Application of circular RNA biomarkers, detection kits and methods related to cervical cancer in the diagnosis of cervical cancer

Abstract

This invention discloses a circular RNA biomarker associated with cervical cancer, characterized in that the circular RNA biomarker is circular RNA hsa_circ_0005571, the nucleotide sequence of which is shown in SEQ ID NO: 1. This invention also discloses the application of a detection kit and method based on this circular RNA hsa_circ_0005571 in the diagnosis of cervical cancer. The circular RNA hsa_circ_0005571 of this invention can serve as an effective biomarker for cervical cancer detection. The kit and detection method of this invention are characterized by simple operation, high sensitivity, strong specificity, and short cycle time, which is beneficial for the early diagnosis and treatment of cervical cancer and provides assistance for the subsequent development of novel drugs with potential therapeutic value for cervical cancer.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and biotechnology, and specifically relates to the application of a cervical cancer-related circular RNA marker, detection kit, and method in the diagnosis of cervical cancer. Background Technology

[0002] Cervical cancer (CC) is a malignant tumor of the reproductive system that seriously threatens women's health. Globally, it ranks fourth in both incidence and mortality among female malignant tumors. It is estimated that in 2018, there were 570,000 new cases of cervical cancer worldwide, with over 310,000 deaths. In developing countries, cervical cancer is the second most common malignant tumor among women; my country and India account for approximately one-third of all cervical cancer cases globally. With changing lifestyles among modern women, the incidence of viral reproductive tract diseases and the prevalence of sexually transmitted infections are increasing, leading to a trend of cervical cancer occurring at younger ages.

[0003] Early detection is an effective method for preventing and treating cervical cancer. Early detection and diagnosis allow for timely and effective intervention, improving survival rates and significantly enhancing patient prognosis. Current main detection methods include cytology and HPV testing. Cytology includes traditional Pap smears and liquid-based cytology. Traditional Pap smears are less expensive, but their accuracy and sensitivity are limited. Doctors have a large workload and their subjective judgment is significant, leading to frequent missed or misdiagnosed cases due to issues in sample collection and smear preparation. Liquid-based cytology is more advanced than traditional smears in its preparation methods, but it still relies on the doctor's subjective judgment of cell morphology, lacking objective standards and easily influenced by subjective factors and sample quality, resulting in unclear diagnostic results [Research progress on the screening value of HPV E6E7, cervical liquid-based cytology, and colposcopy biopsy for cervical cancer; Chinese Journal of Obstetrics and Gynecology, May 2022, Vol. 23, No. 3]. HPV genotyping is based on the identification of HPV DNA in cervical secretions. Despite its high sensitivity, HPV testing cannot distinguish whether a positive result is associated with clinical lesions; a high HPV infection rate is accompanied by a relatively low incidence of cervical cancer, with only persistent HPV infection closely linked to precancerous lesions. This may lead to excessive diagnosis and cause unnecessary anxiety for women. It also suggests that other important factors, such as inter-individual genetic differences, exist in the development and progression of cervical cancer. Therefore, it is crucial to thoroughly investigate the exact pathogenesis of cervical cancer and to identify novel diagnostic biomarkers and potential therapeutic targets.

[0004] Circular RNAs (circRNAs) are a class of closed circular RNA molecules, primarily produced from pre-mRNA through alternative splicing. Due to the absence of a 5' cap and a 3' poly(A) tail, and the lack of free ends required for exonuclease degradation, circRNAs are more stable than linear mRNAs. Current research indicates that circRNAs can participate extensively in the regulation of various pathophysiological processes in tumor cells, including proliferation, differentiation, apoptosis, invasion, and metastasis, by acting as microRNA sponges or decoys, interacting with RNA-binding proteins, and even translating functional peptides. Furthermore, circRNAs are endogenous, abundant, conserved, and stable, and can be specifically expressed in cancer tissues as well as found in blood, plasma, extracellular vesicles, saliva, and urine. These characteristics demonstrate the potential of circRNAs as diagnostic biomarkers and for therapeutic applications.

[0005] Recent studies have confirmed the aberrant expression of circRNAs in cervical cancer, suggesting they may play an important role in the development and progression of cervical cancer and hold promise as novel tumor markers or molecular therapeutic targets for clinical application. However, overall, current research on circRNAs in cervical cancer is still not comprehensive or in-depth. The molecular mechanisms of circRNAs in cervical cancer are still in the basic research stage, and there is considerable room for further research on whether circRNAs can serve as diagnostic markers for cervical cancer. Summary of the Invention

[0006] The main objective of this invention is to address the shortcomings of existing technologies, such as insufficient and in-depth research on circRNAs and a lack of diagnostic biomarkers for cervical cancer. This invention provides an application of cervical cancer-related circular RNA biomarkers, detection kits, and methods in the diagnosis of cervical cancer. The circular RNA hsa_circ_0005571 has been verified as an effective biomarker for cervical cancer detection.

[0007] The objective of this invention and the technical problem it solves are achieved by the following technical solutions.

[0008] One aspect of the present invention provides a circular RNA marker associated with cervical cancer, wherein the circular RNA marker is circular RNA hsa_circ_0005571, and the nucleotide sequence of the circular RNA hsa_circ_0005571 is shown in SEQ ID NO: 1.

[0009] Furthermore, primer sequences with detection specificity for the circular RNA hsa_circ_0005571 are shown in SEQ ID NO: 2 and SEQ ID NO: 3.

[0010] Another aspect of the present invention provides an application of a circular RNA marker in the preparation of a cervical cancer diagnostic kit.

[0011] Another aspect of the present invention provides a cervical cancer diagnostic kit for detecting the relative expression level of the biomarker circular RNA hsa_circ_0005571 in a test sample. The kit includes a primer pair, comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer being shown in SEQ ID NO: 3.

[0012] Further, the sample to be tested includes at least one of the following groups: uterine tissue, lymph nodes, urine, semen, blood, serum, plasma, circulating tumor cells in blood or lymph, tissue containing metastases, and sources containing cervical cancer cells or portions thereof, as well as free or protein-bound RNA molecules from cervical cancer cells.

[0013] Furthermore, the kit also includes qPCR amplification mix and ddH2O.

[0014] Furthermore, the qPCR amplification mix contains SYBGREEN dye.

[0015] Furthermore, the kit also includes an internal control system, which is an internal control primer designed based on the internal reference gene GAPDH sequence. The internal control primer includes an upstream primer and a downstream primer. The nucleic acid sequence of the upstream primer is shown in SEQ ID NO.4, and the nucleic acid sequence of the downstream primer is shown in SEQ ID NO.5.

[0016] In another aspect, this invention provides a method for detecting the cervical cancer marker circular RNA hsa_circ_0005571 using a cervical cancer diagnostic kit, the method comprising the following steps:

[0017] S1. RNA extraction: Total RNA was extracted using the Trizol method;

[0018] S2. Reverse transcription of RNA: Prepare the reverse transcription system and follow the instructions in the TonkBio™ First Chain cDNASynthesis Kit manual to synthesize cDNA through reverse transcription;

[0019] The composition and content of the reverse transcription system are as follows:

[0020]

[0021]

[0022] The reaction conditions are: 60 min at 42℃ and 5 min at 70℃;

[0023] S3. Quantitative Real-Time PCR Amplification: Using the kit described in this invention, PCR amplification is performed using the cDNA obtained in step S2 as a template, and fluorescence signals are collected.

[0024] The system composition and content for fluorescent PCR amplification are as follows:

[0025]

[0026] The reaction conditions for fluorescent PCR were: pre-denaturation at 95℃ for 10 min, followed by denaturation at 95℃ for 15 s, annealing at 52℃ for 30 s, and extension at 72℃ for 30 s, for a total of 38 cycles.

[0027] This invention has significant advantages and beneficial effects compared with existing technologies: It discloses for the first time a kit for detecting the circular RNA hsa_circ_0005571 associated with cervical cancer and its application in the preparation of reagents for detecting or assisting in the diagnosis of cervical cancer. The hsa_circ_0005571 quantitative detection kit contains a pair of specific amplification primers for detecting hsa_circ_0005571 and a pair of specific primers for the internal control GAPDH. The expression of hsa_circ_0005571 in cervical cancer patient samples and normal samples is detected by SYBR Green quantitative PCR, and the relative expression level parameter of hsa_circ_0005571 is calculated for auxiliary diagnosis of cervical cancer. Compared with traditional cervical cancer detection technologies, this invention is simple to operate, highly sensitive, highly specific, and has a short cycle time, which is beneficial for the early diagnosis and treatment of cervical cancer.

[0028] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the preferred embodiments of the present invention are described in detail below with reference to the accompanying drawings. Attached Figure Description

[0029] Figure 1 The structure and full-length sequence of the circular RNA hsa_circ_0005571 gene are shown.

[0030] Figure 2The melting curve of the primer for the circular RNA hsa_circ_0005571 is shown in the figure.

[0031] Figure 3 The Sanger sequencing results of the PCR product of circular RNA hsa_circ_0005571 are shown.

[0032] Figure 4 The expression level of circular RNA hsa_circ_0005571 in cervical cancer tissues and adjacent normal tissues was detected by real-time PCR.

[0033] Figure 5 The expression level of circular RNA hsa_circ_0005571 in plasma samples from cervical cancer patients and healthy controls was detected using real-time PCR.

[0034] Figure 6 The ROC curve of plasma circular RNA hsa_circ_0005571 is shown. Detailed Implementation

[0035] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present invention and do not limit the present invention.

[0036] The circular RNA hsa_circ_0005571 is located on human chromosome 19 (18285849-18286507) and originates from exons 1-3 of its linear parent gene IFI30. Its full-length nucleotide sequence is 351 nt (SEQ ID NO:1). The first two nucleotides and the last two nucleotides are the circular binding sites. Currently, there are few reports on hsa_circ_0005571, with only one study suggesting that hsa_circ_0005571 may be involved in regulating the proliferation, invasion, migration, and apoptosis of triple-negative breast cancer cells [PMID:35378000]. However, there are no reports on the expression pattern and function of hsa_circ_0005571 in cervical cancer tissues and cells, and its correlation with the occurrence and development of cervical cancer remains unknown.

[0037] On one hand, the present invention provides an application of a cervical cancer-related circular RNA biomarker, a detection kit, and a method in the diagnosis of cervical cancer, wherein the circular RNA hsa_circ_0005571 contains a nucleotide sequence such as SEQ ID NO:1.

[0038] SEQ ID NO:1:

[0039] ACAGGCAATCTATACCTGCGGGGGCCCCTGAAGAAGTCCAATGCACCGCTTGTCAATGTGACCCTCTACTATGAAGCACTGTGCGGTGGCTGCCGAGCCTTCCTGATCCGGGAGCTCTTCCCAACATGGCTGTTGGTCATGGAGATCCTCAATGTCACGCTGGTGCCCTACGGAAA CGCACAGGAACAAAATGTCAGTGGCAGGTGGGAGTTCAAGTGCCAGCATGGAGAAGAGGAGTGCAAATTCAACAAGGTGGAGGCCTGCGTGTTGGATGAACTTGACATGGAGCTAGCCTTCCTGACCATTGTCTGCATGGAAGAGTTTGAGGACATGGAGAGAAGTCTGCCACTA.

[0040] Secondly, the present invention provides a detection primer with specificity for detecting circular RNA hsa_circ_0005571, the nucleotide sequence of which is shown in SEQ ID NO:2-3, and the detection primer can be used to prepare cancer diagnosis and treatment kits.

[0041] The nucleotide sequence of the forward primer (Primer F) is GGAGAGAAGTCTGCCACTAAC (SEQ ID NO:2);

[0042] The nucleotide sequence of the reverse primer (Primer R) is GCTTCATAGTAGAGGGTCACATT (SEQ ID NO:3).

[0043] In practical applications, this also includes forward and reverse primers for the internal reference GAPDH:

[0044] Internal reference GAPDH Primer F:CAATGACCCCTTCATTGACC(SEQ ID NO:4);

[0045] Internal reference GAPDH Primer R: GACAAGCTTCCCGTTCTCAG (SEQ ID NO:5).

[0046] Thirdly, the samples used for testing are selected from the group consisting of: uterine tissue, lymph nodes, urine, semen, blood, serum, plasma, circulating tumor cells in blood or lymph, tissue containing metastases, and sources containing cervical cancer cells or portions thereof, as well as free or protein-bound RNA molecules from cervical cancer cells; preferably, the samples are biopsy materials.

[0047] Example 1: Extraction and identification of circular RNA hsa_circ_0005571

[0048] 1. Total RNA extraction using the Trizol method

[0049] Step 1: For tissue samples, weigh approximately 50 mg of cervical cancer tissue or adjacent normal tissue, add 1 mL of Trizol (Invitrogen, catalog number 15596026), and thoroughly mince the tissue. Then, use a tissue homogenizer to homogenize the tissue into a paste. For plasma RNA, collect 5 mL of whole blood in an EDTA anticoagulant collection tube, gently mix, and centrifuge at 1500 g for 5 min. Centrifuge the supernatant again at 1500 g for 10 min, then transfer the supernatant to a new nuclease-free tube and store at -80°C for later use. Take 250 μL of the above plasma sample, add 750 μL of Trizol, and vortex to mix.

[0050] Step 2: Lyse the sample obtained in Step 1 at room temperature for 5 min. Add chloroform at a ratio of 0.2 mL chloroform per 1 mL Trizol. Tighten the cap, vortex for 15 s, let stand for 5 min until the layers appear, and then centrifuge at 12000 rpm for 15 min at 4 °C. After centrifugation, the mixed liquid will separate into three layers: a lower chloroform phase, a middle protein phase, and an upper colorless aqueous phase. All RNA will be distributed in the aqueous phase.

[0051] Step 3: Transfer the aqueous phase to a new centrifuge tube, add an equal volume of isopropanol, mix well, and let stand at -20℃ for 30 min. Then, centrifuge at 12000 rpm for 10 min at 4℃ to obtain a precipitate. All RNA is present in the precipitate.

[0052] Step 4: Remove the supernatant, add 1 mL of 75% ethanol to the system to wash the RNA precipitate, and centrifuge at 7500 rpm for 5 min at 4°C.

[0053] Step 5, repeat step 4.

[0054] Step 6: Remove the ethanol solution, dry at room temperature for 5-10 minutes until the ethanol evaporates, add RNase-free ddH2O water to the centrifuge tube, and dissolve thoroughly to obtain total RNA.

[0055] Step 7: Use NanoDrop ND-2000 to determine the concentration and purity of RNA. Once the RNA quality meets the standards, aliquot it and store it at -80℃.

[0056] 2. Synthesis of the first-strand cDNA sequence

[0057] Prepare the reverse transcription system using PCR tubes (instrument: Bio-rad S1000 gradient PCR instrument; kit: Shanghai Tongke Biotechnology Co., Ltd., TonkBio™ First Chain cDNA Synthesis Kit, TB30001B). The reverse transcription system consists of: 1 μL total RNA (approximately 500-1000 ng), 1 μL random primers, 10 μL ddH2O, 2 μL dNTP mixture (dATP, dGTP, dCTP, and dTTP), 4 μL reverse transcription buffer, 1 μL RNase inhibitor, 1 μL reverse transcriptase, and a total volume of 20 μL.

[0058] The reaction conditions were: 42℃ for 60 min and 70℃ for 5 min. The cDNA obtained from reverse transcription was stored at -80℃ for later use.

[0059] 3. Design of primers for specific amplification of circular RNA hsa_circ_0005571

[0060] The linear deoxyribonucleotide sequence and structural information of the circular RNA hsa_circ_0005571 were obtained using the circBase, CSCD, and circbank databases. Figure 1 This is a diagram of the gene structure of a circular RNA, with a full-length nucleotide sequence of 351 nt (as shown in SEQ ID NO:1). The first two nucleotides and the last two nucleotides are the circular binding sites. Primer design principles: ① Follow standard primer design principles; ② Design primers to cross backsplice junctions.

[0061] Step 1, sequence reassembly: To meet the design requirements across the cleavage site, based on the full-length nucleotide sequence of hsa_circ_0005571 in Example 1, a 176-351nt length sequence from the 3' end is cut off and placed in front of a 1-175nt length sequence from the 5' end to reassemble a new sequence, which includes the cleavage site after circular splicing.

[0062] Step 2: For the reassembled sequence, design primers using conventional methods and write them in the 5'→3' direction by default, following the general sequence linear storage rules.

[0063] Step 3: Primer output and specificity adjustment. Import the primer sequences obtained in Step 2 into the NCBI database (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and use the "Primer-Blast" tool for primer specificity comparison analysis and optimization.

[0064] Step 4: The designed primers were synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0065] The nucleotide sequence of the forward primer (Primer F) is: GGAGAGAAGTCTGCCACTAAC (SEQ ID NO:2);

[0066] The reverse primer (Primer R) nucleotide sequence is: GCTTCATAGTAGAGGGTCACATT (SEQ ID NO:3).

[0067] In one feasible implementation, the upstream primer has a GC content of 52.4%, and the downstream primer has a GC content of 43.5%, where GC content refers to the ratio of guanine and cytosine among the four bases of DNA. Furthermore, both the upstream and downstream primers have a TM value of 62.0 degrees Celsius, where TM value refers to the melting temperature of either the upstream or downstream primer.

[0068] 4. Validation of specific amplification primers for circular RNA hsa_circ_0005571

[0069] Step 1, Real-time PCR amplification reaction (Instrument: ABI 7500 Real-time Quantitative PCR instrument; Reagent: Shanghai Tongke Biotechnology Co., Ltd., Golden qPCR SYBR Green Master Mix (2×), TK03013).

[0070] (1) The reaction system is as follows: 2 μL of cDNA obtained by reverse transcription in step 3, 0.8 μL of upstream primer (SEQ ID NO:2), 0.8 μL of downstream primer (SEQ ID NO:3), 6.4 μL of ddH2O, 10 μL of qPCR amplification mix (containing SYBGREEN dye), and a total volume of 20 μL;

[0071] (2) Real-time PCR reaction conditions: pre-denaturation at 95℃ for 10 min, followed by denaturation at 95℃ for 15 s, annealing at 52℃ for 30 s, and extension at 72℃ for 30 s, for a total of 38 cycles. The ABI 7500 real-time PCR instrument was programmed with a melting curve selected, and the sample fluorescence signal was continuously collected during the ramp-up process to obtain the melting curve.

[0072] (3) The amplification reaction was performed on an ABI 7500 real-time quantitative PCR instrument (Applied Biosystems, Foster City, CA, USA). GAPDH was amplified simultaneously as an internal control. The primer sequence for GAPDH was:

[0073] Internal reference GAPDH Primer F:CAATGACCCCTTCATTGACC(SEQ ID NO:4);

[0074] Internal reference GAPDH Primer R: GACAAGCTTCCCGTTCTCAG (SEQ ID NO:5).

[0075] The primers for GAPDH were synthesized by Suzhou Genewiz Biotechnology Co., Ltd., and were obtained through 2 -△△Ct The relative expression level of genes can be calculated.

[0076] Step 2: Sanger sequencing of the Real-time PCR amplification reaction products. Based on Step 1, Sanger sequencing is used to further verify the primers.

[0077] Figure 2 The melting curve of the primer for the circular RNA hsa_circ_0005571 is shown, exhibiting a single peak. The PCR product was then subjected to Sanger sequencing, with the following results: Figure 3 As shown, the sequencing results exhibit a single peak, and the circularization site is correct. This completes the primer verification for the circular RNA.

[0078] Example 2: Calculation of the relative expression level of circular RNA hsa_circ_0005571 in cervical cancer samples

[0079] Step 1: Extract total RNA according to the method described in Example 1, remove residual genomic DNA from the extracted RNA with DNase, and reverse transcribe the RNA into cDNA.

[0080] Step 2: Detection is performed using quantitative real-time PCR amplification. The primer sequences for quantitative real-time PCR are shown in SEQ ID NO:2-5.

[0081] Step 3, Results Analysis. Relative quantification was performed using the internal reference gene as a standard. The target gene hsa_circ_0005571 was normalized, and the results were analyzed using 2... -△△Ct The relative expression level of hsa_circ_0005571 was calculated using the method described above. Among them, 2... -△△Ct The higher the value, the higher the expression level of hsa_circ_0005571.

[0082] Figure 4The expression level of circular RNA hsa_circ_0005571 in cervical cancer tissues and adjacent normal tissues was detected using real-time PCR. Figure 4 As shown in the figure, the results of quantitative real-time PCR detection showed that the expression of hsa_circ_0005571 in cervical cancer tissue was significantly higher than that in adjacent normal tissue. Figure 5 The expression level of circular RNA hsa_circ_0005571 in plasma samples from cervical cancer patients and healthy controls was shown using real-time PCR. Figure 5 As shown, the expression of circular RNA hsa_circ_0005571 in the plasma of cervical cancer patients was significantly higher than that in the plasma of healthy controls.

[0083] Subsequently, to determine whether hsa_circ_0005571 could serve as a biomarker for cervical cancer, this invention further evaluated its receiver operating characteristic (ROC) curve. As is well known to those skilled in the art, the area under the ROC curve is between 1.0 and 0.5. When AUC > 0.5, the closer the AUC is to 1, the better the diagnostic effect. Accuracy is lower when AUC is between 0.5 and 0.7, and higher when AUC is between 0.7 and 0.9. An AUC greater than 0.9 suggests that the detection target is an ideal specific marker, and an AUC greater than 0.7 suggests that the detection target can serve as a specific marker for this type of detection.

[0084] Figure 6 The ROC curve of plasma circular RNA hsa_circ_0005571 is shown, used to distinguish cervical cancer patients from healthy subjects (AUC = 0.820). The results show that the area under the ROC curve (AUC) is 0.820 (P < 0.0001). This suggests that detecting the relative expression level of hsa_circ_0005571 has high value for the diagnosis of cervical cancer. Therefore, the real-time PCR detection method of this invention can effectively detect the expression of circular RNA hsa_circ_0005571 in organisms.

[0085] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the methods and techniques disclosed above without departing from the scope of the present invention to create equivalent embodiments. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. The application of a reagent for detecting the relative expression level of the circular RNA marker hsa_circ_0005571 in a test sample in the preparation of a cervical cancer diagnostic kit, characterized in that, The reagent includes a primer pair, which includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3. The primer pair specifically amplifies the circular RNA hsa_circ_0005571.

2. The application according to claim 1, characterized in that, The reagents also include qPCR amplification Mix and ddH2O.

3. The application according to claim 1, characterized in that, The sample to be tested includes at least one of the following groups: uterine tissue, lymph nodes, urine, blood, serum, plasma, and circulating tumor cells in blood or lymph.

4. The application according to claim 2, characterized in that, The qPCR amplification mix contains SYBR Green dye.

5. The application according to claim 1, characterized in that, The reagent also includes an internal standard system, which is an internal standard primer designed based on the internal reference gene GAPDH sequence. The internal standard primer includes an upstream primer and a downstream primer. The nucleic acid sequence of the upstream primer is shown in SEQ ID NO.4, and the nucleic acid sequence of the downstream primer is shown in SEQ ID NO.5.

Images