Application of gene editing system in preparation of SMN1 gene mutation of spinal muscular atrophy model pig nuclear transfer donor cells

By applying gene editing systems and CRISPR/Cas9 technology to pig cells, a highly efficient spinal muscular atrophy (SMA) model pig was prepared, solving the problems of large differences between mouse models and human disease states and high costs associated with primate models. This enabled efficient disease model construction and drug research.

CN116004715BActive Publication Date: 2026-02-13NANJING KGENE GENETIC ENG CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202210973665.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-15
Publication Date
2026-02-13
Estimated Expiration
2042-08-15

AI Technical Summary

Technical Problem

Existing mouse models differ significantly from human spinal muscular atrophy in simulating the physiological and pathological state of the disease, failing to accurately reflect the human disease state. Furthermore, primate models are small, difficult to breed, and costly, making them unsuitable for effective disease research.

Method used

A gene editing system, including SMN1-gRNA3, SMN1-gRNA4 and NCN protein, was used to edit genes in pig cells via electroporation to prepare recombinant pig cells for the preparation of spinal muscular atrophy (SMA) model pigs. The SMN1 gene was knocked out using CRISPR/Cas9 technology, and the model pigs were cultured using somatic cell nuclear transfer technology.

Benefits of technology

A highly efficient spinal muscular atrophy (SMA) model pig was successfully constructed with a gene editing efficiency of up to 93.8%, providing effective experimental data for drug screening, efficacy evaluation, gene therapy, and cell therapy. This also shortened the model pig production cycle and reduced costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003797860730000091
    Figure BDA0003797860730000091
  • Figure BDA0003797860730000101
    Figure BDA0003797860730000101
  • Figure HDA0003797860740000011
    Figure HDA0003797860740000011
Patent Text Reader

Abstract

The application discloses application of a gene editing system in preparation of a spinal muscular atrophy model pig nuclear transfer donor cell with SMN1 gene mutation. The application provides application of SMN1-gRNA3 shown in SEQ ID NO: 16, SMN1-gRNA4 shown in SEQ ID NO: 17 and NCN protein in preparation of a kit. The application also provides a method for preparing a recombinant pig cell: SMN1-gRNA3, SMN1-gRNA4 and NCN protein are co-transfected into a pig cell to obtain a recombinant pig cell. The recombinant pig cell is a recombinant pig cell with SMN1 gene mutation. The kit is used for: preparing a recombinant pig cell; preparing a spinal muscular atrophy model pig; preparing a spinal muscular atrophy cell model or a spinal muscular atrophy tissue model or a spinal muscular atrophy organ model. The application has great application value for research and development of spinal muscular atrophy drugs and revealing the pathogenesis of the disease.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, specifically to the field of gene editing technology, and more particularly relates to application of a gene editing system in preparation of a spinal muscular atrophy model pig nuclear transfer donor cell with SMN1 gene mutation. BACKGROUND

[0002] Spinal muscular atrophy (SMA) is a kind of autosomal recessive genetic disease caused by degeneration of anterior horn motor neurons in the spinal cord, resulting in muscle weakness and muscle atrophy. The disease has large differences in clinical manifestations. According to the age of onset and clinical course of patients, SMA is divided into four types from severe to mild. The common characteristics are degeneration of anterior horn cells in the spinal cord, and clinical manifestations are progressive, symmetrical, extensive, flaccid paralysis and muscle atrophy mainly in the proximal limbs, normal intelligence and sensation. The earlier the disease occurs, the worse the prognosis.

[0003] Spinal muscular atrophy can be caused by various gene mutations, and the gene mutation of motor neuron survival gene 1 (SMN1) is the main cause of the disease. The single copy inactivation (asymptomatic) of SMN1 gene is about 1 / 50 in Asian population, which causes about 1 / 10000 of neonatal morbidity. Motor neuron survival protein 1 encoded by SMN1 gene is an important part of spliceosome, and spliceosome complex plays a catalytic role in the assembly of small nuclear ribonucleoprotein, so SMN1 gene plays an important role in the splicing of pre-mRNA.

[0004] The development of animal models is necessary for the study of the mechanism of the occurrence and development of spinal muscular atrophy and the development of corresponding drugs. The commonly used animal model is a mouse model. However, mice are quite different from humans in terms of size, organ size, physiology, pathology, etc., and cannot truly simulate the normal physiological and pathological state of humans. Pigs, as large animals, are similar to humans in size and physiological function, are easy to breed in large quantities, and have lower requirements in terms of ethics and animal protection, making them ideal animal models for human diseases.

[0005] Gene editing is a biological technology that has made significant progress in recent years, including gene editing based on homologous recombination, ZFN, TALEN, CRISPR / Cas9, etc. CRISPR / Cas9 technology is the most advanced gene editing technology at present. Currently, gene editing technology is increasingly applied to the production of animal models. SUMMARY

[0006] The purpose of the present application is to provide the application of a gene editing system in preparation of a spinal muscular atrophy model pig nuclear transfer donor cell with SMN1 gene mutation.

[0007] The application provides application of SMN1-gRNA3, SMN1-gRNA4 and NCN protein in preparation of a kit.

[0008] The application also provides application of SMN1-gRNA3, SMN1-gRNA4 and PRONCN protein in preparation of a kit.

[0009] The application also provides application of SMN1-gRNA3, SMN1-gRNA4 and specific plasmid in preparation of a kit.

[0010] The application provides a kit comprising SMN1-gRNA3, SMN1-gRNA4 and NCN protein.

[0011] The application also provides a kit comprising SMN1-gRNA3, SMN1-gRNA4 and PRONCN protein.

[0012] The application also provides a kit comprising SMN1-gRNA3, SMN1-gRNA4 and specific plasmid.

[0013] The kit described above also comprises a pig cell.

[0014] The kit described above is used for the following (a) or (b) or (c): (a) preparation of a recombinant pig cell; (b) preparation of a spinal muscular atrophy model pig; (c) preparation of a spinal muscular atrophy cell model or a spinal muscular atrophy tissue model or a spinal muscular atrophy organ model.

[0015] The application provides a method for preparing a recombinant pig cell, comprising the following steps: co-transfecting a pig cell with SMN1-gRNA3, SMN1-gRNA4 and NCN protein to obtain a recombinant pig cell.

[0016] The co-transfection is specifically performed by means of electroporation transfection.

[0017] The parameter setting of the electroporation transfection can be specifically 1450V, 10ms, 3pulse.

[0018] The co-transfection can be specifically performed by using a mammalian nucleic transfection kit (Neon kit, Thermofisher) and a NeonTM transfection system electroporator.

[0019] The ratio of SMN1-gRNA3, SMN1-gRNA4 and NCN protein is 0.8-1.2ug SMN1-gRNA3: 0.8-1.2ug SMN1-gRNA4: 3-5ug NCN protein.

[0020] The ratio of SMN1-gRNA3, SMN1-gRNA4 and NCN protein is 1 μg SMN1-gRNA3: 1 μg SMN1-gRNA4: 4 μg NCN protein, respectively.

[0021] The ratio of pig cell, SMN1-gRNA3, SMN1-gRNA4 and NCN protein is 100,000 pig cells: 0.8-1.2 μg SMN1-gRNA3: 0.8-1.2 μg SMN1-gRNA4: 3-5 μg NCN protein, respectively.

[0022] The ratio of pig cell, SMN1-gRNA3, SMN1-gRNA4 and NCN protein is 100,000 pig cells: 1 μg SMN1-gRNA3: 1 μg SMN1-gRNA4: 4 μg NCN protein, respectively.

[0023] The SMN1-gRNA3 is sgRNA, and the target sequence binding region is shown in SEQ ID NO: 16.

[0024] Specifically, the SMN1-gRNA3 is shown in SEQ ID NO: 16.

[0025] Specifically, the SMN1-gRNA3 is shown in SEQ ID NO: 12.

[0026] The SMN1-gRNA4 is sgRNA, and the target sequence binding region is shown in SEQ ID NO: 17.

[0027] Specifically, the SMN1-gRNA4 is shown in SEQ ID NO: 17.

[0028] Specifically, the SMN1-gRNA4 is shown in SEQ ID NO: 13.

[0029] The NCN protein is Cas9 protein or fusion protein with Cas9 protein.

[0030] Specifically, the NCN protein is shown in SEQ ID NO: 3.

[0031] The pig cell is pig fibroblast.

[0032] The pig cell is pig primary fibroblast.

[0033] The pig cell is pig primary fibroblast obtained from newborn pig.

[0034] The method for preparing the NCN protein comprises the following steps:

[0035] (1) introducing the plasmid pKG-GE4 into Escherichia coli BL21(DE3) to obtain a recombinant bacterium;

[0036] (2) culturing the recombinant bacterium in a liquid medium at 30°C, then adding IPTG and inducing culture at 25°C, and then collecting the bacterial bodies;

[0037] (3) subjecting the collected bacterial bodies to cell disruption, and collecting a crude protein solution;

[0038] (4) purifying the fusion protein with His6 tag from the crude protein solution by affinity chromatography;

[0039] (5) subjecting the fusion protein with His6 tag to enterokinase digestion with His6 tag, and then removing the protein with His6 tag by Ni-NTA resin to obtain the purified NCN protein;

[0040] The fusion gene shown in SEQ ID NO: 1 at positions 5209-9852 is in the plasmid pKG-GE4.

[0041] The method for preparing the NCN protein comprises the following steps:

[0042] (1) introducing the plasmid pKG-GE4 into Escherichia coli BL21(DE3) to obtain a recombinant bacterium.

[0043] (2) inoculating the recombinant bacterium obtained in step (1) into a liquid LB medium containing ampicillin, and subjecting to shaking culture;

[0044] (3) inoculating the bacterial solution obtained in step (2) into a liquid LB medium, and subjecting to shaking culture at 30°C and 230 rpm until the OD value is 1.0, then adding IPTG to make the concentration in the system be 0.5 mM, and then subjecting to shaking culture at 25°C and 230 rpm for 12 hours, and then centrifuging to collect the bacterial bodies; 600nm

[0045] (4) taking the bacterial bodies obtained in step (3), and washing with PBS buffer;

[0046] (5) taking the bacterial bodies obtained in step (4), adding a crude extraction buffer and suspending the bacterial bodies, then subjecting to cell disruption, then centrifuging to collect the supernatant, filtering by a filter membrane with a pore size of 0.22 μm, and collecting the filtrate;

[0047] (6) purifying the fusion protein with His6 tag (the fusion protein shown in SEQ ID NO: 2) from the filtrate obtained in step (5) by affinity chromatography; ​

[0048] (7) Take the post-column solution collected in step (6), concentrate using an ultrafiltration tube, and then dilute with 25 mM Tris-HCl (pH 8.0);

[0049] (8) Add recombinant bovine enterokinase with a His6 tag to the solution obtained in step (7) and perform enzyme digestion;

[0050] (9) Mix the solution after completion of step (8) with Ni-NTA resin, incubate, and then centrifuge to collect the supernatant;

[0051] (10) Take the supernatant obtained in step (9), concentrate using an ultrafiltration tube, and then add enzyme storage solution, which is the NCN protein solution.

[0052] The specific method for purifying the fusion protein with a His6 tag from the filtrate obtained in step (5) using affinity chromatography is as follows:

[0053] First, equilibrate the Ni-NTA sepharose column with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then load 50 ml of the filtrate obtained in step (5) at a flow rate of 0.5-1 ml / min; then wash the column with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then wash the column with 5 column volumes of buffer to remove impurities at a flow rate of 1 ml / min; then elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0054] Any of the above-mentioned PRONCN proteins comprises, from upstream to downstream, the following elements: a signal peptide, a chaperone protein, a protein tag, a protease enzyme digestion site, a nuclear localization signal, a Cas9 protein, and a nuclear localization signal.

[0055] The signal peptide functions to promote secretory expression of the protein. The signal peptide can be selected from the signal peptide of Escherichia coli alkaline phosphatase (phoA), the signal peptide of Staphylococcus aureus protein A, the signal peptide of Escherichia coli outer membrane protein (ompa), or the signal peptide of any other prokaryotic gene, and is preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide secretory expression of the target protein into the periplasmic cavity of bacteria, thereby separating the target protein from intracellular bacterial proteins, and the target protein secreted into the periplasmic cavity of bacteria is expressed in a soluble form and can be cleaved by a signal peptide enzyme in the periplasmic cavity.

[0056] The function of the chaperone protein is to increase the solubility of the protein. The chaperone can be any protein that helps form disulfide bonds, preferably a thioredoxin protein (TrxA protein). The thioredoxin protein, which can act as a chaperone to help the co-expressed target protein (e.g. Cas9 protein) form disulfide bonds, improve protein stability, folding accuracy, increase the solubility and activity of the target protein.

[0057] The function of the protein tag is for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag, or any other protein tag, and is further preferably a His tag. The His tag can bind to a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, greatly simplifying the purification process of the target protein.

[0058] The function of the protease cleavage site is to remove the non-functional segment after purification to release the native form of the Cas9 protein. The protease can be selected from enterokinase, factor Xa, thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endoprotease, and is further preferably enterokinase. EK is the enterokinase cleavage site, which facilitates the removal of the fused TrxA-His segment using enterokinase to obtain the native form of the Cas9 protein. After the application uses commercial enterokinase to cleave the fusion protein with a His tag, the TrxA-His segment and the enterokinase with a His tag can be removed by one-step affinity chromatography to obtain the native form of the Cas9 protein, avoiding damage and loss of the target protein caused by multiple purification and dialysis.

[0059] The nuclear localization signal can be any nuclear localization signal, preferably an SV40 nuclear localization signal and / or a nucleoplasmin nuclear localization signal. NLS is a nuclear localization signal, and one NLS site is designed at the N- and C-termini of Cas9, respectively, so that Cas9 can more effectively enter the nucleus for gene editing.

[0060] The Cas9 protein can be saCas9 or spCas9, and is preferably a spCas9 protein.

[0061] The PRONCN protein is specifically shown in SEQ ID NO: 2.

[0062] Any of the above-mentioned specific plasmids comprises the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a coding gene of a PRONCN protein, and a terminator.

[0063] The promoter can be specifically a T7 promoter. The T7 promoter is a strong promoter for prokaryotic expression, and can efficiently drive the expression of an exogenous gene.

[0064] The operon can be specifically a Lac operon. The Lac operon is a regulatory element for lactose-induced expression, and can be used to induce the expression of a target protein at low temperature after the bacteria grow to a certain amount, so as to avoid the influence of the early expression of the target protein on the growth of the host bacteria, and significantly improve the solubility of the expressed target protein.

[0065] The ribosome binding site is a ribosome binding site during protein translation, and is necessary for protein translation.

[0066] The terminator can be specifically a T7 terminator. The T7 terminator can effectively terminate the transcription of a target gene at the end of the target gene, so as to avoid the transcription and translation of other downstream sequences other than the target gene.

[0067] For the codons of the spCas9 protein, the codons thereof are optimized in the present application to completely adapt to the codon bias of the selected E. coli high-efficiency expression strain E. coli BL21 (DE3), so as to improve the expression level of the Cas9 protein.

[0068] The T7 promoter is shown as nucleotides 5121-5139 in SEQ ID NO: 1.

[0069] The Lac operon is shown as nucleotides 5140-5164 in SEQ ID NO: 1.

[0070] The ribosome binding site is shown as nucleotides 5178-5201 in SEQ ID NO: 1.

[0071] The coding sequence of the alkaline phosphatase signal peptide is shown as nucleotides 5209-5271 in SEQ ID NO: 1.

[0072] The coding sequence of the TrxA protein is shown as nucleotides 5272-5598 in SEQ ID NO: 1.

[0073] The coding sequence of the His-Tag is shown as nucleotides 5620-5637 in SEQ ID NO: 1.

[0074] The coding sequence of the enterokinase cleavage site is shown as nucleotides 5638-5652 in SEQ ID NO: 1.

[0075] The coding sequence of the nuclear localization signal is shown as nucleotides 5656-5670 in SEQ ID NO: 1.

[0076] The coding sequence of the spCas9 protein is shown as nucleotides 5701-9801 in SEQ ID NO: 1.

[0077] The coding sequence of the nuclear localization signal is shown as nucleotides 9802-9849 in SEQ ID NO: 1.

[0078] The T7 terminator is shown as nucleotides 9902-9949 in SEQ ID NO: 1.

[0079] Specifically, the specific plasmid is plasmid pKG-GE4.

[0080] The plasmid pKG-GE4 has a DNA molecule shown as nucleotides 5121-9949 in SEQ ID NO: 1.

[0081] Specifically, the plasmid pKG-GE4 is shown as SEQ ID NO: 1.

[0082] The present application also protects the recombinant pig cell prepared by any of the above-mentioned methods.

[0083] The recombinant pig cell is a recombinant pig cell with a mutated SMN1 gene.

[0084] The recombinant pig cell can be a single cell clone with a genotype of heterozygous, double alleles with the same mutation, or double alleles with different mutations in Table 1.

[0085] The present application also protects the use of the recombinant pig cell in preparing a spinal muscular atrophy model pig.

[0086] The recombinant pig cell is used as a nuclear transfer donor cell for somatic cell cloning, and a cloned pig, i.e., a spinal muscular atrophy model pig, can be obtained.

[0087] The present application also protects the pig tissue of the model pig prepared using the recombinant pig cell, i.e., a spinal muscular atrophy tissue model.

[0088] The present application also protects the pig organ of the model pig prepared using the recombinant pig cell, i.e., a spinal muscular atrophy organ model.

[0089] The present application also protects the pig cell of the model pig prepared using the recombinant pig cell, i.e., a spinal muscular atrophy cell model.

[0090] The present application also protects the use of the recombinant pig cell, the spinal muscular atrophy tissue model, the spinal muscular atrophy organ model, the spinal muscular atrophy cell model, or the spinal muscular atrophy model pig, which is as follows (d1) or (d2) or (d3) or (d4):

[0091] (d1) screening drugs for treating spinal muscular atrophy;

[0092] (d2) performing efficacy evaluation of drugs for spinal muscular atrophy;

[0093] (d3) performing efficacy evaluation of gene therapy and / or cell therapy for spinal muscular atrophy;

[0094] (d4) studying pathogenesis of spinal muscular atrophy.

[0095] The pig according to any one of the above embodiments can be a Jiangxiang pig.

[0096] The pig according to any one of the above embodiments can be a newborn Jiangxiang pig.

[0097] The pig according to any one of the above embodiments can be a Bama Xiang pig.

[0098] The pig according to any one of the above embodiments can be a newborn Bama Xiang pig.

[0099] The spinal muscular atrophy according to any one of the above embodiments is caused by mutation of the SMN1 gene.

[0100] Pig SMN1 gene information: survival motor neuron 1, located on chromosome 16, Gene ID: 100170853, Sus scrofa.

[0101] The amino acid sequence of the protein encoded by the pig SMN1 gene is shown in SEQ ID NO: 8.

[0102] The pig SMN1 gene has a DNA segment shown in SEQ ID NO: 9.

[0103] The mutation according to any one of the above embodiments is deletion and / or insertion and / or substitution of one or more nucleotides.

[0104] The mutation according to any one of the above embodiments is deletion of one or more nucleotides.

[0105] The mutation according to any one of the above embodiments is insertion of one or more nucleotides.

[0106] The mutation according to any one of the above embodiments is deletion and insertion of one or more nucleotides.

[0107] Compared with the prior art, the present application has at least the following beneficial effects:

[0108] (1) The research object (pig) of the present application has better applicability than other animals (mice, primates).

[0109] Rodents such as mice and rats are very different from humans in terms of body size, organ size, physiology, pathology, and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that more than 95% of drugs that are effective in mice and rats are ineffective in human clinical trials. As for large animals, primates are the closest animals to humans, but they are small in size, mature late (6-7 years old for mating), and are single-birth animals, with a very slow population expansion rate and a high cost of feeding. In addition, cloning of primates is low in efficiency, difficult, and high in cost.

[0110] Pigs, as model animals, do not have the above-mentioned shortcomings. Pigs are the closest animals to humans, except for primates, and are similar to humans in terms of body size, weight, organ size, and the like, and are very similar to humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, and the like. At the same time, pigs mature early (4-6 months old), have high reproductive capacity, and have multiple offspring per litter, and a large population can be formed within 2-3 years. In addition, the cloning technology of pigs is very mature, and the cloning and feeding costs are much lower than those of primates. Therefore, pigs are very suitable as animal models for human diseases.

[0111] (2) The vector constructed by the application uses the strong promoter T7-lac which can efficiently express the target protein to express the target protein, and uses the signal peptide of the bacterial periplasmic alkaline phosphatase (phoA) to guide the secretion expression of the target protein into the bacterial periplasmic cavity, so as to separate the target protein from the intracellular protein of the bacterium, and the target protein secreted into the bacterial periplasmic cavity is soluble expression. Meanwhile, the Cas9 protein is expressed in fusion with the thioredoxin TrxA, and the TrxA can help the co-expressed target protein to form a disulfide bond, improve the stability and folding correctness of the protein, and increase the solubility and activity of the target protein. In order to facilitate the purification of the target protein, a His tag is designed, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein. Meanwhile, an enterokinase cleavage site is designed after the His tag, which facilitates the removal of the fused TrxA-His polypeptide fragment, so as to obtain the natural form of the Cas9 protein. After the fusion protein is cleaved by the enterokinase with the His tag, the TrxA-His polypeptide fragment and the enterokinase with the His tag can be removed by one-step affinity chromatography, so as to obtain the natural form of the Cas9 protein, which avoids the damage and loss of the target protein caused by multiple purifications and dialysis. Meanwhile, an NLS site is designed at the N and C terminals of the Cas9, so that the Cas9 can more effectively enter the nucleus for gene editing. In addition, the E. coli BL21(DE3) strain is selected as the target protein expression strain, which can efficiently express the foreign genes cloned in the expression vector (such as pET-32a) containing the bacteriophage T7 promoter. Meanwhile, the codons of the Cas9 protein are optimized to adapt to the codon bias of the expression strain, so as to improve the expression level of the target protein. In addition, the expression of the target protein is induced by IPTG at low temperature after the bacteria grow to a certain number, which can avoid the influence of the premature expression of the target protein on the growth of the host bacteria, and the induction expression at low temperature also significantly improves the solubility of the expressed target protein. After the above optimization design and experimental implementation, the activity of the obtained Cas9 protein is significantly higher than that of the commercial Cas9 protein.

[0112] (3) The Cas9 high-efficiency protein combination constructed and expressed by the application is combined with the in vitro transcribed gRNA for gene editing, and the optimal dosage ratio of Cas9 and gRNA is optimized, and finally the ratio of the gene editing single cell clone reaches 93.8%, which is much higher than the conventional gene editing efficiency (10-30%).

[0113] (4) The target gene knockout single cell clone strain obtained by the application can be directly used for somatic cell nuclear transfer animal cloning to obtain a cloned pig with a target gene knockout, and the gene variation can be stably inherited.

[0114] The method of fertilized egg microinjection of gene editing material and then embryo transfer in the mouse model making has a relatively low probability of directly obtaining gene mutant offspring, and needs hybrid breeding of offspring, and is not suitable for long gestation period of large animals (such as pigs) model making. Therefore, the application adopts the primary cell in vitro editing with high technical difficulty and high challenge, and the Cas9 protein and double gRNA cutting and screening positive editing single cell clone method, and then directly obtains the corresponding disease model pig through the somatic cell nuclear transfer animal cloning technology, so that the model pig making cycle can be greatly shortened and manpower, material resources and financial resources can be saved.

[0115] The application adopts the CRISPR / Cas9 technology combined with double gRNA editing to knockout the SMN1 gene, simulates the genetic characteristics of spinal muscular atrophy, and obtains the single cell clone of the SMN1 gene knockout, which lays a foundation for cultivating the spinal muscular atrophy model pig through the somatic cell nuclear transfer animal cloning technology in the later period. The application will help to research and reveal the pathogenesis of spinal muscular atrophy caused by abnormal function of the SMN1 gene, and can be used for drug screening, drug efficacy evaluation, gene therapy and cell therapy research, can provide effective experimental data for further clinical application, and further provides a powerful experimental means for successfully treating human spinal muscular atrophy. The application has great application value for research and development of spinal muscular atrophy drugs and revealing the pathogenesis of the disease. BRIEF DESCRIPTION OF DRAWINGS

[0116] Figure 1 The alignment result of forward sequencing of the single cell clone numbered 3 with the wild type sequence.

[0117] Figure 2 The alignment result of forward sequencing of the single cell clone numbered 27 with the wild type sequence.

[0118] Figure 3 The alignment result of forward sequencing of the single cell clone numbered 14 with the wild type sequence.

[0119] Figure 4 The alignment result of forward sequencing of the single cell clone numbered 11 with the wild type sequence.

[0120] Figure 5 It is the electropherogram of PCR amplification with different primer pairs using the ear tissue of a pig named BX4 in Example 2 as a template.

[0121] Figure 6 It is the electropherogram of PCR amplification with the primer pair composed of SMN1-E1-JDF74 and SMN1-E1-JDR429 using the genomic DNA of 10 pigs as a template in Example 2.

[0122] Figure 7 Figure 1 is a structural schematic diagram of plasmid pET-32a.

[0123] Figure 8 Figure 2 is a structural schematic diagram of plasmid pKG-GE4.

[0124] Figure 9 Figure 3 is an electropherogram of gRNA and NCN protein dosage ratio optimization in Example 4.

[0125] Figure 10 Figure 4 is an electropherogram of NCN protein and commercial Cas9 protein gene editing efficiency comparison in Example 4. DETAILED DESCRIPTION

[0126] The application will be further described in conjunction with the specific embodiments, and the examples given are only for the purpose of illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0127] The experimental methods in the following examples are all routine methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified. The recombinant plasmids constructed in the examples have been sequenced and verified. Commercial Cas9-A protein is a commercially available Cas9 protein with good effect. Commercial Cas9-B protein is a commercially available Cas9 protein with good effect. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, 5% CO2, 5% O2 in a constant temperature incubator.

[0128] The porcine primary fibroblasts used in Example 1 and Example 2 were prepared from the ear tissue of a newborn Bama mini-pig. The porcine primary fibroblasts used in Example 4 were prepared from the ear tissue of a newborn Congjiang mini-pig. The method for preparing porcine primary fibroblasts from porcine ear tissue is as follows: 1) Take 0.5 g of porcine ear tissue, remove the hair and bone tissue, then immerse in 75% alcohol for 30-40 s, then wash with PBS buffer containing 5% (v / v) Penicillin-Streptomycin (Gibco) for 5 times, then wash with PBS buffer once; 2) Cut the tissue into small pieces with scissors, then digest with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 h, then centrifuge at 500g for 5 min, discard the supernatant; 3) Resuspend the precipitate with 1 mL of complete culture medium, then plate into a 10 cm diameter cell culture dish containing 10 mL of complete culture medium and sealed with 0.2% gelatin (VWR), culture until the cells grow to about 60% of the bottom of the dish; 4) After completing step 3, digest and collect the cells with trypsin, then resuspend in complete culture medium. The cells are used for subsequent electroporation experiments.

[0129] The plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in the patent application 202010084343.6. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 395-680 constitute a CMV enhancer, the nucleotides 682-890 constitute an EFla promoter, the nucleotides 986-1006 encode a nuclear localization signal (NLS), the nucleotides 1016-1036 encode a nuclear localization signal (NLS), the nucleotides 1037-5161 encode a Cas9 protein, the nucleotides 5162-5209 encode a nuclear localization signal (NLS), the nucleotides 5219-5266 encode a nuclear localization signal (NLS), the nucleotides 5276-5332 encode a polypeptide P2A (the amino acid sequence of the polypeptide P2A is “ATNFSLLKQAGDVEENPGP”, and the cleavage site is between the first and the second amino acid residues from the C terminus), the nucleotides 5333-6046 encode an EGFP protein, the nucleotides 6056-6109 encode a polypeptide T2A (the amino acid sequence of the polypeptide T2A is “EGRGSLLTCGDVEENPGP”, and the cleavage site is between the first and the second amino acid residues from the C terminus), the nucleotides 6110-6703 encode a Puromycin protein (referred to as Puro protein), the nucleotides 6722-7310 constitute a WPRE sequence element, the nucleotides 7382-7615 constitute a 3’LTR sequence element, and the nucleotides 7647-7871 constitute a bGH poly(A) signal sequence element. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 911-6706 form a fusion gene, which expresses a fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms three proteins: a protein with the Cas9 protein, a protein with the EGFP protein, and a protein with the Puro protein.

[0130] The pKG-U6gRNA vector, i.e., the plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in the patent application 202010084343.6. In SEQ ID NO: 3 in the patent application 202010084343.6, the nucleotides 2280-2539 constitute a hU6 promoter, and the nucleotides 2558-2637 are used for transcription to form a gRNA backbone. When used, a DNA molecule with a length of about 20 bp (a target sequence binding region used for transcription to form a gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain a gRNA.

[0131] Example 1, Preparation of SMN1 gene knockout Bama mini-pig single cell clone

[0132] Two high-efficiency gRNA target points (SMN1-E1-gRNA3 target point and SMN1-E1-gRNA4 target point) were obtained by screening of Example 2.

[0133] The NCN protein was provided by the NCN protein solution prepared in Example 3.

[0134] I. Preparation of gRNA

[0135] 1. Preparation of SMN1-T7-gRNA3 transcription template and SMN1-T7-gRNA4 transcription template

[0136] The SMN1-T7-gRNA3 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 14.

[0137] The SMN1-T7-gRNA4 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 15.

[0138] 2. In vitro transcription to obtain gRNA

[0139] Take SMN1-T7-gRNA3 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification to obtain SMN1-gRNA3. SMN1-gRNA3 is a single-stranded RNA, as shown in SEQ ID NO: 16.

[0140] Take SMN1-T7-gRNA4 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification to obtain SMN1-gRNA4. SMN1-gRNA4 is a single-stranded RNA, as shown in SEQ ID NO: 17.

[0141] SMN1-gRNA3 (SEQ ID NO: 16):

[0142] GGCGGCGGCAGCGGUGUUCCUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0143] SMN1-gRNA4 (SEQ ID NO: 17):

[0144] GGCGGAGGACUCGGUGCUGUUCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

[0145] II. Transfection of porcine primary fibroblasts

[0146] 1. Co-transfect SMN1-gRNA3, SMN1-gRNA4 and NCN protein into porcine primary fibroblasts. Ratio: about 100,000 porcine primary fibroblasts: 1 pg SMN1-gRNA3: 1 pg SMN1-gRNA4: 4 pg NCN protein. Co-transfection is performed by electroporation, using the Neon kit (Thermofisher) and the Neon™ transfection system electroporator (parameters set at: 1450V, 10ms, 3 pulses).

[0147] 2. After step 1 is completed, use complete culture medium to culture for 16-18 hours, then replace with new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0148] 3. After step 2 is completed, use trypsin to digest and collect the cells, then wash with complete culture medium, then resuspend with complete culture medium, then pick each single clone and transfer to a 96-well plate (1 cell per well, each well contains 100 pl of complete culture medium), and culture for 2 weeks (replace with new complete culture medium every 2-3 days).

[0149] 4. After step 3 is completed, use trypsin to digest and collect the cells (the cells obtained in each well, about 2 / 3 are inoculated into a 6-well plate containing complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0150] 5. Take the 6-well plate of step 4, culture until the cells reach 80% confluence, use trypsin to digest and collect the cells, and use cell freezing solution (90% complete culture medium + 10% DMSO, by volume) to freeze the cells.

[0151] 6. Take the centrifuge tube from step 4, collect the cells, lyse the cells and extract genomic DNA. Perform PCR amplification using primer pairs consisting of SMN1-E1-JDF74 and SMN1-E1-JDR429, followed by electrophoresis. Use porcine primary fibroblasts as wild-type controls (WT).

[0152] 7. After completing step 6, recover the PCR amplification products and sequence them.

[0153] If a single-cell clone has only one sequencing result, its genotype is wild-type (also known as homozygous wild-type). If a single-cell clone has two sequencing results, one consistent with the sequencing result of a primary porcine fibroblast and the other showing a mutation (including deletion, insertion, or substitution of one or more nucleotides), the genotype of that single-cell clone is heterozygous. If a single-cell clone has two sequencing results, both showing mutations (including deletion, insertion, or substitution of one or more nucleotides) compared to the sequencing result of a primary porcine fibroblast, the genotype of that single-cell clone is biallelic mutant. If a single-cell clone has only one sequencing result and shows a mutation (including deletion, insertion, or substitution of one or more nucleotides) compared to the sequencing result of a primary porcine fibroblast, the genotype of that single-cell clone is biallelic mutant. If a single-cell clone has only one sequencing result and is consistent with the sequencing result of a primary porcine fibroblast, the genotype of that single-cell clone is wild-type (also known as homozygous wild-type).

[0154] The results are shown in Table 1. Single-cell clones numbered 3 and 8 had wild-type genotypes. Single-cell clones numbered 7, 10, 20, 27, and 31 had heterozygous genotypes. Single-cell clones numbered 1, 4, 5, 9, 12, 13, 14, 15, 17, 18, 19, 21, 22, 23, 24, 25, 28, 29, 30, and 32 had biallelic mutant genotypes. Single-cell clones numbered 2, 6, 11, 16, and 26 had biallelic mutant genotypes. The success rate of obtaining SMN1 gene-edited single-cell clones was 93.8%.

[0155] Example sequencing alignment results can be found in Figures 1 to 4 . Figure 1 The result is the alignment of the forward sequencing of single-cell clone number 3 with the wild-type sequence, and it is determined to be wild-type. Figure 2 The results of forward sequencing of single-cell clone number 27 were compared with the wild-type sequence, and it was determined to be heterozygous. Figure 3 The results are the alignment of the forward sequencing of single-cell clone number 14 with the wild-type sequence, showing different biallelic mutants. Figure 4is the alignment result of single cell clone No. 11 forward sequencing and wild type sequence, which is biallelic same mutant type.

[0156] Table 1 Genotype determination results of SMN1 gene editing single cell clones

[0157]

[0158]

[0159] The single cell clones of the above hybrid type, biallelic same mutant type and biallelic different mutant type are all target single cell clones. The cells are used as nuclear transfer donor cells for somatic cloning, and a cloned pig can be obtained, which is a spinal muscular atrophy model pig.

[0160] Example 2, Screening of SMN1 gene high-efficiency gRNA target sites

[0161] Pig SMN1 gene information: survival motor neuron 1, located on chromosome 16, Gene ID is 100170853, Sus scrofa. The amino acid sequence of the protein encoded by pig SMN1 gene is shown in SEQ ID NO: 8. In pig genomic DNA, SMN1 gene has a total of 10 exons, and the first coding exon and its upstream and downstream 250 bp are shown in SEQ ID NO: 9.

[0162] I. Analysis of the conservation of the SMN1 gene pre-set deletion region and adjacent genomic sequence

[0163] 10 newborn Bama miniature pigs, 6 females (named BC1, BC2, BC3, BC4, BC5, BC6, respectively) and 4 males (named BX1, BX2, BX3, BX4, respectively).

[0164] SMN1-E1-JDF74: CAGAGAAGAAACACCAAAGCGG;

[0165] SMN1-E1-JDR475: TTGAGGCTCCCAAATGGGTAAA;

[0166] SMN1-E1-JDF125: TCCTAAAGCGCTGGTTGTTACT;

[0167] SMN1-E1-JDR429: CCTGGGCAGTAAGCGGAC.

[0168] The genomic DNA extracted from the ear tissue of the pig named BX4 was used as a template, different primer pairs were used for PCR amplification, and then 1% agarose gel electrophoresis was performed. The electrophoresis map is shown in Figure 5. Figure 5 Group 1: primer pair consisting of SMN1-E1-JDF74 and SMN1-E1-JDR429; Group 2: primer pair consisting of SMN1-E1-JDF74 and SMN1-E1-JDR475; Group 3: primer pair consisting of SMN1-E1-JDF125 and SMN1-E1-JDR429; Group 4: primer pair consisting of SMN1-E1-JDF125 and SMN1-E1-JDR475. The results show that the primer pair consisting of SMN1-E1-JDF74 and SMN1-E1-JDR429 is preferably used for amplifying the target fragment.

[0169] The genomic DNA of 10 pigs was used as a template, and the primer pair consisting of SMN1-E1-JDF74 and SMN1-E1-JDR429 was used for PCR amplification, followed by 1% agarose gel electrophoresis. The electrophoresis map is shown in Figure 6 The PCR amplification product was recovered and sequenced, and the sequencing results were compared and analyzed with the SMN1 gene sequence in the public database. The conserved region common to 10 pigs was selected for gRNA target point design.

[0170] II. Screening of target points

[0171] A number of target points were initially screened by screening NGG (avoiding possible mutation sites), and 4 target points were further screened from them through a pre-experiment.

[0172] The 4 target points are as follows:

[0173] SMN1-E1-gRNA1 target point: GACTCGGTGCTGTTCCGGCG;

[0174] SMN1-E1-gRNA2 target point: CGGCAGCGGTGTTCCTGAGG;

[0175] SMN1-E1-gRNA3 target point: CGGCGGCAGCGGTGTTCCTG;

[0176] SMN1-E1-gRNA4 target point: CGGAGGACTCGGTGCTGTTC.

[0177] III. Preparation of gRNA

[0178] The plasmid pKG-U6gRNA was digested with restriction enzyme BbsI, and the vector skeleton (about 3 kb of a linear large fragment) was recovered.

[0179] SMN1-E1-gRNA1-S and SMN1-E1-gRNA1-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(SMN1-E1-gRNA1). The plasmid pKG-U6gRNA(SMN1-E1-gRNA1) expresses sgRNA represented by SEQ ID NO: 10 SMN1-E1-gRNA1 .

[0180] sgRNA SMN1-E1-gRNA1 (SEQ ID NO: 10):

[0181] GACUCGGUGCUGUUCCGGCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0182] SMN1-E1-gRNA2-S and SMN1-E1-gRNA2-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(SMN1-E1-gRNA2). The plasmid pKG-U6gRNA(SMN1-E1-gRNA2) expresses sgRNA represented by SEQ ID NO: 11 SMN1-E1-gRNA2 .

[0183] sgRNA SMN1-E1-gRNA2 (SEQ ID NO: 11):

[0184] CGGCAGCGGUGUUCCUGAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0185] SMN1-E1-gRNA3-S and SMN1-E1-gRNA3-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(SMN1-E1-gRNA3). The plasmid pKG-U6gRNA(SMN1-E1-gRNA3) expresses sgRNA represented by SEQ ID NO: 12 SMN1-E1-gRNA3 .

[0186] sgRNA SMN1-E1-gRNA3(SEQ ID NO: 12):

[0187] CGGCGGCAGCGGUGUUCCUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0188] SMN1-E1-gRNA4-S: caccgCGGAGGACUCGGUGCUGUUCG and SMN1-E1-gRNA4-A: aaacCAGCAGGUCCAGGUCACGUCG were synthesized, mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain plasmid pKG-U6gRNA(SMN1-E1-gRNA4). The plasmid pKG-U6gRNA(SMN1-E1-gRNA4) expresses sgRNA represented by SEQ ID NO: 13 SMN1-E1-gRNA4 .

[0189] SMN1-E1-gRNA4-S: caccgCGGAGGACUCGGUGCUGUUCG and SMN1-E1-gRNA4-A: aaacCAGCAGGUCCAGGUCACGUCG were synthesized, mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain plasmid pKG-U6gRNA(SMN1-E1-gRNA4). The plasmid pKG-U6gRNA(SMN1-E1-gRNA4) expresses sgRNA represented by SEQ ID NO: 13 SMN1-E1-gRNA4 (SEQ ID NO: 13):

[0190] CGGAGGACUCGGUGCUGUUCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0191] SMN1-E1-gRNA1-S: caccGACTCGGTGCTGTTCCGGCG;

[0192] SMN1-E1-gRNA1-A: aaacCGCCGGAACAGCACCGAGTC;

[0193] SMN1-E1-gRNA2-S: caccgCGGCAGCGGTGTTCCTGAGG;

[0194] SMN1-E1-gRNA2-A: aaacCCTCAGGAACACCGCTGCCGc;

[0195] SMN1-E1-gRNA3-S: caccgCGGCGGCAGCGGTGTTCCTG;

[0196] SMN1-E1-gRNA3-A: aaacCAGGAACACCGCTGCCGCCGc;

[0197] SMN1-E1-gRNA4-S: caccgCGGAGGACTCGGTGCTGTTC;

[0198] SMN1-E1-gRNA4-A: aaacGAACAGCACCGAGTCCTCCGc.

[0199] SMN1-E1-gRNA1-S, SMN1-E1-gRNA1-A, SMN1-E1-gRNA2-S, SMN1-E1-gRNA2-A, SMN1-E1-gRNA3-S, SMN1-E1-gRNA3-A, SMN1-E1-gRNA4-S, SMN1-E1-gRNA4-A are all single-stranded DNA molecules.

[0200] IV. Comparison of editing efficiency of different target combinations

[0201] 1. Co-transfection

[0202] First group: co-transfect plasmid pKG-U6gRNA (SMN1-E1-gRNA1), plasmid pKG-GE3 into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (SMN1-E1-gRNA1): 1.08 μg plasmid pKG-GE3.

[0203] Second group: co-transfect plasmid pKG-U6gRNA (SMN1-E1-gRNA2), plasmid pKG-GE3 into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (SMN1-E1-gRNA2): 1.08 μg plasmid pKG-GE3.

[0204] Third group: co-transfect plasmid pKG-U6gRNA (SMN1-E1-gRNA3), plasmid pKG-GE3 into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (SMN1-E1-gRNA3): 1.08 μg plasmid pKG-GE3.

[0205] Fourth group: co-transfect plasmid pKG-U6gRNA (SMN1-E1-gRNA4), plasmid pKG-GE3 into porcine primary fibroblasts. Ratio: about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (SMN1-E1-gRNA4): 1.08 μg plasmid pKG-GE3.

[0206] Fifth group: porcine primary fibroblasts, same electroporation parameters without plasmid.

[0207] Co-transfection was performed by electroporation, using Neon kit (Thermofisher) and Neon TM transfection system (parameters: 1450V, 10ms, 3pulse).

[0208] 2、After step 1, use complete culture solution to culture for 12-18 hours, then replace new complete culture solution for culture. The total culture time after electroporation is 48 hours.

[0209] 3、After step 2, use trypsin to digest and collect cells, lyse cells, extract genomic DNA, use primer pair composed of SMN1-E1-JDF74 and SMN1-E1-JDR429 to perform PCR amplification, then perform 1% agarose gel electrophoresis. Detect cell target gene mutation.

[0210] After cutting and recovering the target product, send it to a sequencing company for sequencing, then use the web-based Synthego ICE tool to analyze the sequencing peak chart to obtain the gene editing efficiency of different target points. The gene editing efficiency of the first group, the second group, the third group, the fourth group is 1%, 17%, 36%, 35% respectively, and the fifth group does not occur gene editing. The results show that the editing efficiency of SMN1-E1-gRNA3 target point and SMN1-E1-gRNA4 target point is higher.

[0211] Example 3, preparation and purification of NCN protein

[0212] I. Construction of prokaryotic Cas9 high-efficiency expression vector

[0213] The structural diagram of plasmid pET-32a is shown in Figure 7 .

[0214] Plasmid pKG-GE4 is obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (referred to as plasmid pKG-GE4) is shown in SEQ ID NO: 1, which is a circular plasmid, and the structural diagram is shown in Figure 8 .

[0215] In SEQ ID NO: 1, nucleotides 5121-5139 constitute a T7 promoter, nucleotides 5140-5164 encode a Lac operator, nucleotides 5178-5201 constitute a ribosome binding site (RBS), nucleotides 5209-5271 encode a phoA signal peptide, nucleotides 5272-5598 encode a TrxA protein, nucleotides 5620-5637 encode a His-Tag (also known as His6 tag), nucleotides 5638-5652 encode an enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode a nuclear localization signal, nucleotides 5701-9801 encode a spCas9 protein, nucleotides 9802-9849 encode a nuclear localization signal, and nucleotides 9902-9949 constitute a T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for the E. coli BL21 (DE3) strain.

[0216] The main modifications of the plasmid pKG-GE4 are as follows: 1) the coding region of the TrxA protein is retained, which can help the expressed target protein form disulfide bonds, increase the solubility and activity of the target protein; a coding sequence of a phoA signal peptide is added before the coding region of the TrxA protein, which can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cleaved by the prokaryotic periplasmic signal peptide enzyme; 2) a coding sequence of a His-Tag is added after the coding sequence of the TrxA protein, which can be used for enrichment of the expressed target protein; 3) a coding sequence of an enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) is added downstream of the coding sequence of the His-Tag, and the purified protein will remove the His-Tag and the upstream fused TrxA protein under the action of enterokinase; 4) a codon-optimized Cas9 gene suitable for expression in the E. coli BL21 (DE3) strain is inserted, and a nuclear localization signal coding sequence is added upstream and downstream of the gene, which increases the nuclear localization ability of the purified Cas9 protein in the later stage.

[0217] The fusion gene in the plasmid pKG-GE4 is shown in nucleotides 5209-9852 of SEQ ID NO: 1, which encodes a fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, referred to as PRONCN protein). Due to the presence of the phoA signal peptide and the enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form a protein shown in SEQ ID NO: 3. The protein shown in SEQ ID NO: 3 is named NCN protein.

[0218] II. Inducing expression

[0219] 1. Introducing plasmid pKG-GE4 into E. coli BL21(DE3) to obtain recombinant bacteria.

[0220] 2. Inoculating the recombinant bacteria obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin, and culturing at 37°C with 200 rpm shaking overnight.

[0221] 3. Inoculating the bacterial solution obtained in step 2 into liquid LB medium, and culturing at 30°C with 230 rpm shaking until the OD value = 1.0, then adding isopropyl thiogalactoside (IPTG) to make its concentration in the system 0.5 mM, then culturing at 25°C with 230 rpm shaking for 12 hours, then centrifuging at 4°C and 10000 g for 15 minutes to collect the bacterial bodies. 600nm

[0222] 4. Washing the bacterial bodies obtained in step 3 with PBS buffer.

[0223] III. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0224] 1. Taking the bacterial bodies obtained in step two, adding crude extraction buffer and suspending the bacterial bodies, then crushing the bacterial bodies with a homogenizer (1000 par cycles for three times), then centrifuging at 4°C and 15000 g for 30 min to collect the supernatant, filtering the supernatant with a 0.22 μm pore size filter membrane to collect the filtrate. In this step, 10 ml of crude extraction buffer is added per g of wet weight of bacterial bodies.

[0225] Crude extraction buffer: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM imidazole, 1 mM PMSF, and the rest is ddH2O.

[0226] 2. Purifying the fusion protein by affinity chromatography.

[0227] First, equilibrating the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate 1 ml / min); then loading 50 ml of the filtrate obtained in step 1 (flow rate 0.5-1 ml / min); then washing the column with 5 column volumes of equilibration buffer (flow rate 1 ml / min); then washing the column with 5 column volumes of buffer to remove impurities (flow rate 1 ml / min); then eluting with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, and collecting the post-column solution (90-100 ml).

[0228] Ni-NTA agarose column: Kingsway, L00250 / L00250-C, with a filler of 10 ml.​

[0229] Equilibrium solution: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the balance is ddH2O.

[0230] Buffer solution: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, with the balance being ddH2O.

[0231] Eluent: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the balance is ddH2O.

[0232] IV. Enzymatic digestion of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein

[0233] 1. Take 15 ml of the post-column solution collected in step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, 15 ml capacity), and then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.

[0234] 2. Add the commercially available His6-tagged recombinant bovine enterokinase (Sangon Biotech, C620031, Recombinant Bovine Enterokinase Light Chain, His6-tagged) to the solution obtained in step 1 (approximately 6 ml), and digest at 25°C for 16 hours. Add 2 units of enterokinase per 50 μg of protein.

[0235] 3. Take the solution from step 2 (about 6 ml), mix it with 480 μl of Ni-NTA resin (GenScript, L00250 / L00250-C), mix by rotation at room temperature for 15 min, then centrifuge at 7000 g for 3 min, and collect the supernatant (4-5.5 ml).

[0236] 4. Take the supernatant obtained in step 3 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml). Then add it to the enzyme storage solution and adjust the protein concentration to 5 mg / ml to obtain the NCN protein solution.

[0237] Sequencing revealed that the N-terminal 15 amino acid residues in the NCN protein solution are as shown in positions 1 to 15 of SEQ ID NO: 3, which is the NCN protein.

[0238] Enzyme stock solution (pH 7.4): 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (v / v) glycerol, remainder ddH2O.

[0239] Example 4, Performance of NCN protein

[0240] The NCN protein was provided by the NCN protein solution prepared in Example 3.

[0241] Two gRNA target points targeting the TTN gene were selected as follows:

[0242] TTN-gRNA1 target point: AGAGCACAGTCAGCCTGGCG;

[0243] TTN-gRNA2 target point: CTTCCAGAATTGGATCTCCG.

[0244] Primers for identifying the target fragment containing the gRNA in the TTN gene were as follows:

[0245] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0246] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0247] I. Preparation of gRNA

[0248] 1. Preparation of TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template

[0249] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0250] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0251] 2. In vitro transcription to obtain gRNA

[0252] The TTN-T7-gRNA1 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) was used for recovery and purification, and TTN-gRNA1 was obtained. TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0253] TTN-gRNA2 was obtained by using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) to transcribe the TTN-T7-gRNA2 transcription template in vitro, and then using MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) to recover and purify, to obtain TTN-gRNA2. TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0254] II. Optimization of the ratio of gRNA to NCN protein

[0255] 1. Co-transfection of porcine primary fibroblasts

[0256] Group 1: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1: 0.5 μg TTN-gRNA2: 4 μg NCN protein.

[0257] Group 2: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1: 0.75 μg TTN-gRNA2: 4 μg NCN protein.

[0258] Group 3: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0259] Group 4: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1: 1.25 μg TTN-gRNA2: 4 μg NCN protein.

[0260] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0261] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0262] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0263] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0264] See electrophoresis image Figure 9 The 505bp band is the wild-type band (WT), and the band around 254bp (the wild-type band theoretically has a deletion of 251bp) is the deletion mutation band (MT).

[0265] Gene deletion mutation efficiency = (MT gray level / MT band bp) / (WT gray level / WT band bp + MT gray level / MT band bp) × 100%. The gene deletion mutation efficiency of the first group is 19.9%, the gene deletion mutation efficiency of the second group is 39.9%, the gene deletion mutation efficiency of the third group is 79.9%, and the gene deletion mutation efficiency of the fourth group is 44.3%. No mutation occurred in the fifth group.

[0266] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to the NCN protein was 1:1:4, and the actual dosage was 1 μg:1 μg:4 μg. Therefore, the optimal dosage of the two gRNAs to the NCN protein was determined to be 1 μg:1 μg:4 μg.

[0267] III. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein

[0268] 1. Co-transfection of porcine primary fibroblasts

[0269] Cas9-A group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-A protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-A protein.

[0270] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2 and NCN protein are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0271] Cas9-B group: TTN-gRNA1, TTN-gRNA2 and commercial Cas9-B protein are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-B protein.

[0272] Control group: TTN-gRNA1, TTN-gRNA2 are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0273] Co-transfection is carried out by electroporation, and mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporation instrument (parameter setting: 1450V, 10ms, 3pulse) are used.

[0274] 2. After completing step 1, use complete culture medium to culture for 12-18 hours, and then replace the new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0275] 3. After completing step 2, the cells are digested with trypsin and collected, genomic DNA is extracted, PCR amplification is carried out using a primer pair composed of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis is carried out.

[0276] The electrophoretogram is shown in Figure 10 The gene deletion mutation efficiency using commercial Cas9-A protein is 28.5%, the gene deletion mutation efficiency using NCN protein is 85.6%, and the gene deletion mutation efficiency using commercial Cas9-B protein is 16.6%.

[0277] The results show that compared with the commercial Cas9 protein, the NCN protein prepared by the application can significantly improve the gene editing efficiency.

[0278] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. Application of SMN1-gRNA3, SMN1-gRNA4 and NCN protein in preparation of a kit; the SMN1-gRNA3 is sgRNA, the target sequence binding region of which is shown as nucleotides 3-22 in SEQ ID NO: 16; the SMN1-gRNA4 is sgRNA, the target sequence binding region of which is shown as nucleotides 3-22 in SEQ ID NO: 17; the NCN protein is shown as SEQ ID NO: 3; the ratio of SMN1-gRNA3, SMN1-gRNA4 and NCN protein is 1 μg SMN1-gRNA3: 1 μg SMN1-gRNA4: 4 μg NCN protein in turn; the preparation method of the NCN protein comprises the following steps: (1) introducing plasmid pKG-GE4 into E. coli BL21(DE3) to obtain a recombinant bacterium; (2) culturing the recombinant bacterium at 30°C using a liquid medium, then adding IPTG and inducing culture at 25°C, and then collecting the bacterial bodies; (3) performing bacterial body disruption on the collected bacterial bodies to collect a crude protein solution; (4) purifying the fusion protein with His6 tag from the crude protein solution using affinity chromatography; (5) performing enterokinase enzyme cutting on the fusion protein with His6 tag, then removing the protein with His6 tag using Ni-NTA resin to obtain the purified NCN protein; the plasmid pKG-GE4 is shown as SEQ ID NO: 1; the use of the kit is as follows (a) or (b) or (c): (a) preparing a recombinant pig cell; (b) preparing a spinal muscular atrophy model pig; (c) preparing a spinal muscular atrophy cell model or a spinal muscular atrophy tissue model or a spinal muscular atrophy organ model.

2. A kit comprising SMN1-gRNA3, SMN1-gRNA4 and NCN protein; the SMN1-gRNA3 is the SMN1-gRNA3 described in claim 1; the SMN1-gRNA4 is the SMN1-gRNA4 described in claim 1; and the NCN protein is the NCN protein described in claim 1; the ratio of SMN1-gRNA3, SMN1-gRNA4 and NCN protein is 1 μg SMN1-gRNA3: 1 μg SMN1-gRNA4: 4 μg NCN protein in turn; the use of the kit is as follows (a) or (b) or (c): (a) preparing a recombinant pig cell; (b) preparing a spinal muscular atrophy model pig; (c) preparing a spinal muscular atrophy cell model or a spinal muscular atrophy tissue model or a spinal muscular atrophy organ model.

3. A method for preparing a recombinant pig cell, comprising the following steps: co-transfecting SMN1-gRNA3, SMN1-gRNA4 and NCN protein into a pig cell to obtain a recombinant pig cell; wherein the SMN1-gRNA3 is the SMN1-gRNA3 as defined in claim 1; the SMN1-gRNA4 is the SMN1-gRNA4 as defined in claim 1; the NCN protein is the NCN protein as defined in claim 1; and the ratio of the SMN1-gRNA3, the SMN1-gRNA4 and the NCN protein is 1 μg SMN1-gRNA3: 1 μg SMN1-gRNA4: 4 μg NCN protein, respectively.

Citation Information

Patent Citations

  • CRISPR / Cas9 system and application thereof in construction of swine-derived recombinant cells with insulin receptor substrate gene defects

    CN112522255A

  • Application of gRNA target combinations in construction of hemophilia model pig cell line

    CN112442515A

  • Pathogenic gene detection method for spinal muscular atrophy

    CN114381503A