Method for instant transformation of caulis sargentodoxae and application thereof

By using Agrobacterium-mediated transient transformation, we constructed expression vector plasmids and infected them with petals of *Spatholobus suberectus*, solving the problem of genetic transformation systems in *Spatholobus suberectus* and enabling rapid research on gene function and significant improvement in flavonoid synthesis pathways.

CN116004709BActive Publication Date: 2026-02-27GUANGXI BOTANICAL GARDEN OF MEDICINAL PLANTS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210906155.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-29
Publication Date
2026-02-27
Estimated Expiration
2042-07-29

AI Technical Summary

Technical Problem

In existing technologies, the construction of genetic transformation systems for *Spatholobus suberectus* is difficult, and the efficiency of obtaining stable transgenic plants is low and the cycle is long, which hinders the in-depth development of research on functional genes in woody plants.

Method used

A transient transformation method mediated by Agrobacterium was adopted. An expression vector plasmid was constructed and transformed into competent Agrobacterium tumefaciens cells. The flowers of the flowering period of *Spatholobus suberectus* were then infected with bacterial solution and subjected to shading treatment to achieve transient transformation of *Spatholobus suberectus* flowers.

Benefits of technology

This study enabled rapid research on the gene function of *Spatholobus suberectus*, significantly increasing the expression of genes related to flavonoid synthesis, particularly the upregulation of genes such as PAL, CHI, and 4CL, thus promoting research on the molecular mechanism of *Spatholobus suberectus* active ingredient synthesis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116004709B_ABST
    Figure CN116004709B_ABST
Patent Text Reader

Abstract

The application discloses a kind of instant transformation methods of caudate morindae radices, it includes the following steps: 1) constructing expression vector plasmid;2) expression vector plasmid is transferred into Agrobacterium tumefaciens competent cell, and using bacterial liquid infects caudate morindae radices full flowering petal;3) the flower of caudate morindae radices after immersion is shaded, and 12-24h is cultured overnight, that is, the instant transformation of caudate morindae radices is completed.The application also provides the application of caudate morindae radices instant transformation method in the study purpose gene regulation caudate morindae radices active ingredient synthesis.The application establishes the instant expression system suitable for the injection of Agrobacterium of caudate morindae radices, can quickly, conveniently and efficiently obtain instant transformation material, especially helpful to study caudate morindae radices active ingredient synthesis related gene.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology. More particularly, the present application relates to a method for transient transformation of Spatholobus suberectus and application thereof. BACKGROUND

[0002] Spatholobus suberectus is derived from the dry stems of Spatholobus suberectus Dunn, a perennial woody plant, and is one of the commonly used traditional Chinese medicines and the native medicinal material variety of "Guishiyi". It is recorded in ancient herbal books as "the saint medicine of blood system" and is the main raw material of Chinese patent medicines such as Jinqi Capsule and Huahong Tablet. Flavonoids are the main active ingredients of Spatholobus suberectus. The whole genome map of Spatholobus suberectus has been completed, providing a basis for functional gene research. However, for perennial woody plants, it is difficult to construct a genetic transformation system, and the efficiency of obtaining stable transgenic plants is low and the cycle is long, which hinders the in-depth study of functional genes of woody plants. The research on sterile tissue culture of Spatholobus suberectus has not been successful for many years, and the construction of a stable genetic transformation system has not been broken through. Therefore, it is particularly important to establish a rapid, efficient and convenient method for identifying the function of genes for Spatholobus suberectus, revealing the molecular mechanism of the formation of medicinal material quality.

[0003] Transient transformation is a rapid and effective method for studying the function of target genes, which not only provides the possibility for large-scale gene function screening. It has been applied in leaves, roots, flowers and calli of various plants. At present, the transient transformation method is mainly mediated by Agrobacterium, and the dipping method and dipping site will affect the transient transformation effect. Therefore, it is necessary to establish a transient transformation system for Spatholobus suberectus for the study of functional genes of Spatholobus suberectus. SUMMARY

[0004] An object of the present application is to solve at least the above problems and to provide at least the advantages to be explained later.

[0005] An object of the present application is to provide a method for transient transformation of Spatholobus suberectus, which can realize the transient transformation of target genes in Spatholobus suberectus flowers and is an effective method for rapid research on the function of Spatholobus suberectus genes.

[0006] In order to achieve these objects and other advantages of the present application, a method for transient transformation of Spatholobus suberectus is provided, comprising the following steps:

[0007] 1) Constructing an expression vector plasmid;

[0008] 2) Transferring the expression vector plasmid into Agrobacterium tumefaciens competent cells, and using bacterial liquid to infect Spatholobus suberectus petal at the full flowering stage;

[0009] 3) The dipped Spatholobus suberectus flowers are subjected to light shielding treatment, and are cultured overnight for 12-24 hours, thereby completing the transient transformation of Spatholobus suberectus.

[0010] Preferably, the expression vector is an overexpression vector, the SsMYB106 gene of Sedi can be connected with the plasmid pBI121 vector to construct the overexpression vector plasmid pBI121-SsMYB106; the SsMYB106 gene of Sedi is shown as SEQ ID NO. 1.

[0011] Preferably, in step 1), the overexpression vector plasmid carries the CaMV35S promoter, the Kanamycin vector resistance and the reporter gene.

[0012] Preferably, the reporter gene is any one of the beta-Glucuronidase, luciferase and fluorescent protein.

[0013] Preferably, in step 2), the overexpression vector plasmid is transferred into the competent cell of Agrobacterium tumefaciens GV3101 by the liquid nitrogen freeze-thaw method, and the colony PCR is used for identification, and the Sedi flower petal in the full-bloom period is infected.

[0014] Preferably, in step 2), the sterile syringe is used to rub the flower petal back to form a fine wound, the bacteria solution is slowly injected into the wound by using the sterile syringe without a needle, and the flower petal after injection is translucent.

[0015] The application of a Sedi transient transformation method in the research of the purpose gene regulating the synthesis of active ingredients of Sedi.

[0016] The application at least has the following beneficial effects: the application establishes the Agrobacterium injection penetration mediated transient expression system suitable for Sedi, and can quickly, conveniently and efficiently obtain the transient transformation material, and is particularly helpful for researching the active ingredient synthesis related genes of Sedi. By constructing the purpose gene overexpression vector and transiently transforming into the plant, the content of total flavonoids in the material can be significantly improved, and the PAL, CHI, 4CL and other genes in the flavonoid synthesis pathway are significantly up-regulated by 10-70 times, which has important significance for revealing the molecular mechanism of the quality formation of Sedi, and the method also provides a reference for researching the quality formation related genes of other perennial woody medicinal materials.

[0017] Other advantages, objects and features of the application will be partly embodied by the following description, and will be partly understood by those skilled in the art through the research and practice of the application. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 The SsMYB106 gene expression level chart in the examples and comparative examples of the application;

[0019] Figure 2 The flavonoid content analysis chart in the examples and comparative examples of the application. DETAILED DESCRIPTION

[0020] The application will be further described in details below with reference to the drawings so that those skilled in the art can implement the application according to the description and drawings.

[0021] It should be understood that the terms such as "have", "contain" and "include" used herein do not exclude the presence or addition of one or more other elements or combinations thereof.

[0022] It should be noted that the experimental methods in the following embodiments are all conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0023] <EMBODIMENT>

[0024] I. Cloning of SsMYB106 gene of Broussonetia papyrifera

[0025] The cDNA sequence (SEQ ID NO. 1) of SsMYB106 gene of Broussonetia papyrifera was obtained by the following steps:

[0026] 1) RNA extraction: Total RNA was extracted from fresh young leaves of Broussonetia papyrifera using Trizol reagent (Invitrogen, USA), and pretreated with RNase Free DNase (Promega, USA) to eliminate genomic DNA contamination; the integrity of the RNA was analyzed by 1.5% agarose gel, and the purity and concentration of the RNA were determined by spectrophotometry.

[0027] 2) First-strand cDNA synthesis: The following reagents were added to a 0.2 mL PCR tube: 5 μL Total RNA, 1 μL Random Primer p(dN)6 (100 pmol), 1 μL Rnase-free ddH2O, 70°C warm bath for 5 min, then ice bath for 2 min, centrifuge for 3-5 s; reagents: 2.0 μL 5×First-Strand Buffer, 0.25 μL Rnase inhibitor, 0.25 μL Reverse Transcriptase, 0.5 μL 10 mmol dNTP, 10.0 μL Total volume, 42°C warm bath for 60 min, 72°C warm bath for 10 min.

[0028] 3) Gene cloning: LA Taq (TaKaRa, DRR02AG) reagent was used for detection on a PCR instrument (BBI, Canada). Gene-specific primers were designed and synthesized using Primer 5.0 software,

[0029] F: ATGGGGAGGCAACCCTG (SEQ ID NO. 2)

[0030] R: CTAATGCCCCTCTTCCTTCATT (SEQ ID NO. 3)

[0031] PCR amplification procedure: 95°C 5 min; 94°C 30 s, 55°C 30 s, 72°C 30 s, 35 cycles; 72°C 8 min.

[0032] 4) PCR electrophoresis and recovery: the PCR product was run on 1% TAE agarose gel electrophoresis, the results were shown in Fig. 2, and the target fragment was recovered by column DNA gel recovery kit (Shengwu Biotech, B518131). Figure 1

[0033] 5) Ligation and transformation: the PCR purified product was ligated to pUC18-T vector to obtain pUC18-SsMYB106 vector, which was then transformed into 100 μL competent cells, 10 μL ligation solution was added, mixed gently, placed on ice for 30 min, 42°C water bath heat shock for 60 s; placed on ice for 10-15 min; added 400 μL LB medium, 37°C 200-250 rpm shaking culture for 1 h; centrifuged at 4000 rpm for 5 min at room temperature, the bacteria were spread on the plate containing ampicillin antibiotic which was pre-coated with 20 μL 100 mM IPTG and 100 μL 20 mg / mL X-gal, and inverted culture overnight.

[0034] 6) Colony PCR and sequencing: universal primers on pUC18-T vector were used for PCR. PCR amplification procedure: 95°C 3 min; 94°C 30 s, 55°C 30 s, 72°C 60 s, 25 cycles; 72°C 10 min. After the PCR product was sequenced and verified successfully, the cDNA sequence of SsMYB106 gene of Millettia pinnata was obtained, as shown in SEQ ID NO. 1.

[0035] II. Construction of overexpression vector pBI121-SsMYB106 of Millettia pinnata

[0036] 1) Double enzyme digestion: pBI121 empty vector and pUC18-SsMYB106 vector were digested with EcoRI and HindIII restriction endonuclease.

[0037] ​2) Product recovery connection: pBI121 empty vector enzyme digestion product, pUC18-SsMYB106 vector enzyme digestion product was recovered with gel recovery kit, and the two recovered products were connected with T4 ligase to obtain overexpression vector plasmid pBI121-SsMYB106. The overexpression vector plasmid pBI121-SsMYB106 carries CaMV35S promoter, kanamycin vector resistance and β-glucuronidase reporter gene; the reporter gene can also be luciferase, fluorescent protein and other reporter genes.

[0038] 3) Transformation: the overexpression vector plasmid pBI121-SsMYB106 was transformed into Agrobacterium GV3101 competent cells by liquid nitrogen freeze-thaw method, and the transformed Agrobacterium was cultured on LB solid medium containing 50 mg / L kanamycin at 28°C overnight, and single colonies were picked and cultured in LB liquid medium containing 50 mg / L kanamycin until the bacterial liquid OD 600 value reached 0.7; after colony PCR identification, Agrobacterium containing overexpression vector plasmid pBI121-SsMYB106 for transient transformation was obtained. Colony PCR primers are as follows:

[0039] F: GACCTGCAGGCATGCAAGCTTTGAGACTTTTCAACAAAGCG (SEQ ID NO. 4)

[0040] R: CGATCGGGGAAATTCGAGCTCCTAATGCCCCTCTTCCTTCAT (SEQ ID NO. 5)

[0041] III. Transient transformation of pBI121-SsMYB106

[0042] 1) Select the flowers on the Broussonetia kurroo plant in full bloom, and use a 1 mL sterile syringe to gently rub a fine wound on the back of the petal, then use a 1 mL needle-free sterile syringe to slowly inject Agrobacterium containing overexpression vector plasmid pBI121-SsMYB106 into the wound, and inject on both sides of the petal, so that the injected petal is translucent.

[0043] 2) The flowers on the Broussonetia kurroo plant after treatment need to be treated with light shielding, and after 16 h of overnight culture, sample collection is performed the next day. At least 20 flowers are treated per inflorescence, and 3 different plants are treated for three biological replicates. The flowers treated with empty vector bacterial liquid are used as negative control.

[0044] <Comparative Example 1>

[0045] The operation method of the embodiment differs in that, in step three, the transient transformation method is vacuum infiltration: flowers of *Spatholobus suberectus* during its peak flowering period are harvested, washed with sterile water, and placed in a vacuum filtration flask containing *Agrobacterium* bacterial suspension containing the overexpression vector plasmid pBI121-SsMYB106, allowing the flowers to be immersed in the bacterial suspension. Vacuum infiltration is performed at a pressure of 0.08 MPa for 2 hours, and the flask is then covered with tin foil for light protection. Each treatment is repeated in triplicate, with flowers treated with empty vector bacterial suspension serving as a control.

[0046] <Comparative Example 2>

[0047] The operation method of the embodiment differs in that, in step three, the instantaneous conversion method is vacuum impregnation: Chicken blood vine leaves are harvested, washed with sterile water, and placed in a vacuum flask containing bacterial solution, allowing the flowers to immerse in the solution. Vacuum permeation is performed at 0.08 MPa pressure for 2 hours. The flask is then covered with tin foil for light protection. Each treatment is repeated three times, with leaves treated with empty carrier bacterial solution serving as a control. Other steps are the same as in the embodiment.

[0048] <Analysis of Instantaneous Conversion Results>

[0049] (I) Identification of Transient Conversion Materials

[0050] The transient expression rate of GUS was statistically analyzed by analyzing the staining results of the experimental group materials in the examples and comparative examples using GUS histochemical staining.

[0051] The GUS staining method for the treated *Spatholobus suberectus* flowers was as follows: Prepare a GUS staining working solution (BioSharp). The prepared GUS staining working solution should be stored at -20℃ in the dark. Place *Spatholobus suberectus* flowers in a 1.5mL centrifuge tube, and add the prepared GUS staining working solution to completely cover the material. Wrap the tube in aluminum foil and incubate at room temperature for 12 hours. Transfer the material to 70% ethanol for destaining three times until the negative control material is white. The blue spots of the GUS-positive staining are very stable and do not fade in ethanol. The stained *Spatholobus suberectus* flowers were photographed under a stereomicroscope.

[0052] GUS transient expression rate (100%) = (number of staining samples / number of detections) × 100%.

[0053] According to statistics, the transient expression rates of GUS in the Example, Comparative Example 1, and Comparative Example 2 were 100%, 80%, and 20%, respectively.

[0054] (II) SsMYB106 gene expression analysis

[0055] The relative expression levels of the SsMYB106 gene in the control and experimental groups of the examples and comparative examples were analyzed using qRT-PCR. 18S was selected as the endogenous reference gene, and specific primers for qRT-PCR were designed using Primer 5.0 software.

[0056] SsMYB106-F: CTCAATAAACAGGCAGCGTCTC (SEQ ID NO. 6)

[0057] SsMYB106-R: GTCCCATAATGCTTCCACCAG (SEQ ID NO. 7)

[0058] 18S-F: CAACTCTAAAGGTCGTTTCCCA (SEQ ID NO. 8)

[0059] 18S-R: AGTGGCACCAGCGTCTACAA (SEQ ID NO. 9).

[0060] The treated Caesalpinia japonica flowers were subjected to qRT-PCR to detect the content of the target gene. The qRT-PCR method comprises the following steps:

[0061] 1) RNA extraction: FastPure Universal Plant Total RNA Isolation Kit (Vazyme, RC411) was used to extract sample RNA;

[0062] 2) Reverse transcription: Total RNA 1 μL, 4×gDNA wiper Mix 4 μL, and RNase-free ddH2O were added to an ice-bath RNase-free PCR tube to make up to 16 μL using HiScript III RT SuperMix for qPCR (+gDNA wiper) kit. The reaction solution was gently mixed by pipetting and incubated at 42°C for 2 min. Then 5×HiScript III qRT SuperMix 4 μL was added and gently mixed by pipetting. The reverse transcription reaction was performed according to the following conditions: 37°C for 15 min, 85°C for 5 s. The obtained product was stored at -20°C.

[0063] 3) qRT-PCR: ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711) was used for quantitative PCR reagent detection on StepOne Plus type fluorescent quantitative PCR instrument (ABI, USA). Primer 5.0 software was used to design and synthesize the specific primers of the target gene. The amplification program was as follows: 95°C for 30 s; 95°C for 10 s, 60°C for 30 s, 40 cycles.

[0064] The expression amount of SsMYB106 gene in different treatments was calculated by 2 -ΔΔCT Method, and the results are shown in Table 1. Figure 1Results are shown in Table 1.

[0065] The results show that the expression amount of SsMYB106 gene in the example is 37.7 times that of the control, achieving overexpression of the target gene SsMYB106. The expression amount of SsMYB106 gene in Comparative Example 1 is 3.8 times that of the control, and the expression amount of SsMYB106 gene in Comparative Example 2 is 2.3 times that of the control, indicating that the expression level of the target gene in the injection infiltration-mediated transient expression system of the Millettia pinnata flower in the example is significantly higher than that of the vacuum infiltration transient transformation method in Comparative Examples 1 and 2, and the Millettia pinnata flower in Comparative Example 1 is also better than the Millettia pinnata leaf in Comparative Example 2.

[0066] (III) Flavonoid content analysis

[0067] SsMYB106 gene has the function of regulating the synthesis of flavonoid components according to the previous experiments. Therefore, the content of total flavonoids in the transiently transformed material was determined by using a UV spectrophotometer with rutin as a control, and the results are shown in Table 2. Figure 2 The results show that the flavonoid content in the example is increased by 53.6% compared with the control, the function of SsMYB106 gene is verified, and it is further proved that the Agrobacterium injection infiltration-mediated transient expression system of Millettia pinnata in the application is successful.

[0068] (IV) SsMYB106 gene transient overexpression regulates the expression of flavonoid synthesis pathway genes

[0069] The expression amount of genes in the flavonoid biosynthesis pathway was analyzed by qRT-PCR method, and it was found that the transient overexpression of SsMYB106 gene in the example significantly up-regulated the expression levels of PAL, CHI, 4CL and other genes in the flavonoid biosynthesis pathway, which were 14.1 times, 69.5 times and 47.7 times that of the control, respectively, and the function of SsMYB106 gene was further analyzed.

[0070] Although the embodiments of the application have been disclosed as above, they are not limited to the use listed in the specification and embodiments, and can be fully applied to various fields suitable for the application, and additional modifications can be easily realized by those skilled in the art, and therefore the application is not limited to specific details and the figures shown and described herein, without departing from the general concept defined by the claims and the equivalent scope.

Claims

1. A method for instant transformation of Spatholobus suberectus, characterized by, The method comprises the following steps: 1) constructing an expression vector plasmid; The expression vector is an overexpression vector, and the Morinda officinalis How gene SsMYB106 is connected with a plasmid pBI121 vector to construct an overexpression vector plasmid pBI121 - SsMYB106 ; the Morinda officinalis How gene SsMYB106 is shown as SEQ ID NO. 1; The overexpression vector plasmid carries a CaMV35S promoter, kanamycin resistance and a reporter gene; The reporter gene is any one of β-Glucuronidase, luciferase and fluorescent protein; 2) transforming the expression vector plasmid into Agrobacterium tumefaciens competent cells, and using bacterial liquid to infect the flower petals of Spatholobus suberectus in the full-bloom period; The overexpression vector plasmid is transformed into Agrobacterium tumefaciens GV3101 competent cells by liquid nitrogen freeze-thaw method, and is identified by colony PCR to be correct, and is used to infect the flower petals of Spatholobus suberectus in the full-bloom period; A sterile syringe is used to gently rub a fine wound on the back of the petal, a sterile syringe without a needle is used to slowly inject the bacterial liquid into the wound, and the injection is performed on both sides of the petal, so that the injected petal is translucent; 3) the immersed and dyed Spatholobus suberectus flower is subjected to shading treatment, and is cultured overnight for 12-24 hours, so that the transient transformation of Spatholobus suberectus is completed.

2. The application of the Spatholobus suberectus transient transformation method in claim 1 in the study of the regulation of the target gene on the synthesis of active ingredients of Spatholobus suberectus.