3': acgcacggcctgggggatcaccctcaagatcatc) and the downstream primer was H375AR (5'→3': tgatcccccaggccgtgcgtttcatcgcgtgc). The amplified product was digested with DpnI endonuclease and then introduced into the competent state of Escherichia coli strain Transetta (DE3) by transformation. After sequencing and identification, the protein was purified according to the second step. SDS gel electrophoresis was performed as shown in Figure 5 And scan the spectrum from 350nm to 700nm.

[0084] like Figure 6 As shown, when the protein concentrations of H375A variant protein and wild-type protein were both 5 μM, H375A variant protein had only a weak absorption peak near 420 nm, which was very different from the wild-type protein, suggesting that this conserved histidine residue formed a coordination bond with the heme cofactor.

[0085] 2. The in vitro biochemical reaction system is 100 μl, including 10 μl 40 mM hydrogen peroxide, 20 μl 15 mM L-tryptophan (dissolved in 50 mM HEPES buffer) and 70 μl tryptophan-5-hydroxylase (wild-type protein of Luz15 or H375A variant protein, protein concentration is 10 μM). The reaction temperature is 30°C and the reaction time is 60 minutes. After the reaction is completed, 300 μl of methanol is added for quenching, and the reaction is centrifuged at 12000 rpm for 5 min. The supernatant is analyzed by high performance liquid chromatography (mobile phase ratio: 0-25 min, acetonitrile: water = 5:95-95:5. The mobile phase contains 0.05% formic acid, the chromatographic column is EC-C18 analytical column, the detector is a UV detector, the wavelength is 254 nm, and the flow rate is 0.6 mL / min), as shown in FIG. Figure 7 As shown, it is proved that histidine at position 375 is an essential amino acid for catalytic function.

[0086] Example 2

[0087] 1. Construction of mutant strain DS-1. The construction steps are as follows:

[0088] 1. Based on the Escherichia coli-Streptomyces shuttle plasmid vector pSET152 (NCBI sequence number AJ414670.1), a strategy for knocking out the kynA gene by homologous double exchange method was designed.

[0089] pSET152 was digested with HindIII and then self-ligated with T4 ligase to obtain pSET152H vector.

[0090] In the tryptophan degradation gene cluster of Streptomyces albus J1074, kynA is a gene encoding tryptophan dioxygenase, and its nucleotide sequence is shown in SEQ ID NO.7 (the portion from 3190336 to 3191229 in the sequence of NCBI accession number NZ_DS999645.1).

[0091] Using the genomic DNA of Streptomyces albus J1074 as a template, two homologous arms (2.1 kb and 2.0 kb in length, respectively) upstream and downstream of the target knockout region were amplified by polymerase chain reaction.

[0092] The 2.1 kb left homology arm was amplified using primers ALF (5'→3': atgtcgtcatcaacaagcttatggccattcacgagaacctgc) and ALR (5'→3': ggtaccggcgaagtcgagattc), and the 2.0 kb right homology arm was amplified using primers ARF (5'→3': atctcgacttcgccggtaccaagacggtcttccccgagctg) and ARR (5'→3': tatgacatgattacgaattcgcgatgtcgtcgaaggtgtcg).

[0093] The two homology arms were simultaneously inserted into pSET152 using a seamless cloning kit (ClonExpress MultiS OneStep Cloning Kit from Nanjing Novozyme Biotechnology Co., Ltd.) to obtain the kynA knockout vector pSET152H-ΔkynA. After sequencing verification, it was introduced into the competent state of Escherichia coli strain ET12567 / pUZ8002 by transformation. After picking a single colony and inoculating it into a test tube for 12 hours, it was transferred to LB at a ratio of 1:50 at 37°C and 180rpm for 5 hours, and the Escherichia coli cells were collected by centrifugation at 5000rpm for 8min, and washed three times with LB, and the cells were collected using the same centrifugation conditions each time.

[0094] At the same time, take 50 microliters of the spore suspension of wild-type white Streptomyces, centrifuge at 5000rpm for 5min, remove the upper glycerol, then add 800 microliters of 2×YT medium to resuspend, put it in a 45℃ water bath for heat shock for 5 minutes, and then use it to resuspend the washed Escherichia coli. After mixing the two bacteria, spread them on MS medium (2% D-mannitol, 2% soybean powder, 2% agar powder) plates containing 10mM magnesium chloride and culture them at 30℃. After 18 hours, cover them with apramycin and nalidixic acid at a final concentration of 50mg / L. After 3 days, pick the conjugant and make it produce spores on the MS plate containing apramycin. Then collect the spores and continuously passage them on the MS plate without antibiotics until a mutant strain is obtained. After three passages, streak separation is performed at each passage to obtain a single colony. Single colonies were picked and cultured on MS plates containing apramycin and MS plates without antibiotics. Single colonies that grew on plates without antibiotics but not on apramycin plates were picked for PCR identification. The identification primers were AF (5'→3': cgtccacagctgtggacagg) and ULR (5'→3': gtcacgctcatgtgctgattcc), respectively.

[0095] like Figure 8 As shown, the starting strain will produce a target band of 1.3 kb, while the mutant strain will produce an expected band of 0.5 kb. Through screening, a ΔkynA mutant strain with a kynA deletion mutation was obtained.

[0096] 2. Based on the Escherichia coli-Streptomyces shuttle plasmid vector pSET152H (obtained in step 1), a strategy for ant gene knockout by homologous double exchange method was designed.

[0097] In the antimycin biosynthetic gene cluster ant of Streptomyces albus J1074, antN is a gene encoding tryptophan dioxygenase. The nucleotide sequence of the gene cluster ant is shown in SEQ ID NO.8 (the portion from 80271 to 109997 in the sequence of NCBI accession number NZ_DS999645.1).

[0098] Using the genomic DNA of Streptomyces albus J1074 as a template, two homologous arms (2.7 kb and 2.4 kb in length, respectively) upstream and downstream of the target knockout region were amplified by polymerase chain reaction.

[0099] The 2.7 kb left homology arm was amplified using primers antLF (5'→3': atgtcgtcatcaacaagcttggagacctccgtcatcgtcacctc) and antLR (5'→3': acacgcggacgcgtgcctttc), and the 2.4 kb right homology arm was amplified using primers antRF (5'→3': aaaggcacgcgtccgcgtgtcactacacgctcatcgagccag) and antRR (5'→3': tatgacatgattacgaattcacggtggagcagtcgacatcgtc).

[0100] The two homology arms were simultaneously inserted into pSET152 using a seamless cloning kit (ClonExpress MultiS OneStep Cloning Kit from Nanjing Novozyme Biotechnology Co., Ltd.) to obtain the knockout vector pSET152H-△ant of the antimycin biosynthesis gene cluster ant. After sequencing verification, it was introduced into the competent state of Escherichia coli strain ET12567 / pUZ8002 by transformation. After 12 hours of picking a single colony into a test tube, it was transferred to LB at a ratio of 1:50 at 37°C and 180rpm for 5 hours, and the Escherichia coli cells were collected by centrifugation at 5000rpm for 8min, and washed three times with LB, and the cells were collected using the same centrifugation conditions each time.

[0101] At the same time, take 50 microliters of the spore suspension of the white Streptomyces ΔkynA strain with kynA deletion mutation, centrifuge at 5000rpm for 5min, remove the upper glycerol, then add 800 microliters of 2×YT medium to resuspend, put it in a 45℃ water bath for heat shock for 5 minutes, and then use it to resuspend the washed Escherichia coli. After mixing the two bacteria, spread them on MS (2% D-mannitol, 2% soybean powder, 2% agar powder) plates containing 10mM magnesium chloride and culture at 30℃. After 18 hours, cover with apramycin and nalidixic acid at a final concentration of 50mg / L. After 3 days, pick the conjugant and make it produce spores on the MS plate containing apramycin. Then collect the spores and continuously subculture on the MS plate without antibiotics until the mutant strain is obtained. After subculture 3 times, streak separation is performed at each subculture to obtain a single colony. Single colonies were picked and cultured on MS plates containing apramycin and MS plates without antibiotics, and single colonies that grew on plates without antibiotics but not on apramycin plates were picked for PCR identification. The identification primers were 00250F (5'→3': cactcactctgctgtgtctcg) and OR (5'→3': cacaggtgctgttcgacgtgg), respectively.

[0102] like Fig. 9As shown, the starting strain does not produce a band, while the mutant strain produces the expected band of 0.7 kb. Through screening, the ΔkynAΔant strain with ant deletion mutation was obtained.

[0103] 3. Based on the Escherichia coli-Streptomyces shuttle plasmid vector pIJ8660-ermE*p-MCS (reference Du, Y.-L., Dalisay, DS, Andersen, RJ&Ryan, KS Chem. Biol. 20, 1002–1011 (2013).), the heterologous expression of bacterial tryptophan-5-hydroxylase gene luz15 (nucleotide sequence as shown in SEQ ID NO.2), methyltransferase gene luz16 (nucleotide sequence as shown in SEQ ID NO.9) and decarboxylase gene SapsmH (nucleotide sequence as shown in SEQ ID NO.10) was performed by genome integration.

[0104] Using the genomic DNA of Actinomycetes luzonense DSM43766 as a template, the fragment luz15-16 (2281 bp in length, the nucleotide sequence is the 36571 to 38851 part of the sequence of NCBI accession number OM250071.1, of which the 37598 to 38851 part is luz15, and the 36571 to 37605 part is luz16) containing the tryptophan 5-hydroxylase gene luz15 and the methyltransferase gene luz16 was amplified by polymerase chain reaction. The amplification primers were 15F (5'→3': agcagcCATatgcgagccacgacgaacgtcg) and 16R (5'→3': agcagcTCTAGAGtcaattgccagcgccattgtcctg).

[0105] The luz15-16 fragment was inserted into pIJ8660-ermE*p-MCS using the two restriction sites of NdeI and XbaI to obtain pIJ8660-ermE*p-luz15-16. After sequencing verification, pIJ8660-ermE*p-luz15-16 was linearized by restriction digestion with XbaI.

[0106] Using the decarboxylase gene SapsmH (length 1470 bp, nucleotide sequence as shown in SEQ ID NO.10) synthesized by Beijing Qingke Biotechnology Co., Ltd. as a template, SapsmH was amplified by polymerase chain reaction, and then SapsmH was connected with linearized pIJ8660-ermE*p-luz15-16 using a seamless cloning kit to obtain a heterologous expression vector pIJ8660-ermE*p-luz15-16-SapsmH of luz15-16;

[0107] After sequencing verification, the cells were transformed into competent E. coli strain ET12567 / pUZ8002. A single colony was picked and inoculated into a test tube culture medium for 12 hours, and then transferred to LB culture medium at a ratio of 1:50 at 37°C and 180 rpm for 5 hours. The E. coli cells were collected by centrifugation at 5000 rpm for 8 minutes, and washed three times with LB, with the same centrifugation conditions used each time to collect the cells.

[0108] At the same time, 500 μL of spore suspension of the white Streptomyces ΔkynAΔant strain with kynA and ant deletion mutations was taken, centrifuged at 5000 rpm for 5 min, and the upper glycerol layer was removed. Then, 800 μL of 2×YT medium was added for resuspending, and heat-shocked in a 45°C water bath for 5 minutes. Then, the washed Escherichia coli was resuspended, and the two bacteria were mixed and spread on MS (2% D-mannitol, 2% soybean powder, 2% agar powder) plates containing 10 mM magnesium chloride and cultured at 30°C. After 18 hours, the plates were covered with apramycin at a final concentration of 50 mg / L and nalidixic acid at 25 mg / L. After 3 days, the conjugates were picked and plated on MS plates containing apramycin to produce spores, and PCR identification was performed using the following primers: HF (5'→3': tggcgctggcaattgacTCTAGAAAAGGAGGCGGACATatgaag) and HMR (5'→3': gtcggtggccacctcgcacatg).

[0109] like Fig.10 As shown, the heterologous expression strain produced the expected band of 0.7 kb, thus confirming that the DS-1 mutant was obtained.

[0110] 2. Fermentation of DS-1 mutant and identification of melatonin

[0111] The spores of the DS-1 mutant strain were collected and spread on a YEMET liquid medium (0.5% peptone, 0.3% yeast powder, 0.3% malt extract, 1% glucose and 0.1% L-tryptophan). After culturing at 30°C for 7 days, the culture was taken and the protein was precipitated with 4 volumes of methanol, and the mycelium and denatured protein were removed by centrifugation to obtain a supernatant containing melatonin, which was analyzed by high performance liquid chromatography. The mobile phase ratio: 0-25min, acetonitrile: water = 5:95-95:5. The mobile phase contained 0.05% formic acid, the chromatographic column was an EC-C18 analytical column, the detector was an ultraviolet detector, the wavelength was 254nm, the flow rate was 0.6mL / min, and the retention time of melatonin was 8 minutes.

[0112] By comparing with the standard of melatonin, e.g. Fig.11 As shown, it was proved that the mutant engineered strain DS-1 can synthesize melatonin with a production of 238±29 mg / L.

[0113] It should be pointed out that for ordinary people in this field, without departing from the principle of the present invention, several modifications and improvements can be made, such as using other actinomycete hosts such as Streptomyces coelicolor, Streptomyces venezuelae, Corynebacterium glutamicum, etc., fermenting with different culture media, using CRISPR / Cas9 and other technologies to achieve deletion mutations of kynA or antimycin biosynthetic gene clusters, using transposon mutagenesis, insertion mutations, point mutations and other principles to inactivate kynA or antimycin biosynthetic gene clusters, using transposase or Streptomyces replicative plasmids to introduce luz15, luz16 and SaPsmH into Streptomyces albus, and replacing luz15 with homologous genes of luz15 (amino acid sequences with more than 50% homology). These should also be regarded as the protection scope of the present invention.

Claims

1. Use of bacterial tryptophan-5-hydroxylase in catalyzing the preparation of 5-hydroxytryptophan from tryptophan, characterized in that: The amino acid sequence of the bacterial amino acid-5-hydroxylase is shown in SEQ ID NO.1, SEQ ID NO.3 or SEQ ID NO.5, and the sequence contains a conserved histidine residue, which corresponds to position 375 of the sequence shown in SEQ ID NO.1, position 369 of the sequence shown in SEQ ID NO.3, and position 363 of the sequence shown in SEQ ID NO.

5.

2. The use according to claim 1, characterized in that The nucleotide sequence of the bacterial amino acid-5-hydroxylase encoding gene is shown in SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.

6.

3. The use according to claim 2, characterized in that The application includes: using wet bacteria obtained after fermentation and culture of engineered bacteria containing bacterial amino acid-5-hydroxylase encoding genes or enzymes extracted after wet bacteria crushing as biocatalysts, using L-tryptophan as a substrate, hydrogen peroxide as an oxidant, and a buffer solution with a pH of 6 to 9 as a reaction medium, reacting at 30 to 40° C., and separating and purifying the reaction solution after the reaction is completed to obtain L-5-hydroxytryptophan.

4. Use of bacterial tryptophan-5-hydroxylase in the preparation of melatonin, characterized in that: The application includes: using Streptomyces albus J1074 as the starting bacterium, using gene inactivation technology to inactivate the tryptophan dioxygenase gene kynA and antimycin biosynthetic gene cluster ant Inactivation, Streptomyces albus Δ kynA Δ ant strain; then in Δ kynA Δ ant The coding gene of the bacterial tryptophan 5-hydroxylase and the methyltransferase gene are introduced into the strain luz16 and decarboxylase genes SapM , the decarboxylase gene SapM The nucleotide sequence of is shown in SEQ ID NO.10, and an engineering strain of Streptomyces albus that efficiently produces melatonin is obtained; then the engineering strain of Streptomyces albus is inoculated into a fermentation medium containing a tryptophan substrate for fermentation and culture, and the fermentation product is separated and purified to obtain melatonin; The amino acid sequence of the bacterial amino acid-5-hydroxylase is shown in SEQ ID NO.1, SEQ ID NO.3 or SEQ ID NO.5, and the sequence contains a conserved histidine residue, which corresponds to position 375 of the sequence shown in SEQ ID NO.1, position 369 of the sequence shown in SEQ ID NO.3, and position 363 of the sequence shown in SEQ ID NO.

5.

5. An engineered strain of Streptomyces albus, characterized in that: The strain construction method comprises the following steps: using Streptomyces albus J1074 as the starting strain, inactivating the tryptophan dioxygenase gene by gene inactivation technology, kynA and antimycin biosynthetic gene cluster ant Inactivation, Streptomyces albus Δ kynA Δ ant strain; then in Δ kynA Δ ant The coding gene of bacterial tryptophan 5-hydroxylase and methyltransferase gene were introduced into the strain luz16 and decarboxylase genes SapM , obtaining an engineered strain of Streptomyces albus that efficiently produces melatonin; The tryptophan dioxygenase gene kynA The nucleotide sequence is shown in SEQ ID NO.7; Antimycin biosynthetic gene cluster ant The nucleotide sequence is shown in SEQ ID NO.8; the methyltransferase gene luz16 The nucleotide sequence is shown in SEQ ID NO.9; the decarboxylase gene SapM The nucleotide sequence is shown in SEQ ID NO.10; the amino acid sequence of the bacterial tryptophan-5-hydroxylase is shown in SEQ ID NO.1, SEQ ID NO.3 or SEQ ID NO.

5.

6. A method for preparing melatonin, characterized in that: The following steps are involved: The engineered strain of Streptomyces albus described in claim 5 is inoculated into a fermentation medium containing a tryptophan substrate, fermented and cultured, and the fermentation product is separated and purified to obtain melatonin.

7. The preparation method according to claim 6, characterized in that: The fermentation medium comprises, per liter of medium, 3-6 g of peptone, 2-4 g of yeast powder, 2-4 g of malt extract, 5-20 g of glucose, 0.5-2 g of tryptophan, and the balance is water.

8. The preparation method according to claim 6, characterized in that: The fermentation culture conditions are 27~37℃ for 7~9 days.

9. The preparation method according to claim 6, characterized in that: After the fermentation is completed, the fermentation product is diluted with methanol, and the mycelium and precipitated protein are removed by centrifugation to obtain a supernatant containing melatonin, which is then separated and purified to obtain melatonin.

Images