Application of nucleolin in blocking porcine reproductive and respiratory syndrome virus infection

Abstract

The present invention discloses the application of nucleolin in blocking porcine reproductive and respiratory syndrome virus infection, and belongs to the field of biotechnology. The present invention discovers a new PRRSV cell target protein - Nucleolin protein (NCL), and the specific siRNA for NCL and the single-stranded oligonucleotide AS1411 with specific affinity for NCL can significantly inhibit PRRSV infection, and the combined application of the two can significantly improve the ability to resist PRRSV infection. The specific siRNA of NCL and AS1411 can be developed into drugs for preventing and treating PRRSV infection, thereby providing a new idea for PRRSV research and prevention, expanding the scope of research, and having extremely important significance for actual production.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of nucleolin in blocking porcine reproductive and respiratory syndrome virus infection. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS), also known as blue ear disease, is an acute infectious disease caused by porcine reproductive and respiratory syndrome virus (PRRSV). The main characteristics of the disease are reproductive disorders in sows and breathing difficulties in pigs of all ages, causing huge economic losses to the pig industry. PRRSV is divided into two types of viruses, PRRSV-1 (European type) and PRRSV-2 (North American type). In my country, PRRSV-2 is the main prevalent virus.

[0003] The PRRSV genome is highly variable. The first strain, CH-1a(1), was first reported and isolated in my country in 1996. In 2007, highly pathogenic PRRSV (HP-PRRSV) appeared. In 2013, NADC30-like PRRSV appeared. Its clinical detection rate has increased year by year. By 2020, NADC30-like strains accounted for more than 50% of clinically isolated strains. In 2017, NADC34-like PRRSV appeared in my country, and by 2021, the detection rate had increased significantly. The continuous emergence of these variant strains has made the epidemic of PRRSV more complicated. What is more serious is that these new strains can recombine with the original strains and vaccine strains to produce new strains with altered virulence and immune characteristics, resulting in unsatisfactory protection of existing vaccines. In addition, there is a lack of effective drugs and the pathogenic mechanism is not yet fully understood, making the disease more difficult to prevent and control.

[0004] Nucleolin (NCL), as a stress-responsive RNA-binding protein, can affect the stability and translation activity of specific mRNAs by recognizing and binding to special motifs (rich in AU or G sequences) or IRES elements, and significantly regulate processes such as cell proliferation, tumorigenesis, and viral infection. However, there are no reports on the role of nucleolin in regulating PRRSV infection. Summary of the invention

[0005] In view of the above prior art, the purpose of the present invention is to provide the use of nucleolin in blocking PRRSV infection. The present invention has found that NCL has the effect of promoting PRRSV infection, and blocking the function of NCL can inhibit PRRSV infection. Therefore, the present invention designs a series of substances for NCL to block PRRSV infection, and has achieved remarkable results.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect of the present invention, a gene encoding nucleolin is provided as a target for preparing an inhibitor for inhibiting PRRSV infection.

[0008]

[0009] In a second aspect of the present invention, a siRNA targeting a nucleolin encoding gene is provided, wherein the sense strand of the siRNA is shown in SEQ ID NO.2, and the antisense strand is shown in SEQ ID NO.3; specifically, as follows:

[0010] Sense strand: GGCGATCTATTTCCCTGTATT; (SEQ ID NO.2)

[0011] Antisense strand: TACAGGGAAATAGATCGCCTT. (SEQ ID NO.3)

[0012] Note: All the bold “T” bases above can also be replaced by “U” bases.

[0013] The third aspect of the present invention provides the use of the above siRNA in reducing the transcription of the gene encoding NCL and / or reducing the expression of nucleolin.

[0014] The fourth aspect of the present invention provides the use of the above siRNA in the preparation of a drug for blocking PRRSV infection.

[0015] The fifth aspect of the present invention provides the use of nucleolin (NCL) as a target protein affecting PRRSV infection in the preparation of an inhibitor for inhibiting PRRSV infection.

[0016] The sixth aspect of the present invention provides the use of an NCL function inhibitor in the preparation of a drug for blocking PRRSV infection.

[0017] Preferably, the NCL function inhibitor is a nucleic acid aptamer AS1411, and its nucleotide sequence is shown in SEQ ID NO.4, which is as follows:

[0018] AS1411:TTGGTGGTGGTGGTTGTGGTGGTGGTGG. (SEQ ID NO. 4).

[0019] The above-mentioned nucleic acid aptamer AS1411 is an improved nucleic acid aptamer (28 bases) obtained on the basis of the disclosed sequence (26 bases), and its structure is T base-AS1411. It can be coupled with extracellular vesicles (EVs) to improve the targeting of EVs, which is beneficial to treat related diseases through the function of EVs carrying drugs.

[0020] In a seventh aspect, the present invention provides a drug for blocking PRRSV infection, wherein the drug comprises the above-mentioned siRNA and / or AS1411 as an active ingredient.

[0021] Preferably, the drug is prepared by mixing 1 μM siRNA and 2.5 μM nucleic acid aptamer AS1411 in a volume ratio of 1:1.

[0022] The present invention has found that the combined use of siRNA targeting nucleolin encoding genes and nucleic acid aptamer AS1411 has a significant synergistic effect in blocking PRRSV infection compared with the use of siRNA and nucleic acid aptamer AS1411 alone.

[0023] Beneficial effects of the present invention:

[0024] The present invention has discovered a new PRRSV cell target protein, NCL protein, and found the specific siRNA and affinity single-stranded oligonucleotide AS1411 of the receptor gene. The NCL protein can participate in the infection of PRRSV. Therefore, knocking down the NCL gene or reducing protein expression can significantly reduce the ability of highly pathogenic PRRSV (HP-PRRSV), NADC30-like, and recombinant toxins (toxins formed after HP-PRRSV and NADC30-LIKE recombination) to infect cells; AS1411 treatment can also inhibit PRRSV infection. Therefore, the specific siRNA and AS1411 designed for the NCL coding gene can be developed into drugs for preventing and treating PRRSV infection. The present invention provides a brand-new idea for PRRS research and prevention, expands the scope of research, and is of great significance for actual production. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 : Effects of siRNA-NC and siRNA-NCL on cytotoxicity in Marc-145 cells (A), detection of siRNA-NCL silencing effect (B), real-time PCR (C), Western blot (D) and virus titer TCID50 (E) detection results of TA-12 infection.

[0026] Figure 2 : Effects of different doses of AS1411 and control nucleic acid aptamer (cApt) on cytotoxicity of Marc-145 cells at 24h and 48h (A), real-time PCR of AS1411 on NCL when infected or not infected with TA-12 (B), real-time PCR (C) of TA-12 cells first inoculated with AS1411 followed by treatment with AS1411, Western blot (D) and virus titer TCID50 (E) detection results.

[0027] Figure 3:Real-time PCR (A) of the effect of AS1411 on NCL in Marc-145 cells when infected or not with TA-12, real-time PCR (B) of AS1411 treatment followed by inoculation with TA-12, Western blot (C) and virus titer TCID50 (D).

[0028] Figure 4 :The effect of AS1411 on different types of PRRSV infection. The results of real-time PCR and Western blot of different doses of AS1411 on TA-01 (A), and the results of real-time PCR and Western blot of different doses of AS1411 on TA-01 (B). The results of real-time PCR and Western blot of different doses of AS1411 on TA-02 (C), and the results of real-time PCR and Western blot of different doses of AS1411 on TA-02 (D).

[0029] Figure 5 : Preventive real-time PCR (A), Western blot (C) and therapeutic real-time PCR (B), Western blot (D) of AS1411 against TA-12 infection on PAM.

[0030] Figure 6 :The effect of siRNA and AS1411 combination on TA-12. The effect of TA-12 infection after siRNA silencing and then treated with AS1411 on NCL real-time PCR (A), real-time PCR of TA-12 (B) and virus titer TCID50 (C) detection results. DETAILED DESCRIPTION

[0031] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0032] As mentioned above, the cross-immunity between HP-PRRSV and common strains of PRRSV is low, which brings great difficulties to the prevention and treatment of HP-PRRSV. Therefore, it is necessary to find new ways to prevent and control the disease. Using proteomics as a technical means, searching for cellular proteins involved in the virus infection process, and research on drugs or inhibitors targeting these cellular proteins has become a hot topic in current research.

[0033] In all eukaryotic cells, nucleolin (also referred to as NCL, C23) is the most important protein in the nucleolus of eukaryotic cells. The inventors first discovered that NCL protein can be used as a target protein affecting HP-PRRSV infection. NCL has the effect of promoting PRRSV infection, and blocking the function of NCL can inhibit PRRSV infection.

[0034] Therefore, the development and design of NCL siRNA and NCL function inhibitors using the gene encoding nucleolin or nucleolin as a target can block or inhibit HP-PRRSV infection.

[0035] RNA interference is the specific degradation of homologous mRNA induced by double-stranded RNA, which is mainly achieved by designing siRNA of the corresponding gene. The quality of the designed siRNA will significantly affect the effect of RNA interference, and then affect the success or failure of the experiment. The present invention is based on the sequence characteristics of the NCL gene (GenBank accession number: XM_015111344.2) and considers the effect of the target structure on the siRNA interference efficiency. A plurality of siRNAs with high interference efficiency for NCL are predicted, and then the 566th siRNA gene silencing site of NCL is selected according to the structural characteristics of the NCL protein and the local characteristics near the target site.

[0036] The details are as follows:

[0037] Sense strand: GGCGATCTATTTCCCTGTATT; (SEQ ID NO.2)

[0038] Antisense strand: TACAGGGAAATAGATCGCCTT. (SEQ ID NO.3)

[0039] Note: All the bold “T” bases above can also be replaced by “U” bases.

[0040] The siRNA designed as above has excellent interference effect and has a significant effect of inhibiting HP-PRRSV infection.

[0041] AS1411 is a guanine-rich nucleic acid aptamer that can form a G-quadruplex structure and therefore has many special biological activities. The improved nucleic acid aptamer (28 bases) obtained by the present invention on the basis of the disclosed AS1411 sequence (26 bases) has a structure of T base-AS1411. It can be coupled with extracellular vesicles (EVs) to improve the targeting of EVs, which is beneficial to the treatment of related diseases through the function of EVs to carry drugs.

[0042] siRNA of the cell protein NCL and specific affinity single-stranded oligonucleotide AS1411 can inhibit the above-mentioned viral receptor (target protein) and receptor-specific affinity single-stranded oligonucleotide against highly pathogenic strains (HP-PRRSV) (the representative strain is TA-12, and the accession number of GenBank is HQ416720). The inhibitor mainly inhibits HP-PRRSV infection of cells. It has been verified through experiments that NCL siRNA and its specific affinity single-stranded oligonucleotide can stably serve as a blocker of HP-PRRSV infection of cells, which has not been used in previous studies.

[0043] In one embodiment of the present invention, the specific identification process of the viral target cell protein NCL protein and its specific affinity single-stranded oligonucleotide is given as follows:

[0044] The siRNA silencing site sequence was designed based on the NCL gene (GenBank accession number: XM_015111344.2) published by NCBI. The results of fluorescence quantitative analysis and Western blot showed that the expression of NCL mRNA and protein could be significantly reduced after NCL gene silencing (see Figure 1 B, 1D), and then HP-PRRSV was inoculated after gene silencing. Samples were collected 24 hours later, and the virus copy number, viral N protein expression, and virus copy number in the supernatant culture medium were detected by real-time PCR, Western blot, and TCID50 methods, respectively. The results showed that silencing the NCL gene could significantly reduce HP-PRRSV infection (see Figure 1 C, 1D, 1E).

[0045] The cytotoxicity test of AS1411 on Marc-145 cells was carried out, and 0-5 μM was finally selected as the safe concentration range ( Figure 2 A), and selected 5 μM AS1411 treatment 6 hours after HP-PRRSV inoculation, and collected samples 24 hours later for real-time PCR, Western blot and TCID50 detection. The results showed that 5 μM AS1411 treatment could significantly reduce HP-PRRSV infection (see Figure 2 C, 2D, 2E). At the same time, the cells were pretreated with 5μM AS1411 for 6h, and then HP-PRRSV was inoculated. After 24h, samples were collected and tested by real-time PCR, Western blot and titration. The results showed that 5μM AS1411 pretreatment could significantly reduce HP-PRRSV infection (see Figure 3To further verify the results, 1μM, 2.5μM, and 5μM AS1411 were used to conduct prevention and treatment experiments on TA-01 and TA-02 strains, respectively. The results showed that 1μM and 5μM AS1411 had a preventive effect on TA-01 infected cells (see Figure 4 A), 1μM, 2.5μM, and 5μM all had significant therapeutic effects on TA-01 infection in cells (see Figure 4 B). 1μM and 2.5μM AS1411 treatment can effectively prevent TA-02 strain (see Figure 4 C). 1μM and 2.5μM AS1411 treatment had no therapeutic effect on TA-02 strain infection, while 5μM AS1411 could significantly inhibit TA-02 strain infection (see Figure 4 D).

[0046] To further verify the role of AS1411 in HP-PRRSV infection, 1 μM and 2.5 μM AS1411 were used in PAM cells for prevention and treatment experiments. The results showed that 2.5 μM AS1411 could prevent TA-12 infection (see Figure 5 A, 5C), 1μM and 2.5μM AS1411 can treat TA-12 infection (see Figure 5 B, 5D).

[0047] Through the above research, a new HP-PRRSV cell target protein was discovered, and the inhibitory target of the receptor and the specific affinity single-stranded oligonucleotide AS1411 were found. Interference with the NCL gene or treatment with AS1411 can have a significant inhibitory effect on PRRSV-infected cells, and can be developed into a drug for the prevention and treatment of PRRSV infection, thus providing a new idea for PRRS research and prevention, expanding the scope of research, and having extremely important significance for actual production.

[0048] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0049] The test materials used in the embodiments of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Experimental methods without specifying detailed conditions are carried out in accordance with conventional test methods or in accordance with the operating instructions recommended by the supplier. Among them: the PRRSV strains used in the present invention, the HP-PRRSV type is represented by the TA-12 strain, the NADC30-like type is represented by the TA-01 strain, and the recombinant virus (the virus formed by the recombination of HP-PRRSV and NADC30-LIKE) type is represented by the TA-02 strain. The public can obtain the above-mentioned strains from the applicant within 20 years from the date of application for repeating the present invention.

[0050] Example 1: Design of NCL siRNA and its effect on PRRSV infection

[0051] Targeting the gene encoding nucleolin (shown in SEQ ID NO.1), the 566th gene silencing site was selected to synthesize siRNA and its negative control sequence (see Table 1). The synthesized sequence was diluted to 1 μM with DEPC water and dispensed into RNase-free 1.5 mL centrifuge tubes and stored at -20°C.

[0052] Marc-145 cells in good condition were selected and counted at 1.5×10 5 The cells were plated in 6-well plates at a density of 100 cells / mL and transfected with siRNA at a cell density of about 70%. RNAiMAX Reagent instructions, add 25 μL of 1 μM siRNA to each well for siRNA transfection, mix well, and culture in a 37°C, 5% CO2 incubator for 24 hours. Discard the old cell culture medium, wash the cells with pre-cooled PBS, blow down all the cells with a pipette, transfer to a new centrifuge tube, centrifuge at 2000rpm for 3 minutes, discard the supernatant, and keep the precipitate. Lyse the cells with cell lysis buffer to collect protein for Western blot verification, and extract cell RNA and reverse transcribe for fluorescence quantitative PCR verification (see Table 1 for primers used for fluorescence quantitative PCR).

[0053] Table 1: siRNA sequences and primer sequences required for the study

[0054]

[0055]

[0056] Note: In Table 1, Marc-145 cells and PAM cells were used in the present invention. Marc-145 cells are PRRSV susceptible cell lines derived from monkey kidney epithelial cells, and PAM cells are primary porcine lung macrophages. The primer sequences used to detect GAPDH in these two cell lines are different, so they are listed separately. The gene sequence of NCL is a sequence conserved by humans and monkeys, and is only used for Marc-145 cell experimental research.

[0057] In Table 1, all bold "T" bases in the siRNA can be replaced with "U" bases. The siRNA NCL and NC used in the subsequent examples are all bold "T" bases replaced with "U" bases.

[0058] The results of cell survival rate showed that silencing of NCL 566th siRNA gene had no effect on cell growth ( Figure 1 A). After silencing the NCL gene, TA-12 was inoculated, and samples were collected 24 hours later. Real-time PCR was used to detect NCL mRNA and TA-12 viral copy number ( Figure 1 B. Figure 1 C); Western blot detection of NCL and TA-12 virus N protein expression ( Figure 1 D); TCID50 method was used to detect the number of TA-12 virus copies in the supernatant culture medium ( Figure 1 E). The results showed that silencing the NCL gene could significantly reduce TA-12 infection.

[0059] Example 2: Preparation of AS1411 and its effect on PRRSV

[0060] (1) Preparation of AS1411 and its effect on cell activity

[0061] AS1411 and its control sequence cApt were designed and amplified. The specific sequences are as follows:

[0062] AS1411:TTGGTGGTGGTGGTTGTGGTGGTGGTGG.

[0063] Control (cApt): TTCCTCTCCTCCTTCTCCTCCTCCTCC.

[0064] Dilute to 100 μM with DEPC water and dispense into 1.5 mL centrifuge tubes without RNAse, and store at -20°C as the stock solution. Take 100 μM of the stock solution and dilute it into different concentrations of AS1411 (or cApt) working solution. Select Marc-145 cells in good condition and plate them on 96-well plates. When the cell density is about 70%, add different concentrations of working solution. Use CCK-8 method to measure the effect of AS1411 on cell toxicity at 24h and 48h (see Figure 2 A), and found that 0-5 μM was a non-toxic concentration.

[0065] (2) The therapeutic effect of AS1411 on TA-12

[0066] Marc-145 cells in good condition were plated on 6-well plates and cultured in a 37°C, 5% CO2 incubator for 24 hours before inoculating TA-12. 6 hours after virus inoculation, 25 μl of 5 μM AS1411 was added to each well. Protein, total RNA and supernatant culture fluid were collected 24 hours after treatment, and real-time PCR was used with primer pairs to amplify the N gene of TA-12 to study viral infection.

[0067] The control group was dripped with the same amount and concentration of cApt, and other treatments remained the same.

[0068] The results showed that AS1411 treatment did not affect the mRNA changes of NCL in the absence or presence of virus. Figure 2 B), but can significantly reduce the infection of TA-12 in cells ( Figure 2 C). Protein expression was detected by Western blot, and it was found that AS1411 treatment could inhibit TA-12 infection in cells without affecting NCL ( Figure 2 D). The TCID50 method was used to detect the number of TA-12 virus copies in the supernatant culture medium. The number of TA-12 copies in the AS1411 group was lower than that in the control group ( Figure 2 E).

[0069] Example 3: Preventive effect of AS1411 pretreatment on TA-12

[0070] Marc-145 cells in good condition were plated on 6-well plates and cultured in a 37°C, 5% CO2 incubator for 24 hours. 25 μl of AS1411 was added to each well at a concentration of 5 μM. TA-12 cells were inoculated 6 hours after treatment. Protein, total RNA and supernatant culture fluid were collected 24 hours after virus inoculation. Western blot, real-time PCR and TCID50 were used for detection.

[0071] The control group was dripped with the same amount and concentration of cApt, and other treatments remained the same.

[0072] The results showed that AS1411 treatment did not affect the mRNA and protein changes of NCL in the absence or presence of virus. Figure 3 A, 3C), AS1411 pretreatment inhibits TA-12 infection in cells ( Figure 3 B, 3C, 3D).

[0073] Example 4: Preventive and therapeutic effects of AS1411 on TA-01 / TA-02

[0074] To further verify the results, we selected three different concentrations between 0-5μM, namely 1μM, 2.5μM, and 5μM. We also conducted the same AS1411 treatment experiment on the TA-01 and TA-02 strains.

[0075] The results showed that 1μM and 5μM AS1411 had a preventive effect on NADC30-like infected cells, and the effect was extremely significant at 5μM ( Figure 4 A). 1μM, 2.5μM, and 5μM all have significant therapeutic effects on TA-01 infection in cells ( Figure 4 B). 1μM and 2.5μM AS1411 treatment can effectively prevent TA-02 strain ( Figure 4 C), 5μM AS1411 had no effect. As for treatment, 1μM and 2.5μM AS1411 treatment had no effect on the infection of TA-02 strain, but 5μM AS1411 could significantly inhibit the infection of TA-02 strain ( Figure 4 D).

[0076] Example 5: Impact of AS1411 on TA-12 on PAM

[0077] To further verify the results, primary porcine lung macrophages (PAM) were used for verification. 50-day-old SPF piglets were bled, and their lungs were aseptically removed after tracheal ligation. The outer surface was first washed with autoclaved PBS (1640 culture medium and 5× double antibody with 1 / 25 volume of PBS), and 30.0ml-50ml of pH7.2 PBS was poured into the lungs from the trachea, and the lung surface was gently tapped. The lavage fluid was recovered after 1-2 minutes, and this was repeated until the lavage fluid was clear. The recovered bronchoalveolar lavage fluid was gently blown with a pipette to break up the cell clumps, filtered with a single layer of sterile 100-mesh stainless steel sieve, and all the lavage fluid was collected. Centrifuged at 1500r / min for 5-10 minutes, and the precipitate was collected. Wash twice with PBS containing 5× double antibody, and mix gently and centrifuge each time. Then add an appropriate amount of 1×RPMI1640 (containing 2× double antibodies) nutrient solution containing 10% fetal bovine serum to disperse the cells, place them in a culture bottle or culture dish and culture them in a 37°C, 5% CO2 incubator. After they adhere to the wall, discard the supernatant and non-adherent cells and continue to culture them with 1×RPMI1640 culture solution containing 10% fetal bovine serum for later use. On PAM cells, AS1411 was treated before and 6 hours after virus inoculation, and samples were collected 24 hours later. The effect on TA-12 infection was detected by real-time PCR and Western blot.

[0078] The results showed that 2.5 μM AS1411 pre-treatment could inhibit the infection of TA-12 ( Figure 5 A, 5C), 1μM AS1411 treatment as a control had no effect. 1μM and 2.5μM AS1411 post-inoculation treatment can inhibit TA-12 infection ( Figure 5 B, 5D).

[0079] Example 6: Effect of combined use of AS1411 and siRNA on TA-12 replication

[0080] Marc-145 cells in good condition were plated on 6-well plates and cultured in a 37°C, 5% CO2 incubator for 24 hours, followed by the following treatments:

[0081] Treatment 1 (Si-NCL+AS1411): 25 μl of siRNA (Si-NCL) at a concentration of 1 μM was transfected into each well, and the cells were cultured in a cell culture incubator for 24 h before inoculating TA-12. 6 h after inoculation, 25 μl of AS1411 at a concentration of 2.5 μM was added to each well, and the cells were cultured in a cell culture incubator for 18 h. Samples were collected and the effects on TA-12 infection were detected by real-time PCR and TCID50.

[0082] Treatment 2 (Si-NCL+cApt): 25 μl of siRNA (Si-NCL) at a concentration of 1 μM was transfected into each well, and the cells were cultured in a cell culture incubator for 24 h before inoculating TA-12. 6 h after inoculation, 25 μl of cApt was added to each well at a concentration of 2.5 μM, and the cells were cultured in a cell culture incubator for 18 h. Samples were collected and the effects on TA-12 infection were detected by real-time PCR and TCID50.

[0083] Treatment 3 (Si-NC+AS1411): 25 μl of siRNA (Si-NC) at a concentration of 1 μM was transfected into each well, and the cells were cultured in a cell culture incubator for 24 h before inoculating TA-12. 6 h after inoculation, 25 μl of AS1411 at a concentration of 2.5 μM was added to each well, and the cells were cultured in a cell culture incubator for 18 h. Samples were collected and the effects on TA-12 infection were detected by real-time PCR and TCID50.

[0084] Treatment 4 (Si-NC+cApt): 25 μl of siRNA (Si-NC) at a concentration of 1 μM was transfected into each well, and the cells were cultured in a cell culture incubator for 24 h before inoculating TA-12. 6 h after inoculation, 25 μl of cApt was added to each well at a concentration of 2.5 μM, and the cells were cultured in a cell culture incubator for 18 h. Samples were collected and the effects on TA-12 infection were detected by real-time PCR and TCID50.

[0085] The results showed that the combination of siRNA and AS1411 could reduce the mRNA expression of NCL ( Figure 6 A), the improvement effect of the combination of siRNA and AS1411 (treatment 1) on the inhibitory effect of TA-12 compared with treatment 4 is superior to the sum of the improvement effects of siRNA and AS1411 alone (treatment 2, treatment 3) on the inhibitory effect of TA-12 compared with treatment 4 ( Figure 6 B, 6C). Therefore, the combination of siRNA and AS1411 has a synergistic effect in the prevention and treatment of TA-12 infection.

[0086] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. An siRNA targeting a nucleolin encoding gene, characterized in that: The sense strand of the siRNA is shown in SEQ ID NO.2, and the antisense strand is shown in SEQ ID NO.

3.

2. Use of the siRNA according to claim 1 in the preparation of a drug for blocking porcine reproductive and respiratory syndrome virus infection.

3. The use of nucleic acid aptamer AS1411 in the preparation of a drug for blocking porcine reproductive and respiratory syndrome virus infection, characterized in that: The nucleotide sequence of nucleic acid aptamer AS1411 is shown in SEQ ID NO.

4.

4. A drug for blocking porcine reproductive and respiratory syndrome virus infection, characterized in that: The drug comprises the siRNA and / or nucleic acid aptamer AS1411 as claimed in claim 1 as active ingredients; the nucleotide sequence of nucleic acid aptamer AS1411 is shown in SEQ ID NO.

4.

5. The drug according to claim 4, characterized in that The drug is prepared by mixing 1 μM siRNA and 2.5 μM nucleic acid aptamer AS1411 in a volume ratio of 1:1.

Images