New lactobacillus reuteri strains and uses thereof

Abstract

The present invention relates to a new Lactobacillus reuteri strain DS0384 and uses thereof.

Description

Technical Field

[0001] This invention relates to a novel strain of Lactobacillus reuteri and its uses. Background Technology

[0002] The intestine, composed of the small and large intestines, is a crucial organ for food digestion, playing a key role in the secretion of various digestive enzymes. It also plays a vital role in the absorption of digested nutrients, water, and the secretion of hormones. Food ingested through the mouth for digestion is absorbed into the body as it travels through the intestines. The villi of the small intestine absorb nutrients containing amino acids and glucose, while the large intestine absorbs most of the water. The development of the intestine's structure, such as its length and surface area—the passageway through which food passes and the cross-section that provides contact with digested food—as well as the villi, allows for normal digestion and absorption.

[0003] Besides its digestive and absorptive functions, the gut is an organ closely related to the microbiome, and approximately 95% of the microorganisms in the human body reside there. Furthermore, the number of microorganisms in the human gut is more than 10 times the number of cells in the human body. Research indicates that the types of gut microbiota, the quantity and proportion of each type, have significant impacts on human health and physical characteristics, and interest in the correlation between gut microbiota and human diseases and health is increasing.

[0004] Therefore, if the intestine is short, has a small cross-sectional area, or its detailed structure is underdeveloped, digestion and absorption may be reduced compared to normal individuals due to developmental or maturation problems, which adversely affects overall health. In particular, slow intestinal development in fetuses, newborns, infants, and other individuals whose development and growth are not yet complete also negatively impacts the development of organs outside the intestine or overall growth, thus increasing the need for improvement. Even in the absence of intestinal developmental disorders, research into methods that can aid in intestinal development and maturation in developing and growing individuals is of paramount importance.

[0005] On the other hand, *Lactobacillus reuteri* is a lactic acid bacterium that inhabits the gut and is known to have multiple functions. Among published patent literature, there are reports of *Lactobacillus reuteri* strains having the effect of preventing and improving skin aging (Korean Patent Publication No. 10-2020-0028627), reports of immune-enhancing effects (Korean Patent Publication No. 10-2018-0053499), and reports of strains enhancing the development of "nervous system" cells such as intestinal neurons (Korean Patent Publication No. 10-2014-0131501). However, no existing patents have disclosed the properties of *Lactobacillus reuteri* strains that promote intestinal development and maturation. In particular, strains that are particularly superior to other strains in promoting the expression of genes and proteins specifically expressed in the mature gut have not been studied, or their applicability in the human gut has not been investigated. Therefore, there is a need to develop novel *Lactobacillus reuteri* strains with excellent intestinal development and maturation effects and properties suitable for human intestinal models. Summary of the Invention

[0006] [Technical Issues]

[0007] The purpose of this invention is to provide a novel lactic acid bacteria strain that is superior to other microbial strains in promoting intestinal development or intestinal maturation, and has the property of showing the ability to protect and restore damaged intestines.

[0008] Another object of the present invention is to provide a pre-fermentation feed composition that uses the novel lactic acid bacteria strains described above for the production of fermented foods or for the production of strain culture media.

[0009] Another object of the present invention is to provide a composition that can be used for the purpose of promoting intestinal development or maturation or restoring intestinal damage using the novel lactic acid bacteria strains described above.

[0010] Another object of the present invention is to provide a pharmaceutical composition that can be used to prevent or treat intestinal developmental disorders or inflammatory bowel disease using the novel lactic acid bacteria strains described above.

[0011] Another object of the present invention is to provide a feed composition that can be used to prevent or improve intestinal developmental disorders or inflammatory bowel disease using the novel lactobacillus strains described above.

[0012] [Technical Solution]

[0013] To achieve the above objectives, one aspect of the present invention provides Lactobacillus reuteri DS0384 strain.

[0014] To achieve the above objectives, another aspect of the present invention provides a pre-fermentation feed composition comprising Lactobacillus reuteri DS0384 strain.

[0015] To achieve the above objectives, another aspect of the present invention provides a composition for promoting intestinal development, intestinal maturation or intestinal injury recovery, comprising Lactobacillus reuteri DS0384 strain or a culture medium thereof.

[0016] To achieve the above objectives, another aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of intestinal developmental disorders or inflammatory bowel disease, comprising Lactobacillus reuteri DS0384 strain or a culture medium thereof.

[0017] To achieve the above objectives, another aspect of the present invention provides a feed composition for preventing or improving intestinal developmental disorders or inflammatory bowel disease, comprising Lactobacillus reuteri DS0384 strain or a culture medium thereof.

[0018] [Beneficial Effects]

[0019] The novel *Lactobacillus reuteri* strain DS0384 and its culture medium of the present invention have the effect of increasing the size of intestinal organoids differentiated from human intestinal stem cells, increasing budding structures, and increasing the expression of intestinal maturation marker genes and proteins.

[0020] Furthermore, even when human intestinal stem cells isolated from intestinal organoids are treated with Lactobacillus reuteri DS0384 strain and its culture medium, it also promotes the growth of intestinal stem cells.

[0021] Furthermore, when intestinal organoids were treated simultaneously with Lactobacillus reuteri DS0384 strain and inflammatory cytokines, the surface area of ​​the damaged intestine could be increased, and the expression levels of intestinal wall function and proliferation-related marker proteins could be increased. Therefore, it was also excellent in promoting and improving the recovery of intestinal injury.

[0022] Furthermore, even when mice were orally administered the Lactobacillus reuteri DS0384 strain and its culture medium of the present invention, intestinal development was promoted, for example, the length and area of ​​villi and the depth of crypts in the small intestine increased, the mucosa / submucosa ratio of the large intestine increased, and the expression of marker genes and proteins of intestinal maturity increased.

[0023] In particular, the *Lactobacillus reuteri* strain DS0384 of the present invention exhibits the aforementioned effects more significantly than other lactic acid bacteria belonging to other species and other strains classified as *Lactobacillus reuteri*, and possesses the characteristic of increasing the expression of intestinal maturation marker genes, which is not found in other *Lactobacillus reuteri* strains. Therefore, it corresponds to a novel strain with characteristics and effects not found in conventional strains. Furthermore, it has been confirmed that treatment with strain DS0384 has effects not only observed in non-human animals, but also in intestinal organoids prepared from human intestinal models and human intestinal stem cells. Therefore, it can be recently confirmed that it also shows excellent effects in promoting intestinal development and maturation, as well as promoting and improving the recovery of intestinal injury in humans.

[0024] Therefore, the Lactobacillus reuteri DS0384 strain of the present invention can be used for the purpose of promoting intestinal development or intestinal maturation or as a food, or usefully used as a medicine and feed for the prevention, treatment and improvement of intestinal development disorders, and is therefore very useful in related industries. Attached Figure Description

[0025] Figure 1A The results of microscopic examination of intestinal organoid morphological changes after treatment with cultures of *Bifidobacterium longum*, *Lactobacillus gasseri*, *Lactobacillus curvatureus*, *Lactobacillus rhamnosus*, and *Lactobacillus reuteri* DS0384 strains of the present invention are shown (top data; bright field, BF). The results of comparison of the expression of intestinal maturation marker proteins by immunofluorescence staining are also shown (bottom data). On the scale bar, black indicates 500 µm and white indicates 100 µm. Figure 1B The diagram shows a comparison of the size changes of intestinal organoids (left panel) and the number of budding structures (right panel) to demonstrate the morphological changes of intestinal organoids after treatment with cultures of *Bifidobacterium longum*, *Lactobacillus gasseri*, *Lactobacillus curvaturei*, *Lactobacillus rhamnosus*, and *Lactobacillus reuteri* DS0384 strains of this invention. (*: p < 0.05 according to t-test, control group vs. experimental group; **: p < 0.01 according to t-test, control group vs. experimental group; ***: p < 0.001 according to t-test, control group vs. experimental group) Figure 1C The graph shows a comparison of the expression levels of intestinal maturation marker genes (CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1, and MUC13) in intestinal organs treated with the *Lactobacillus reuteri* DS0384 strain of this invention, confirmed by qRT-PCR, with the results of the control group. (*: p < 0.05 according to t-test, control group vs. experimental group; **: p < 0.01 according to t-test, control group vs. experimental group)

[0026] Figure 2AThe results of microscopic examination of intestinal organoid morphological changes after treatment with cultures of *Lactobacillus reuteri* strains DS0191, DS0195, DS0333, and DS0354, and *Lactobacillus reuteri* strain DS0384 of this invention are shown (top data; bright field, BF), and the results of comparison of the expression of intestinal maturation marker proteins by immunofluorescence staining are shown (bottom data). On the scale bar, black indicates 500 µm and white indicates 100 µm. Figure 2B A graph comparing the expression levels of intestinal maturation marker genes (CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1, and MUC13) is shown, confirmed by qRT-PCR. (*: p < 0.05 based on t-test, control group vs. experimental group; **: p < 0.01 based on t-test, control group vs. experimental group)

[0027] Figure 3A The results of microscopic examination of morphological changes in intestinal organoids after treatment with cultures of *Lactobacillus reuteri* strains DSP007, DS0337, and KCTC3594, and the *Lactobacillus reuteri* strain DS0384 of this invention, are shown (top data; bright field, BF). The results of comparison of the expression of intestinal maturation marker proteins by immunofluorescence staining are also shown (bottom data). On the scale bar, black indicates 500 µm and white indicates 100 µm. Figure 3B The graph shows a comparison of the expression levels of intestinal maturation marker genes (CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1, and MUC13), confirmed by qRT-PCR. (*: p < 0.05 based on t-test, control group vs. experimental group; **: p < 0.01 based on t-test, control group vs. experimental group; ***: p < 0.001 based on t-test, control group vs. experimental group)

[0028] Figure 4A The results show the morphological changes in intestinal organoids after treatment with cultures obtained by culturing Lactobacillus reuteri strains DS0384 and DSP007 for 6, 12, 18, and 24 hours, respectively. Scale bar indicates 500 µm. Figure 4B A comparative plot showing the expression patterns of intestinal maturation marker genes in intestinal organoids treated with cultures of *Lactobacillus reuteri* strains obtained at each time period, confirmed by qRT-PCR. (*: p < 0.05 according to t-test, control group vs. experimental group; **: p < 0.01 according to t-test, control group vs. experimental group)

[0029] Figure 5AThe results show the morphological changes observed in intestinal stem cells isolated from intestinal organoids after treatment with cultures of *Lactobacillus reuteri* strains DS0384 and KCTC3594. On the scale bar, black indicates 1 mm and white indicates 200 µm. Figure 5B The analysis shows the relative size of intestinal stem cell colony surface areas treated with bacterial culture medium using the ImageJ program. (n ≥ 5 per group; *: p < 0.05 according to t-test, control group vs. experimental group; **: p < 0.01 according to t-test, control group vs. experimental group)

[0030] Figure 6A This is a graph demonstrating the morphological changes of intestinal organoids in a control group treated with the inflammatory cytokines IFNγ / TNFα for 3 days and in a group treated with the inflammatory cytokines and Lactobacillus reuteri DS0384 strain culture medium (bright field, BF). Scale bar indicates 1 mm. Figure 6B This is a graph illustrating the morphological changes of intestinal organoids stained with hematoxylin and eosin in a control group treated with PBS, a control group treated with only inflammatory cytokines (IFNγ / TNFα), and a group treated with inflammatory cytokines and culture medium of Lactobacillus reuteri DS0384. Scale bars are in 200µm. Figure 6C This is a graph comparing the changes in surface area of ​​intestinal organoids between the control group and the group treated with Lactobacillus reuteri DS0384 strain culture. (n ≥ 10 per group; *: p < 0.05 according to t-test, control group vs. experimental group)

[0031] Figure 7 The graph shows the expression of the intestinal wall functional marker ZO-1 protein and the proliferation marker Ki67 protein in intestinal organoids, as confirmed by immunofluorescence staining, in a control group treated with PBS (control), a control group treated with the inflammatory cytokine IFNγ / TNFα for 3 days (IFNγ / TNFα), and a group treated with the inflammatory cytokine and Lactobacillus reuteri DS0384 culture medium. On the scale bar, white represents 125 µm and yellow represents 500 µm. The lower graph shows a comparison of the expression levels of ZO-1 and Ki67 as measured above. (n ≥ 5 per group; *: p < 0.05 according to t-test, control group vs. experimental group; ***: p < 0.001 according to t-test, control group vs. experimental group)

[0032] Figure 8The results show the intestinal tissues of mice orally administered via hematoxylin and eosin staining, using histological morphology analysis to confirm the presence of bacteria in a culture medium containing the present invention’s Lactobacillus reuteri DS0384 strain (“strain” in the figure) and a culture medium from which bacteria were removed by centrifugation (“culture medium” in the figure), and the intestinal tissues of mice orally administered via PBS with a culture medium of Lactobacillus reuteri KCTC3594.

[0033] Figure 9 It is displayed according to the above Figure 8 The results show a graph comparing the changes in villus length and area, and crypt depth in the jejunum of the small intestine, with changes in crypt depth and mucosa / submucosa ratio in the large intestine (colon). (n>7 for each group; *: p<0.05 according to t-test, control group vs. experimental group; **: p<0.01 according to t-test, control group vs. experimental group; ***: p<0.001 according to t-test, control group vs. experimental group) Detailed Implementation

[0034] The present invention will now be described in detail.

[0035] In this invention, the term "culture medium" refers to the culture medium itself obtained by culturing the strain, or the culture supernatant obtained by removing the strain therefrom, and its filtrate, concentrate or dry matter product, and may be used interchangeably with "culture supernatant", "conditioned culture medium" or "conditioned medium".

[0036] In this invention, the term "prevention" refers to any action that suppresses or delays the onset of a corresponding disease or negative condition by administering the composition to a subject.

[0037] In this invention, the term "treatment" can refer to any action that redirects the symptoms of a corresponding disease or negative condition that has already occurred by administering a composition to a subject.

[0038] In this invention, the term “improvement” refers to any action that includes reversing, suppressing, or delaying symptoms, and may be used interchangeably with prevention or treatment.

[0039] 1. A novel Lactobacillus reuteri strain and a pre-fermentation feed composition including the strain.

[0040] One aspect of the present invention provides a novel strain of Lactobacillus reuteri.

[0041] The Lactobacillus reuteri mentioned is Lactobacillus reuteri DS0384, and is a strain deposited under accession number KCTC 14164BP. As of April 6, 2020, Lactobacillus reuteri DS0384 strain was deposited at the Korean Center for Type Culture Collection, Korea Institute of Biotechnology, under accession number KCTC 14164BP.

[0042] Lactobacillus reuteri DS0384 is a strain capable of surviving in the intestines of humans or non-human animals, and may have various effects on the health of humans or non-human animals while surviving in the intestines. Lactobacillus genus microorganisms are generally Gram-positive anaerobic bacteria that can ferment in the intestines to produce lactic acid, acetic acid, etc., and are known to have effects such as inhibiting the growth of harmful bacteria or enhancing immunity, promoting digestion, and improving intestinal diseases in human or non-human inhabitants. Lactobacillus reuteri DS0384 is a microorganism classified as belonging to the genus Lactobacillus and can exhibit some of the characteristics of Lactobacillus genus microorganisms as described above. Lactobacillus reuteri DS0384 can be a safe microorganism because it does not show toxicity or cause disease in humans or non-human animals, and can function as a probiotic because it can act as a beneficial bacterium in the intestines to help the health of humans or non-human animals.

[0043] Lactobacillus reuteri DS0384 strain may possess characteristics that promote intestinal development or maturation. Specifically, Lactobacillus reuteri DS0384 strain may have activity that promotes the maturation of the small or large intestine to a more mature state, or it may have activity that promotes the maturation of the small or large intestine to an immature state. For example, the strain may increase the length and area of ​​villi, or increase the depth of crypts in the small intestine, or increase the mucosa / submucosa ratio in the large intestine. Furthermore, the strain may increase the expression of one or more genes selected from the group consisting of CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1, and MUC13.

[0044] In one specific embodiment of the present invention, treatment of intestinal organoids prepared from an in vitro human intestinal model with a culture medium containing metabolites produced by *Lactobacillus reuteri* strain DS0384 demonstrated promotion of maturation and development, and increased expression levels of maturation-related marker genes and proteins. Furthermore, compared to the control group, treatment with *Lactobacillus reuteri* strain DS0384 culture medium resulted in an increase in the surface area of ​​intestinal stem cell colonies, thus confirming the presence of activity promoting intestinal stem cell growth and maturation. The intestinal organoids were prepared by differentiating human pluripotent stem cells and embody a human in vitro intestinal model, and the intestinal stem cells isolated from the intestinal organoids were also human intestinal stem cells. Therefore, it can be newly confirmed that *Lactobacillus reuteri* is a strain with excellent activity in promoting intestinal development or maturation in humans and non-human animals, and thus, it can be confirmed that *Lactobacillus reuteri* is a target lactic acid bacteria strain that can be effectively used to promote human intestinal development or maturation.

[0045] In another specific embodiment of the invention, it was demonstrated that even when mice were orally administered a culture medium containing *Lactobacillus reuteri* strain DS0384 or a culture medium containing metabolites produced by this strain, the development of the small and large intestines was promoted, and the expression of intestinal maturation marker genes was increased. Specifically, *Lactobacillus reuteri* strain DS0384 was shown to promote intestinal maturation in a manner not observed in other types of lactic acid bacteria, and exhibited significantly higher expression levels of genes and proteins associated with intestinal maturation, or increased expression of maturation-related marker genes, which was not observed in groups treated with cultures of other microorganisms, even when compared to treatment with cultures of seven types of microorganisms classified as *Lactobacillus reuteri*. Therefore, *Lactobacillus reuteri* strain DS0384 is a novel strain that exhibits effects promoting intestinal maturation and development at levels unpredictable or unattainable in conventionally known lactic acid bacteria or *Lactobacillus reuteri* microorganisms. Thus, the strain of the present invention can be effectively used to promote intestinal development or maturation, or to prevent, treat, or improve intestinal development disorders.

[0046] The *Lactobacillus reuteri* strain DS0384 may possess properties that promote the recovery from intestinal injury. Intestinal injury can be caused, for example, by an inflammatory response within the intestine, but the causes are not limited to this. If the function or structure of the intestine is impaired compared to its normal state, the *Lactobacillus reuteri* strain of the present invention can promote its recovery.

[0047] Recovery from intestinal injury can occur by increasing the surface area of ​​the damaged intestine to restore it to its original state, or by protecting the intestine from further damage. Furthermore, recovery can also involve increasing the expression of gene or protein markers associated with intestinal wall function or proliferation in the damaged intestine. Intestinal wall function markers may include, but are not limited to, ZO-1 protein, and intestinal wall proliferation markers may include, but are not limited to, Ki67 protein.

[0048] In one specific embodiment of the present invention, when intestinal organoids were simultaneously treated with a culture medium containing metabolites and inflammatory cytokines produced by Lactobacillus reuteri DS0384 strain, an increase in surface area and recovery of damaged surface area were demonstrated. Furthermore, an increase in the expression levels of ZO-1 and Ki67 proteins was also demonstrated. Therefore, it can be confirmed that Lactobacillus reuteri DS0384 strain has the activity of preventing intestinal damage and promoting the recovery of damaged intestines.

[0049] Another aspect of the present invention provides a pre-fermentation feed composition.

[0050] The pre-fermentation feed composition includes Lactobacillus reuteri DS0384 strain.

[0051] The description of the Lactobacillus reuteri DS0384 strain is the same as above.

[0052] In this invention, the term "fermentation pre-feedback" refers to a formulation comprising microorganisms involved in fermentation and other components providing essential building blocks for microbial growth, used for the large-scale production of fermentation products or metabolites by microorganisms, or for the large-scale cultivation of microorganisms involved in fermentation. In the fermentation pre-feedback composition of this invention, the microorganisms involved in fermentation include *Lactobacillus reuteri* strain DS0384. The fermentation pre-feedback composition may include a culture medium of *Lactobacillus reuteri* strain DS0384.

[0053] The pre-fermentation feed composition can be a reserve culture or seed culture of *Lactobacillus reuteri* DS0384 strain that has been conserved for long-term preservation and storage, and can be a mother pre-fermentation feed produced from the reserve culture or seed culture, or can be a batch pre-fermentation feed produced using the mother pre-fermentation feed. The pre-fermentation feed composition can be used to prepare compositions for promoting intestinal development or maturation, pharmaceutical compositions for preventing or treating intestinal development disorders, feed compositions for preventing or improving intestinal development disorders, fermented foods, etc., including *Lactobacillus reuteri* DS0384 strain or its culture, and the descriptions of the compositions for promoting intestinal development or maturation, pharmaceutical compositions, and feed compositions are the same as those described below.

[0054] Fermented foods can be, but are not limited to, yogurt (hard, soft, or beverage type), fermented milk such as lactic acid bacteria beverages, cheese, or butter, and can also include any food or product made by fermentation through fermenting microorganisms or lactic acid bacteria.

[0055] The pre-fermentation feed composition of the present invention can be used in any formulation, product, food, etc. prepared to utilize the effect of the Lactobacillus reuteri DS0384 strain of the present invention, and can be used to produce more Lactobacillus reuteri DS0384 strain or its culture medium in a shorter time.

[0056] The pre-fermentation feed composition may also include a culture medium in which *Lactobacillus reuteri* DS0384 can grow. The culture medium may contain, but is not limited to, components such as glucose, yeast extract, peptone, polysorbate 80, ammonium citrate, magnesium sulfate, dipotassium hydrogen phosphate, and sodium acetate, and may contain, but is not limited to, any components that can promote the growth of *Lactobacillus reuteri* DS0384. The pH of the culture medium may be adjusted to a range of pH 5 to 7.

[0057] The pre-fermentation feed composition may exclude bacteria other than Lactobacillus reuteri DS0384. To remove bacteria other than Lactobacillus reuteri DS0384, the pre-fermentation feed composition can be prepared by culturing Lactobacillus reuteri DS0384 in a sterile medium.

[0058] The pre-fermentation feed composition may also include a cryoprotectant. The cryoprotectant may be one or more selected from the group consisting of skim milk powder, maltodextrin, dextrin, trehalose, maltose, lactose, mannitol, cyclodextrin, glycerol, and honey, but is not limited thereto, and may contain any agent capable of preventing damage or death of lactic acid bacteria during the freeze-drying process.

[0059] When the pre-fermentation feed composition includes a cryoprotectant, it can be used in the form of a lyophilized product, such as a powder. The freeze-drying method has advantages in terms of formulation, packaging, and storage, and can preserve the Lactobacillus reuteri DS0384 strain contained therein for a long time.

[0060] 2. Compositions containing strain DS0384 or its culture medium in promoting intestinal development, intestinal maturation, or intestinal injury recovery. use

[0061] Another aspect of the present invention provides a composition that promotes intestinal development, intestinal maturation, or intestinal injury recovery.

[0062] The composition contains Lactobacillus reuteri DS0384 strain or its culture medium as an active ingredient.

[0063] The description of the *Lactobacillus reuteri* DS0384 strain is the same as above. *Lactobacillus reuteri* DS0384 strain exhibits excellent activities in increasing intestinal size and the expression of intestinal maturation marker genes, and also exhibits excellent activities in increasing the surface area of ​​damaged intestines to restore them and increasing the expression of intestinal wall functional markers and proliferation marker proteins. Therefore, compositions including this strain or its culture medium as active ingredients can be effectively used for the purpose of promoting intestinal development, intestinal maturation, or intestinal injury recovery.

[0064] The culture medium is obtained by culturing *Lactobacillus reuteri* DS0384 and can be the culture medium itself containing the strain of bacteria, or a culture supernatant obtained by removing the bacteria from it, and can be its filtrate, concentrate, or dry matter. The culture medium after removing the bacteria contains components produced and secreted by *Lactobacillus reuteri* DS0384 strain, such as metabolites, and therefore may have intestinal development or intestinal maturation activity.

[0065] Apart from the precipitate collected by removing floating solid particles from the culture medium of Lactobacillus reuteri DS0384, the filtrate is only a water-soluble supernatant and can be filtered using filters such as cotton or nylon, for example, filters of 0.2 µm to 5 µm, or can be used by freeze filtration, centrifugation, etc. without limitation.

[0066] The concentrate is a culture medium in which the concentration of solid components is increased, and can be a concentrate of a culture medium containing lactic acid bacteria cells or a concentrate of a culture supernatant from which lactic acid bacteria cells have been removed. The concentrate can be, but is not limited to, those concentrated by vacuum concentration, plate concentration, thin-film concentration, etc., for example, using known concentrators at temperatures between 40°C and 60°C. The content of culture medium contained in the composition of the present invention can be appropriately adjusted according to the concentration of the concentrate.

[0067] The dried material includes, but is not limited to, those dried by methods such as freeze drying, vacuum drying, hot air drying, spray drying, vacuum drying, foam drying, high frequency drying, and infrared drying.

[0068] Lactobacillus reuteri strain DS0384 can be used at 10 9 Up to 10 12 The concentration of CFU / g is included in the composition, and for example, it can be in the form of 10... 9 Up to 10 11 CFU / g, 10 10 Up to 10 12 CFU / g, or 10 10 Up to 10 11 The concentration of CFU / g is included in the composition. When Lactobacillus reuteri DS0384 strain is included in the composition at a concentration within the above range, Lactobacillus reuteri DS0384 strain can promote intestinal development, intestinal maturation or recovery of intestinal damage, or can adequately produce or secrete substances that help them, or can achieve normal metabolism without inhibiting the growth of the strain. Therefore, the composition of the present invention can exhibit sufficient effect for the purpose of promoting intestinal development or intestinal maturation.

[0069] The composition may also include a cryoprotectant. The cryoprotectant is described as above. When using a lyophilized product obtained by freeze-drying a culture medium containing Lactobacillus reuteri DS0384 cells, the composition including the lyophilized product has advantages in terms of oral intake, formulation, packaging, and storage, and has the advantage that the freeze-dried strain can again exhibit normal physiological activity and grow and metabolize in subjects administering the composition of the present invention, particularly in the intestine, because the strain can be preserved for a long time.

[0070] In this invention, the term "intestine" refers to the digestive tract region extending from the stomach to the anus. In humans and other mammals, the intestine consists of two regions: the small intestine (which in humans is further subdivided into the duodenum, jejunum, and ileum) and the large intestine (which in humans is further subdivided into the cecum and colon). Other mammals may have more complex intestines, and the intestine in this invention may include all of these.

[0071] The development or maturation of the intestine can specifically refer to the development or maturation of the small intestine or the large intestine. The compositions of the present invention can be used to promote the maturation of the small intestine or large intestine, or to promote the maturation of immature small intestine and large intestine.

[0072] In addition, promoting intestinal development or intestinal maturation is a process of enhancing, increasing, growing, supporting, or developing as part of the process of promoting the formation of specific mature epithelium or promoting the differentiation of intestinal epithelial cells and intestinal compartments.

[0073] The development or maturation of the small intestine can be caused by an increase in the length and area of ​​the villi or an increase in the depth of the crypts within the small intestine.

[0074] The development or maturation of the large intestine can be characterized by an increase in the depth of the crypts or an increase in the mucosa / submucosa ratio. For example, the development or maturation of the large intestine can be characterized by an increase in the thickness of the mucosa while the thickness of the submucosa remains unchanged. As the large intestine develops and matures, the submucosa maintains its structure, and the thickness of the mucosa increases, which may result in an increase in the mucosa / submucosa ratio that constitutes the large intestine.

[0075] Intestinal development or intestinal maturation can be caused by increasing the expression of one or more genes selected from the group consisting of CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1, and MUC13.

[0076] Intestinal injury can be caused, for example, by an inflammatory response in the intestine, but the causes of intestinal injury are not limited to this. If the function or structure of the intestine is impaired compared to its normal state, the Lactobacillus reuteri strain of the present invention can promote their recovery.

[0077] Recovery from intestinal injury can be achieved by increasing the surface area of ​​the damaged intestine to restore it to its original state, or by increasing the expression of gene or protein markers associated with intestinal wall function or proliferation in the damaged intestine. Intestinal wall function markers may include, but are not limited to, ZO-1 protein, and intestinal wall proliferation markers may include, but are not limited to, Ki67 protein.

[0078] The subjects to which the compositions of the present invention are applied may be newborns or infants. Additionally, newborns or infants may be premature or immature infants. A newborn is an infant from birth until acquiring independent extrauterine life, for example, an infant under 28 days of age. An infant may be an infant under 5 years of age, for example, an infant under 4 years of age or under 3 years of age. When applied to newborns or infants, the advantages and effects of the compositions of the present invention described above may be more pronounced. A premature infant is an infant born earlier than the normal gestational age, for example, an infant born between 29 and 38 weeks of gestation. An immature infant is an infant born in a state of physical immaturity, for example, an infant with low birth weight (e.g., 2.5 kg or less, 2 kg or less, or 1.5 kg or less) or an infant with weakened immune systems. The causes of prematurity and / or immaturity may include maternal illness, maternal age, stress, fetal condition, etc., but the compositions of the present invention can be applied to subjects without being limited to these causes. The compositions may be applied immediately after delivery of a premature or immature infant in a neonatal state, or may be applied during the period after birth when the premature or immature infant is growing and is an infant.

[0079] Because the composition of the present invention has excellent effects in promoting intestinal development and maturation, it has the ability to improve the immature intestinal development of the person who applies it accordingly. Therefore, when used for the purpose of targeting premature or immature infants, this effect can be more pronounced.

[0080] Compositions comprising Lactobacillus reuteri DS0384 strain or its culture medium can be prepared in a unit dose form by means readily available to those skilled in the art, either by formulation of the compounds of the invention with a pharmaceutically acceptable carrier and / or excipients, or by incorporation into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granules, tablet, capsule, gel (e.g., hydrogel), or lyophilized product, and may further include dispersants, stabilizers, and / or cryoprotectants as additives.

[0081] Specifically, the lyophilized product is used in powder form by freeze-drying the strain or its culture medium together with a cryoprotectant, wherein the cryoprotectant may be skim milk powder, maltodextrin, dextrin, trehalose, maltose, lactose, mannitol, cyclodextrin, glycerol, and / or honey. Alternatively, it is used by mixing with a preservative carrier, adsorbing, then drying, and solidifying, wherein the preservative carrier may be diatomaceous earth, activated carbon, and / or defatted rice bran.

[0082] The compositions of the present invention can be prepared by mixing a strain or its culture medium with any one of a carrier, excipient or additive.

[0083] The descriptions of the strains, carriers, excipients, and additives are the same as above. When a cryoprotectant is used as an additive, a composition comprising lactic acid bacteria in lyophilized powder form can be prepared by mixing the strains and the cryoprotectant, subjecting the mixture to a freezing process at -45°C to -30°C, then drying it at 30°C to 40°C and grinding it with a mixer. Specifically, the freezing process can be a process of vacuum freezing for 65 to 75 hours at a temperature of -45°C to -30°C and a pressure of 5 mTorr to 50 mTorr.

[0084] 3. Compositions comprising DS0384 strain or its culture medium for the prevention, treatment, and improvement of intestinal developmental disorders or inflammation. Uses of enteropathy

[0085] Another aspect of the present invention provides pharmaceutical compositions for the prevention or treatment of intestinal developmental disorders or inflammatory bowel disease, and feed compositions for the prevention or improvement of intestinal developmental disorders or inflammatory bowel disease.

[0086] The pharmaceutical composition and feed composition include Lactobacillus reuteri DS0384 strain or its culture medium as active ingredients.

[0087] The description of the *Lactobacillus reuteri* DS0384 strain is the same as above. *Lactobacillus reuteri* DS0384 strain exhibits excellent activities in increasing intestinal size and the expression of intestinal maturation marker genes, as well as excellent activities in increasing the surface area of ​​damaged intestines to restore damaged intestinal surface area and increasing the expression of intestinal wall function markers and proliferation marker proteins. Therefore, compositions comprising this strain or its culture medium as active ingredients can be effectively used for the prevention, treatment, or improvement of intestinal developmental disorders. Furthermore, *Lactobacillus reuteri* DS0384 strain again increases the surface area of ​​damaged intestines and increases the expression of marker proteins related to intestinal wall function and proliferation; therefore, it has excellent activities in promoting the recovery of intestinal damage. Therefore, compositions comprising the strain or its culture medium as active ingredients can be effectively used for the prevention, treatment, or improvement of inflammatory bowel disease.

[0088] Intestinal developmental disorders can be defined as a condition in which the intestines of humans or non-human animals fail to function at a normal level due to insufficient intestinal development compared to those that have completed development, maturation, differentiation, or growth. This includes the intestinal conditions of fetuses, newborns, infants, etc., who are still in the developmental or growth stages. Additionally, intestinal developmental disorders can also be defined as a condition in which the degree of intestinal development is insufficient compared to the average level of intestinal development at the same stage of development or growth. Intestinal developmental disorders encompass diseases and related gastrointestinal disorders caused by the degree of intestinal developmental deficiencies. Specifically, intestinal developmental disorders can be, but are not limited to, malabsorption syndromes (malabundance syndrome), inflammatory bowel diseases (Crohn's disease, ulcerative colitis, etc.), irritable bowel syndrome, short bowel syndrome (SBS), necrotizing enterocolitis (NEC), radiation proctitis, or premature infants, immature infants, and infants with immature intestines.

[0089] Inflammatory bowel disease (IBD) refers to a disease that occurs with intestinal damage, specifically an inflammatory response resulting from damage to the intestine. Specifically, IBD can be, but is not limited to, ulcerative colitis, Crohn's disease, Behcet's disease, etc., and can include any disease in which abnormal chronic inflammation occurs in the intestine, regardless of the cause of the inflammation. The *Lactobacillus reuteri* strain of the present invention has excellent activity in promoting the recovery of intestinal damage, for example, promoting the proliferation of inflammatory bowel disease caused by damage. Therefore, the compositions of the present invention can be effectively used for the purpose of preventing, treating, or improving IBD.

[0090] In one specific embodiment of the present invention, it has been demonstrated that when human intestinal organoids prepared using human stem cells and human intestinal stem cells isolated therefrom are treated with Lactobacillus reuteri DS0384 strain, excellent results are observed. Therefore, the composition of the present invention has been experimentally proven to exhibit sufficient effect even when applied to humans and can be effectively used for human purposes.

[0091] The pharmaceutical compositions of the present invention can be prepared in unit dose form by formulation of the compounds of the present invention with pharmaceutically acceptable carriers and / or excipients, or by incorporation into multi-dose containers, according to methods readily practiced by those skilled in the art. In this case, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granules, tablet, capsule, or gel (e.g., hydrogel), and may further include dispersants and / or stabilizers.

[0092] Furthermore, the bacterial strains or their cultures contained in the pharmaceutical composition can be delivered in pharmaceutically acceptable carriers, such as colloidal suspensions, powders, salt solutions, lipids, liposomes, microspheres, or nanospheres. These can be combined or associated with delivery devices and can be delivered in vivo using delivery systems known in the art, such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation agents, polysaccharides, polyamino acids, dendritic polymers, saponins, adsorption enhancers, or fatty acids.

[0093] In addition, pharmaceutically acceptable carriers may include, but are not limited to, lactose, glucose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylparaben, propylparaben, talc, magnesium stearate, mineral oil, etc., which are commonly used in formulations. Furthermore, in addition to the above-mentioned components, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc., may also be included. Suitable pharmaceutically acceptable carriers and reagents are described in detail in Remington's Pharmaceutical Sciences, 19th ed., 1995.

[0094] The pharmaceutical compositions can be administered orally or parenterally in clinical administration, and are used in the form of general pharmaceutical preparations. That is, the pharmaceutical compositions of the present invention can be administered in various oral and parenteral formulations in actual clinical administration, and are prepared using diluents or excipients, such as fillers, expanders, binders, wetting agents, disintegrants, and surfactants, which are commonly used in formulation. Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and are prepared by mixing at least one or more excipients, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc., with herbal extracts or herbal fermentation products. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid dosage forms for oral administration include suspensions, oral solutions, emulsions, syrups, etc., and may contain various excipients, such as wetting agents, sweeteners, flavoring agents, preservatives, etc., in addition to commonly used simple diluents such as water and liquid paraffin. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate can be used as non-aqueous solvents and suspension solvents. Witepsol, polyethylene glycol, Tween 61, cocoa butter, lauryl alcohol, glycerin, and gelatin can be used as suppository bases.

[0095] The pharmaceutical composition can be used alone or in combination with surgical procedures, radiotherapy, hormone therapy, chemotherapy, and the use of biological response modifiers to prevent or improve intestinal developmental disorders.

[0096] The concentration of the active ingredient in the pharmaceutical composition can be determined taking into account the therapeutic purpose, the patient's condition, the required time, etc., and is not limited to a specific range of concentrations. The pharmaceutical compositions of the present invention are administered in pharmaceutically effective amounts. In this invention, the term "pharmaceutically effective amount" refers to an amount sufficient to treat the disease with a reasonable benefit / risk ratio suitable for medical treatment, and the level of the effective dose can be determined based on factors including the type and severity of the patient's disease, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the rate of excretion, the duration of treatment, and concurrently used drugs, as well as other factors known in the medical field. The pharmaceutical composition can be administered as a single therapeutic agent or in combination with other therapeutic agents for intestinal developmental disorders, can be administered simultaneously, separately, or sequentially with conventional therapeutic agents, and can be administered once or multiple times. Taking all the above factors into consideration, it is important to administer an amount that achieves maximum effect with minimal dosage and without side effects, which can be readily determined by those skilled in the art.

[0097] Specifically, the effective amount of the pharmaceutical composition of the present invention can vary depending on the patient's age, sex, condition, weight, the extent of absorption of the active ingredient into the body, the inactivation rate, the excretion rate, the type of disease, and concomitant medications. It can also be increased or decreased depending on the route of administration, the severity of obesity, sex, weight, age, etc., and can be administered, for example, at a dose of approximately 0.0001 µg to 500 mg per kg of patient body weight per day, such as 0.01 µg to 100 mg. Additionally, at the discretion of a physician or pharmacist, it can be administered in divided doses at fixed time intervals, several times a day, such as 2 to 3 times a day.

[0098] Another aspect of the present invention provides a method for preventing or treating intestinal developmental disorders, comprising administering the pharmaceutical composition to a subject.

[0099] The subjects can be humans or non-human animals, and can be subjects whose intestinal development is insufficient compared to that of a fully developed human or non-human animal, or subjects in a developmental or growth stage. Furthermore, subjects can be humans or non-human animals whose intestinal development is insufficient compared to the average level of intestinal development at the same stage of development or growth.

[0100] The formulation, administration method, and dosage and concentration of the active ingredient contained in the pharmaceutical composition are described in the same manner as above.

[0101] The feed composition of the present invention can prevent or improve intestinal development disorders by promoting intestinal development or maturation in non-human animals, and can be added as a feed additive composition to prevent or improve intestinal development disorders. The feed additive is equivalent to the supplementary feed stipulated in the Korean Feed Management Act.

[0102] In this invention, the term "feed" refers to any natural or artificial diet, meal, or meal component intended or suitable for consumption, ingestion, and digestion by an animal, which is a non-human animal. There are no particular limitations on the type of feed, and feeds commonly used in the art can be used. Non-limiting examples of feed may include plant-based feeds such as grains, roots and fruits, food processing byproducts, algae, fiber, pharmaceutical byproducts, oils and fats, starch, oilseed meal, or grain byproducts; and animal feeds such as proteins, inorganic materials, oils and fats, minerals, single-cell proteins, zooplankton, and food. These ingredients may be used alone or in combination of two or more.

[0103] The present invention will now be described in detail through embodiments. However, the following embodiments are only for illustrative purposes, and the scope of the present invention is not limited to these embodiments.

[0104] All results from the following experiments are presented as mean ± standard error of mean (SEM), and all experiments were performed in at least three replicates. P-values ​​were determined using a two-tailed t-test, and unless otherwise stated, all statistical significance analyses were performed relative to the control group. A P-value less than 0.05 was considered statistically significant (*P<0.05, **P<0.01, ***P<0.001).

[0105] Example 1: Confirmation of the effect of the lactic acid bacteria of the present invention on promoting the maturation of intestinal organoids.

[0106] To verify the effect of the culture medium of Lactobacillus reuteri DS0384 strain of the present invention on intestinal maturation, intestinal organoids were prepared as an in vitro intestinal model and treated with the culture medium of Lactobacillus reuteri DS0384 strain of the present invention, and the maturation of the intestinal organoids was verified.

[0107] 1-1. Differentiation of human intestinal organoids

[0108] Intestinal organoids were prepared by differentiating human pluripotent stem cells. To differentiate human pluripotent stem cells, methods known in the art were used (Nature 470, 105–109 (2011)). Specifically, to induce human pluripotent stem cells (H9 (WA09); Wicell Research Institute, Madison, Wisconsin, USA) into a fixed endoderm, the stem cells were treated for 3 days with a medium containing fetal bovine serum (FBS, Thermo Scientific) and 100 ng / ml activin A, wherein the concentration of FBS was increased to 0%, 0.2%, and 2%, respectively, during FBS treatment. To form hindgut bulbs, they were further cultured for 4 days in a differentiation medium containing 500 ng / ml FGF4, 3 µm of CHIR 99021, and 2% FBS. The spherical bodies formed through induced differentiation were inserted into Matrigel domes and cultured in a three-dimensional culture environment in a medium containing 1× B27 supplement (Invitrogen), 100 ng / ml EGF (R & D Systems), 100 ng / ml head protein (R & D Systems), and 500 ng / ml R-spondin 1 (R & D Systems). The cultures were passaged every 10 days and used in experiments.

[0109] 1-2. Confirmation of the role of Lactobacillus reuteri strains in promoting intestinal organoid maturation

[0110] The intestinal organoids differentiated according to Example 1-1 above were treated with several types of lactic acid bacteria to confirm whether the intestinal organoids were mature.

[0111] Five types of lactic acid bacteria were used to treat intestinal organoids to confirm their respective roles. Morphological changes were demonstrated in intestinal organoids treated with lactic acid bacteria broth, and the expression of intestinal maturation markers was confirmed by immunofluorescence staining (immunocytochemistry, ICC) and qRT. The lactic acid bacteria used were *Bifidobacterium longum* DS0431 (isolated from neonatal feces), *Lactobacillus gasseri* DS0444 (isolated from breast milk), *Lactobacillus curvaturei* AB70 (isolated from female genitalia), *Lactobacillus rhamnosus* DS0979 (isolated from breast milk), and the *Lactobacillus reuteri* DS0384 strain of this invention (isolated from neonatal feces). The cultures of the five microbial strains were centrifuged at 12,000 rpm for 10 minutes, and only the supernatant was collected. The collected supernatant was sterilized at low temperature in a heating block preheated to 65°C for 30 minutes, and then filtered through a 0.22 µm syringe filter unit to remove impurities. The separated organs were treated with the culture medium obtained in this manner, diluted 1 / 100 in intestinal organoid culture medium, and passaged twice for a total of 20 days. Changes in the intestinal organoids were then observed.

[0112] First, morphological changes in intestinal organoids were identified by examining variations in size and the number of budding structures. Specifically, the dimensions of six organoids in each group treated with lactic acid bacteria were measured and compared by taking photographs of intestinal organoids under a microscope, and the number of budding structures was identified by the number of budding structures produced by each of the six organoids in each group treated with lactic acid bacteria.

[0113] As a result, it was confirmed that, compared with the groups treated with cultures of the other four types of lactic acid bacteria, larger intestinal organoids and more budding structures were observed when treated with the culture medium of the *Lactobacillus reuteri* DS0384 strain of the present invention. Figure 1A and Figure 1B (Upper part of the data). The surface area of ​​the organoids in the control group was measured to be 0.30 ± 0.02 mm. 2 The surface area of ​​the organoids in the group treated with the culture medium of the *Bifidobacterium longum* strain of the present invention was measured to be 0.27 ± 0.06 mm. 2 The surface area of ​​the organoids in the group treated with Lactobacillus gasseri culture medium was measured to be 0.24 ± 0.05 mm. 2 The surface area of ​​the organoids in the group treated with Lactobacillus curvaturei culture medium was measured to be 0.56 ± 0.08 mm. 2 The surface area of ​​the organoids in the group treated with Lactobacillus rhamnosus culture medium was measured to be 0.41 ± 0.10 mm. 2The surface area of ​​the organoids in the group treated with the culture medium of *Lactobacillus reuteri* (DS0384) strain of the present invention was measured to be 1.10 ± 0.07 mm. 2 Therefore, the size of organoids significantly increased in the groups treated with Lactobacillus curvature and Lactobacillus reuteri (DS0384) strain culture of the present invention, and in the group treated with Lactobacillus reuteri strain culture of the present invention ( Figure 1B In the left figure, the surface area of ​​the organoids increased the most. As a result of measuring the number of budding structures, the number of budding structures formed was 3.17±0.52 for the control group, 2.33±0.61 for *Bifidobacterium longum*, 2.50±0.37 for *Lactobacillus gasseri*, 8.83±0.96 for *Lactobacillus curvaturei*, 4.33±0.78 for *Lactobacillus rhamnosus*, and 19.67±2.20 for the *Lactobacillus reuteri* (DS0384) strain of the present invention. This confirms that the number of budding structures significantly increased in the groups treated with the culture medium of *Lactobacillus curvaturei* and *Lactobacillus reuteri* (DS0384) strains of the present invention, and the increase in the number of budding structures was greatest in the group treated with the culture medium of *Lactobacillus reuteri* (DS0384) strain. Figure 1B (Right image).

[0114] Furthermore, immunofluorescence staining was used to confirm the expression levels of intestinal maturation marker proteins in the mature intestine. OLFM4 (a marker of mature intestinal stem cells), DEFA5 (a marker of mature Panette cells), KRT20 (a marker of mature intestinal structural proteins), and MUC13 (a marker of mucin-producing cells) were targeted as marker proteins. Specifically, intestinal organoids treated with cultures of the five lactic acid bacteria described above were fixed in 4% PFA (paraformaldehyde), then cryoprotected by treatment with 10–30% sucrose solution, and frozen by treatment with OCT solution. The frozen intestinal organoid tissue was sectioned into 10–20 µm thick sections using a microtome, treated with PBS containing 0.1% Triton X-100 to allow the sections to pass through, and then blocked with PBS containing 4% BSA (bovine serum albumin) for 1 hour. Primary antibodies against the four target proteins mentioned above, diluted 1:100, were reacted overnight at 4°C with anti-OLFM4 antibody (ab85046, abcam from Cambridge, Massachusetts, USA), anti-DEFA5 antibody (ab90802, abcam), anti-KRT20 antibody (ab76126, abcam), and anti-MUC13 antibody (ab124654, abcam). Secondary antibodies, diluted 1:200, were reacted at room temperature for 1 hour with anti-goat antibody (anti-goat IgG Alexa Fluor 488, A21467, Invitrogen), anti-rabbit antibody (anti-rabbit IgG Alexa Fluor 594, A21442, Invitrogen), and anti-mouse antibody (anti-mouse IgG Alexa Fluor 594, A21203, Invitrogen). Cell nuclei were then stained with DAPI and observed under a fluorescence microscope.

[0115] As a result, it was confirmed that OFLM4, DEFA5, KRT20, and MUC13 proteins were stained and observed only in groups treated with the culture medium of *Lactobacillus reuteri* strain DS0384 of the present invention; therefore, proteins that appear during intestinal maturation were expressed and produced. Figure 1A (Lower part of the data), while no expression of proteins related to intestinal maturation was observed in the groups treated with cultures of the other four types of lactic acid bacteria.

[0116] Furthermore, the expression levels of intestinal maturation marker genes in intestinal organoids treated with culture medium of each lactic acid bacteria were confirmed by qRT-PCR. CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1, and MIC13 genes were targeted as mature intestinal marker genes. RNA was isolated and extracted from intestinal organoids treated with culture medium using the RNeasy kit (Qiagen), and cDNA was synthesized by reverse transcription of mRNA using a cDNA synthesis kit (Superscript IV cDNA synthesis system, Invitrogen). The synthesized cDNA was subjected to qRT-PCR using a PCR machine (7500 Rapid Real-Time PCR System, Invitrogen) with primers according to Table 1 below.

[0117] As a result, when treated with the culture medium of Lactobacillus reuteri DS0384 strain of the present invention, the expression levels of all 10 intestinal maturation marker genes containing the CDX2 gene increased several to several thousand times compared with the control group. Therefore, a significant increase can be confirmed. Figure 1C ).

[0118] Table 1

[0119] SEQ ID NO: sequence name Sequence (5′→3′) 1 GAPDH forward primer GAAGGTGAAGGTCGGAGTC 2 GAPDH reverse primer GAAGATGGTGATGGGATTTC 3 CDX2 forward primer CTGGAGCTGGAGAAGGAGTTTC 4 CDX2 reverse primer ATTTTAACCTGCCTCTCAGAGAGC 5 DPP4 forward primer CAAATTGAAGCAGCCAGACA 6 DPP4 reverse primer GGAGTTGGGAGACCCATGTA 7 OLFM4 forward primer ACCTTTCCCGTGGACAGAGT 8 OLFM4 reverse primer TGGACATATTCCCTCACTTTGGA 9 DEFA5 forward primer CCTTTGCAGGAAATGGACTC 10 DEFA5 reverse primer GGACTCACGGGTAGCACAAC 11 CREB3L3 forward primer ATCTCCTGTTTGACCGGCAG 12 CREB3L3 reverse primer GTCGTCAGAGTCGGGGTTTG 13 KRT20 forward primer TGGCCTACACAAGCATCTGG 14 KRT20 reverse primer TAACTGGCTGCTGTAACGGG 15 LYZ forward primer AAAACCCCAGGAGCAGTTAAT 16 LYZ reverse primer CAACCCTCTTTGCACAAGCT 17 LCT forward primer GGCAGTCTGGGAGTTTTAGG 18 LCT reverse primer ATGCCAAAATGAGGCAAGTC 19 SLC5A1 forward primer GTGCAGTCAGCACAAAGTGG 20 SLC5A1 reverse primer ATGCACATCCGGAATGGGTT 21 MUC13 forward primer CGGATGACTGCCTCAATGGT 22 MUC13 reverse primer AAAGACGCTCCCTTCTGCTC

[0120] Taking into account the results of the above experiments, when human intestinal organoids were treated with the Lactobacillus reuteri DS0384 strain of the present invention in various types of lactic acid bacteria isolated from neonatal feces, breast milk or female genitalia, it was confirmed that the expression levels of genes and proteins related to intestinal maturation were significantly increased, and it can be seen that it has a real role in promoting intestinal development and maturation, such as increasing the size of intestinal organoids and inducing the formation of budding structures.

[0121] 1-3. Confirm the differences in the effects of different strains of Lactobacillus reuteri on promoting intestinal organoid maturation.

[0122] Examples 1-2 above demonstrate that the *Lactobacillus reuteri* strain DS0384 of the present invention exhibits superior effects in promoting intestinal maturation and development compared to other lactic acid bacteria species. Therefore, the DS0384 strain of the present invention was compared with other strains classified as the same species to compare the differences in its effects on promoting intestinal organoid maturation.

[0123] To compare with the *Lactobacillus reuteri* strain DS0384 of the present invention, intestinal organoids were treated with culture media of *Lactobacillus reuteri* strains DS0191, DS0195, DS0333, and DS0354, and the effects were compared with those of treatment with culture media of strain DS0384. Experiments were performed using the same methods as in Examples 1-2 above, and the morphological changes of intestinal organoids after culture treatment, as well as the expression levels of proteins and genes used as markers of intestinal maturation, were confirmed by immunofluorescence staining and qRT-PCR.

[0124] The results confirmed that other Lactobacillus reuteri strains also have a certain degree of effect in promoting intestinal organoid development, but when treated with the culture medium of the DS0384 strain of this invention, the structural development of intestinal organoids was the greatest. Figure 2A The data above (and even the results of immunofluorescence staining) confirm that OLFM4 and DEFA5 proteins are expressed only in the group treated with the culture medium of the DS0384 strain of the present invention. Figure 2A (Lower part of the data). Even in the results confirming the expression levels of marker genes by qRT-PCR, unlike the fact that the expression of all 8 genes in the group treated with the culture medium of the DS0384 strain of the present invention was significantly increased compared with the control group, the expression of some genes in the group treated with the culture medium of other Lactobacillus reuteri strains did not increase ( Figure 2B In particular, it has been demonstrated that, unlike groups treated with cultures of other *Lactobacillus reuteri* strains, the expression levels of the OLFM4 and DEFA5 genes were significantly increased in the group treated with the culture medium of strain DS0384. The OLFM4 gene is highly expressed in the human small and large intestines and corresponds to a marker gene specifically expressed in intestinal stem cells; therefore, it is known to be closely related to intestinal development and differentiation. The DEFA5 gene encodes the DEFA5 (defensin α5) protein, which is abundant on the intestinal surface and is highly expressed in mature Panette cells; therefore, it is used as a marker for this protein. Thus, it can be demonstrated that the DS0384 strain of the present invention, exhibiting characteristics of increased OLFM4 and DEFA5 gene expression levels, unlike groups treated with cultures of other microbial strains, can promote intestinal maturation and development, even in a manner different from other strains, thus demonstrating a more significant maturation-promoting effect.

[0125] In addition to the results of the comparative experiments using four Lactobacillus reuteri strains confirmed above, the effectiveness of the DS0384 strain of the present invention was further validated through additional comparative experiments using Lactobacillus reuteri strains DSP007, DS0337, and KCTC3594. Intestinal organoids were treated in the same manner, and the morphological changes and expression levels of marker proteins and genes were confirmed by immunofluorescence staining and qRT-PCR.

[0126] As a result, unlike the groups treated with cultures of *Lactobacillus reuteri* DSP007, DS0337, and KCTC3594, which showed less morphological maturation of intestinal organoids, the groups treated with the culture medium of the present invention DS0384 strain showed significantly enhanced maturation of intestinal organoids. Furthermore, in the immunofluorescence staining results, expression of OLFM4, DEFA5, KRT20, and MUC13 proteins was observed only in the groups treated with the culture medium of the present invention DS0384 strain. Figure 3A Even in the qRT-PCR results, it can be confirmed that, compared with the control group, the expression of 10 intestinal maturation marker genes was significantly increased in the group treated with the culture medium of the DS0384 strain of the present invention, while in the groups treated with the culture medium of the other three Lactobacillus reuteri strains, the expression levels appeared to be significantly lower than the expression levels in the culture medium of the DS0384 strain of the present invention, and even lower than the control group. Figure 3B ).

[0127] Based on the results of Examples 1-2 and 1-3 above, it can be seen that the culture medium of the *Lactobacillus reuteri* strain DS0384 of the present invention has an excellent effect on promoting the maturation and development of intestinal organoids. In particular, it was confirmed that lactic acid bacteria strains classified as different from *Lactobacillus reuteri* did not show an effect on promoting intestinal maturation, and compared with groups treated with culture media belonging to other strains of *Lactobacillus reuteri*, the DS0384 strain of the present invention showed a significantly superior effect on promoting intestinal maturation.

[0128] 1-4. Comparison of the effects of Lactobacillus reuteri DS0384 and DSP007 strains on promoting intestinal organoid maturation and optimizing culture conditions.

[0129] Based on the experimental results of Examples 1-3 above, another comparative experiment was conducted using Lactobacillus reuteri DSP007 strain, which showed the effect of promoting intestinal organ maturation after Lactobacillus reuteri DS0384 strain of the present invention. In this case, culture media of each strain were obtained and each culture time was treated to confirm the difference in effect according to culture conditions.

[0130] Specifically, the Lactobacillus reuteri DS0384 and DSP007 strains of the present invention were cultured for 6 hours, 12 hours, 18 hours and 24 hours, and intestinal organoids were treated with the culture medium obtained each time. The expression levels of 10 intestinal maturation marker genes containing the CDX2 gene and the morphological changes of intestinal organoids were measured by qRT-PCR in the same manner as in Examples 1-2 above.

[0131] The results confirmed that treatment with Lactobacillus reuteri DS0384 culture medium not only clearly showed morphological changes in intestinal organoids, but also significantly increased the expression levels of 10 intestinal maturation marker genes in the group treated with DS0384 culture medium. Figure 4A and Figure 4B In particular, in intestinal organoids treated with cultures obtained from 18 hours or longer (18 hours, 24 hours of culture) of strain DS0384, the expression levels of intestinal maturation marker genes were significantly increased. Conversely, when treated with cultures of strain DSP007, which also belongs to Lactobacillus reuteri, no significant effect on promoting intestinal maturation was observed, and the effect was confirmed to be indistinguishable based on culture time.

[0132] The above experimental results confirm once again that the Lactobacillus reuteri DS0384 strain or its culture medium of the present invention is a strain with superior intestinal maturation-promoting effect compared with other Lactobacillus reuteri strains. Furthermore, it can be confirmed that the intestinal maturation-promoting effect is even better in the culture medium obtained after culturing the DS0384 strain for 18 hours or longer, such as 18 hours or 24 hours.

[0133] 1-5. Confirmation of the effect of Lactobacillus reuteri DS0384 strain on promoting human intestinal stem cell growth

[0134] In addition to demonstrating the excellent effect of the Lactobacillus reuteri DS0384 strain of the present invention in promoting the growth of intestinal organoids, it was also demonstrated whether the treatment of human intestinal stem cells isolated from intestinal organoids with the DS0384 strain promoted the growth of stem cells.

[0135] Specifically, intestinal stem cells were isolated from human intestinal organoids, cultured, and attached to culture dishes. The intestinal stem cells were then treated with a culture medium containing diluted *Lactobacillus reuteri* strains DS0384 and KCTC3594, and cultured and observed for 7 to 10 days, with the culture medium changed every 2 days. Furthermore, the differences in growth based on culture medium treatment were confirmed by comparing the colony morphology (surface area) of the intestinal stem cells.

[0136] As a result, the surface area of ​​intestinal stem cell colonies treated with the culture medium of the present invention of Lactobacillus reuteri DS0384 was measured to be approximately 7.3 times larger than that treated with the culture medium of Lactobacillus reuteri KCTC3594. Figure 5A and Figure 5B Therefore, it can be confirmed that the Lactobacillus reuteri DS0384 strain of the present invention has excellent properties not only in promoting intestinal maturation, but also in promoting the growth of intestinal stem cells.

[0137] Example 2 confirms the protective effect of the lactic acid bacteria of the present invention on intestinal organoids.

[0138] To verify the protective effect of the culture medium of Lactobacillus reuteri DS0384 strain of the present invention on the intestine, after preparing intestinal organoids, inducing their damage, and treating them with the culture medium of the DS0384 strain of the present invention, the protective effect on intestinal organoids was verified in the same manner as that used to verify the effects of promoting intestinal maturation and promoting the growth of intestinal stem cells.

[0139] First, to obtain damaged intestinal organoids, after 10 days of passage, second- or third-generation intestinal organoids were treated for 3 days with inflammatory cytokines IFNγ and TNFα at concentrations of 125 ng / ml, respectively. Additionally, the intestinal organoids were simultaneously treated with inflammatory cytokines and a culture medium of *Lactobacillus reuteri* strain DS0384 of this invention, diluted 1 / 100 in the intestinal organoid culture medium, and then the condition of the intestinal organoids was observed.

[0140] The results of morphological analysis of damaged intestinal organoids treated with culture medium of strain DS0384 confirmed that the surface area of ​​intestinal organoids treated with inflammatory cytokines alone decreased, while the surface area of ​​intestinal organoids treated with culture medium of strain DS0384 of the present invention significantly increased and recovered. Figure 6A , Figure 6B and Figure 6C ).

[0141] Furthermore, after freezing and sectioning the intestinal organoids, the expression of intestinal wall functional marker proteins and proliferation marker proteins was confirmed by immunofluorescence staining. The results showed that, compared with the control group treated only with inflammatory cytokines, the intestinal organoids treated with the culture medium of the DS0384 strain of the present invention significantly increased the expression levels of ZO-1, a functional marker protein of the intestinal wall, and Ki67, a proliferation marker protein. Figure 7 ).

[0142] Based on the above experimental results, when intestinal organoids damaged by inflammatory cytokines were treated with the culture medium of the *Lactobacillus reuteri* strain DS0384 of the present invention, it was confirmed that it promotes recovery by inhibiting the reduction of surface area and protects the intestine from damage by increasing the expression of intestinal wall or proliferation marker proteins. Therefore, it can be confirmed that the *Lactobacillus reuteri* strain DS0384 of the present invention, in addition to promoting intestinal maturation and intestinal stem cell growth, also has a protective effect on the intestine.

[0143] Example 3: Mouse experiments were used to demonstrate the effect of the lactic acid bacteria of the present invention on promoting intestinal maturation and development in animals.

[0144] In the isolated intestinal model, intestinal organoids, and intestinal stem cells prepared by simulating the human intestine in Example 1, the DS0384 strain of the present invention was demonstrated to be superior to microorganisms, such as other types of Lactobacillus reuteri, in its effect on intestinal maturation and development. Therefore, in order to verify whether the DS0384 strain of the present invention promotes intestinal maturation when actually applied to animals, animal experiments were conducted on mice.

[0145] 3-1. Creation of mouse models and design of animal experiments

[0146] Three-day-old male C57BL / 6J mice (Eumseong DBL, South Korea) were used as the experimental mice, and all animal experiments were conducted with the approval of the Research Animal Care and Use Committee (IACUC) of the Korea Institute of Biomedical Engineering (Approval No.: KRIBB-AEC-19222). The control group consisted of mice orally administered physiological saline (PBS), and the group administered a culture of *Lactobacillus reuteri* KCTC3594 orally. In the case of the group administered the DS0384 strain of the present invention, experiments were conducted by administering the bacterial culture to mice in the same manner as in Examples 1-2 above, or by orally administering the culture to mice and centrifuging to remove the bacteria.

[0147] Three-day-old mice were stabilized for two days, and then administered samples from both the experimental and control groups orally for seven days. After seven days, the mice were euthanized humanely, and their intestines were dissected, with changes in length and weight measured at dissection. Mice exhibiting growth retardation compared to other mice during oral gavage were excluded from the experiment, and seven or more replicates for each condition were configured to ensure statistical significance (n>7 per group).

[0148] 3-2. Confirmation of the effect of the DS0384 strain of the present invention on promoting intestinal development in mice.

[0149] Mice from Examples 2-1 were administered the above-described samples orally via gavage with a culture medium containing *Lactobacillus reuteri* DS0384 of the present invention and a culture medium after centrifugation for 7 days to remove bacteria, respectively. The control group was administered PBS and a culture medium of *Lactobacillus reuteri* KCTC3594 orally for 7 days. Tissue samples were then prepared for microscopic observation. First, a midline incision was made in the abdomen of euthanized mice, and the entire digestive tract was removed. Samples were collected by separating the digestive tract tissue into the jejunal portion of the small intestine and the distal colonic portion of the large intestine. The samples were fixed with 4% PFA, cryoprotected with sucrose, and then frozen using OCT solution. Next, 10 µm thick cryosections were prepared at -20°C using a cryostat. For samples difficult to observe with cryosectioning, 4% PFA was used for fixation, followed by embedding in paraffin and cutting into 5–7 µm thick sections.

[0150] H&E staining (hematoxylin and eosin staining) was performed to observe the properties of the tissue sections from the cryostat. The tissue sections from the cryostat were adhered to a glass slide, stained with hematoxylin for 5 minutes, washed with running water, and then stained with eosin. They were then dehydrated with ethanol, washed with xylene, and sealed. Tissue sections extracted from paraffin-embedded tissue using a microtome were adhered to a glass slide, dried, stained with hematoxylin and eosin, and then sealed using the same procedure as the cryostat sections.

[0151] By observing the histological morphology of tissues under a microscope, the length and area of ​​the villi in the jejunum of the small intestine and the depth of the crypts were measured, as well as the depth of the crypts and the thickness of the mucosa in the large intestine. These measurements were then used to quantify the degree of intestinal development and maturation. With the maturation of the large intestine, the mucosal thickness increases, and the structure of the submucosa is maintained during normal development; therefore, the mucosa / submucosa ratio increases. Thus, the maturity of the large intestine can be confirmed by measuring the crypt depth and the increase in the mucosa / submucosa ratio.

[0152] As a result, it was observed that when the culture medium of *Lactobacillus reuteri* strain DS0384 of the present invention was administered orally, the length and area of ​​villi increased, and the depth of crypts in the small intestine and large intestine of mice increased. Specifically, it was confirmed that the development of the small and large intestines was significantly promoted when the DS0384 culture medium was administered, even compared with the control group which was given PBS and KCTC3594 culture medium. Figure 8 and 9Although strain KCTC3594, like strain DS0384, is classified as *Lactobacillus reuteri*, it has been confirmed that oral administration of KCTC3594 culture medium showed no change in small and large intestinal development compared to administration of PBS. However, the DS0384 culture medium of the present invention significantly promoted intestinal development both when administered after containing the bacteria and when administered after removing the bacteria by centrifugation. Treatment with the *Lactobacillus reuteri* DS0384 strain and its culture of the present invention confirmed an increase in villus length and area, as well as crypt length, thus demonstrating excellent promotion of small intestinal development. Furthermore, an increased mucosa / submucosa ratio was confirmed, thus demonstrating excellent promotion of large intestinal development.

[0153] The above results demonstrate that the *Lactobacillus reuteri* strain DS0384 of the present invention and its metabolites promote the development of the small and large intestines. Furthermore, other *Lactobacillus reuteri* strains do not exhibit this effect, or their effect is less pronounced than that of strain DS0384. Therefore, the *Lactobacillus reuteri* strain DS0384 and its culture medium of the present invention are not only suitable for promoting intestinal maturation, but also characterized by a significantly superior effect on promoting intestinal maturation compared to other conventional lactic acid bacteria and *Lactobacillus reuteri* strains known in the art for various purposes. Thus, it can be seen that the DS0384 strain of the present invention is a novel strain with new effects and characteristics that cannot be predicted or achieved from conventional *Lactobacillus reuteri*.

[0154] For the purposes of this description, it will be apparent to those skilled in the art that the present invention has only been described in detail with reference to the described embodiments. However, various changes and modifications can be made within the scope of the technical concept of the present invention, and such changes and modifications obviously fall within the scope of the appended claims.

[0155] [Login ID]

[0156] Name of depository: Korea Center for Type Culture Collection, Korea Institute of Life Sciences

[0157] Login ID: KCTC 14164BP

[0158] Login date: 20200406 <110> Korea Research Institute of Bioscience and Biotechnology <120> New Lactobacillus reuteri strains and their uses <130> 2021OPA5566 <150> KR 10-2020-0076569 <151> 2020-06-23 <160> twenty two <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 1 gaaggtgaag gtcggagtc 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 2 gaagatggtg atgggatttc 20 <210> 3 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> CDX2 forward primer <400> 3 ctggagctgg agaaggagtt tc 22 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> CDX2 reverse primer <400> 4 attttaacct gcctctcaga gagc 24 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DPP4 forward primer <400> 5 caaattgaag cagccagaca 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DPP4 reverse primer <400> 6 ggagttggga gacccatgta 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OLFM4 forward primer <400> 7 acctttcccg tggacagagt 20 <210> 8 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> OLFM4 reverse primer <400> 8 tggacatatt ccctcacttt gga 23 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DEFA5 forward primer <400> 9 cctttgcagg aaatggactc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DEFA5 reverse primer <400> 10 ggactcacgg gtagcacaac 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CREB3L3 forward primer <400> 11 atctcctgtt tgaccggcag 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CREB3L3 reverse primer <400> 12 gtcgtcagag tcggggtttg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KRT20 forward primer <400> 13 tggcctacac aagcatctgg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KRT20 reverse primer <400> 14 taactggctg ctgtaacggg 20 <210> 15 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> LYZ forward primer <400> 15 aaaaccccag gagcagttaa t 21 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LYZ reverse primer <400> 16 caaccctctt tgcacaagct 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LCT forward primer <400> 17 ggcagtctgg gagttttagg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LCT reverse primer <400> 18 atgccaaaat gaggcaagtc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC5A1 forward primer <400> 19 gtgcagtcag cacaaagtgg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SLC5A1 reverse primer <400> 20 atgcacatcc ggaatgggtt 20 <210> twenty one <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MUC13 forward primer <400> twenty one cggatgactg cctcaatggt 20 <210> twenty two <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MUC13 reverse primer <400> twenty two aaagacgctc ccttctgctc 20

Claims

1. A strain of Lactobacillus reuteri DS0384, deposited with accession number KCTC 14164 BP.

2. A pre-fermentation feed composition comprising Lactobacillus reuteri strain DS0384, deposited under accession number KCTC 14164 BP.

3. The pre-fermentation feed composition according to claim 2, wherein the composition further comprises a cryoprotectant.

4. A composition for promoting intestinal development, intestinal maturation or intestinal injury recovery, comprising Lactobacillus reuteri DS0384 strain deposited with accession number KCTC 14164BP, a culture medium obtained by culturing said strain, or a culture supernatant obtained by removing said strain from said culture medium as an active ingredient.

5. The composition according to claim 4 for promoting intestinal development, intestinal maturation, or intestinal injury recovery, wherein, The Lactobacillus reuteri DS0384 strain was used at 10 9 Up to 10 12 The concentration of CFU / g is included in the composition.

6. The composition according to claim 4 for promoting intestinal development, intestinal maturation, or intestinal injury recovery, wherein, The composition also includes a cryoprotectant.

7. The composition according to claim 4 for promoting intestinal development, intestinal maturation, or intestinal injury recovery, wherein, The intestinal development or intestinal maturation refers to the development or maturation of the small intestine or large intestine.

8. The composition according to claim 7 for promoting intestinal development, intestinal maturation, or intestinal injury recovery, wherein, The development or maturation of the small intestine involves increasing the length and area of ​​the villi or increasing the length of the crypts in the small intestine.

9. The composition according to claim 7 for promoting intestinal development, intestinal maturation, or intestinal injury recovery, wherein, The development or maturation of the large intestine involves increasing the length of the crypts in the large intestine or increasing the mucosa / submucosa ratio in the large intestine.

10. The composition for promoting intestinal development, intestinal maturation or intestinal injury recovery according to claim 4, wherein the intestinal development or intestinal maturation is the increase of expression of one or more genes selected from the group consisting of CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1, and MUC13.

11. The composition according to claim 4 for promoting intestinal development, intestinal maturation or intestinal injury recovery, wherein the intestinal injury recovery is an increase in the surface area of ​​the damaged intestine or an increase in the expression of at least one protein selected from the group consisting of ZO-1 and Ki67 proteins in the intestine.

12. A pharmaceutical composition for the prevention or treatment of intestinal developmental disorders or inflammatory bowel disease, comprising, as an active ingredient, a strain of Lactobacillus reuteri DS0384 deposited under accession number KCTC14164 BP, a culture medium obtained by culturing said strain, or a culture supernatant obtained by removing said strain from said culture medium.

13. The pharmaceutical composition for the prevention or treatment of intestinal developmental disorders or inflammatory bowel disease according to claim 12, wherein the pharmaceutical composition is prepared as any formulation selected from the group consisting of capsules, powders, granules, tablets, pills, and lyophilized products.

14. A feed composition for preventing or improving intestinal developmental disorders or inflammatory bowel disease, comprising Lactobacillus reuteri DS0384 strain deposited under accession number KCTC14164 BP, a culture medium obtained by culturing said strain, or a culture supernatant obtained by removing said strain from said culture medium as an active ingredient.

Images