A KASP molecular marker for rice fertility genes and its application

CN116004889BActive Publication Date: 2026-03-10YANGZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-11
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Existing molecular markers for rice fertility, such as SSR and InDel, have low detection efficiency and are prone to aerosol pollution, making them unsuitable for high-throughput molecular detection platforms and affecting rice breeding efficiency.

Method used

A molecular marker for rice fertility was developed for a high-throughput molecular detection platform. Using KASP technology and Primer X, Primer Y and Primer R, the InDel site Ms-1 at bases 27607862-27607863 on chromosome 1 of the rice genome was detected. The genotype of the amplified product was analyzed by PCR amplification and fluorescence detection analyzer.

Benefits of technology

It enables rapid and accurate detection of the Ms-1 fertility gene locus in rice, reducing cumbersome procedures and the use of toxic substances, lowering breeding costs, and improving breeding efficiency and molecular detection efficiency, making it suitable for high-throughput molecular breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116004889B_ABST
    Figure CN116004889B_ABST
Patent Text Reader

Abstract

The application discloses a KASP molecular marker of a rice fertility gene and application thereof, and belongs to the field of genomic sequences and plant biotechnologies; the primer of the molecular marker comprises Primer X, Primer Y and Primer R; a method for detecting the 27607862-27607863 base of the first chromosome of a rice genome by using the primer; the application uses the KASP molecular technology to rapidly genotype and identify an InDel site which is closely linked to the rice fertility gene, and the KASP molecular technology can be used for high-throughput molecular breeding; the fertility selection efficiency of the KASP molecular marker is relatively high, the KASP molecular marker can be used for molecular marker assisted selection in the early breeding stage, the breeding cost is reduced, and the breeding process of a rice sterile line is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genomic sequences and plant biotechnology, and in particular to a KASP molecular marker of a fertility gene site Ms-1 of rice and application thereof. BACKGROUND

[0002] Rice (Oryza sativa) is one of the three major crops in China, and more than 60% of the population in China mainly eats rice. Increasing yield through hybrid advantage is a common method for crops, and three-line hybridization is particularly important for hybrid rice seed production. Therefore, breeding sterile materials is an important direction of rice breeding. Marker-assisted selection (MAS) is a new breeding model combining modern molecular biology and traditional genetic breeding, which can compensate for many drawbacks in traditional breeding by using molecular markers to select plants at the DNA level at an early stage of development, and is an effective way to improve the efficiency of rice breeding (Ma Xiaoqian, Yang Tao, Zhang Quan, et al. Research status and prospect of new rice breeding technology [J]. China Agricultural Science and Technology Review, 2022, 24(1): 7.).

[0003] At present, many rice sterile genes have been located and cloned, such as SAW1, pms3, CMS-WA, OsRPA2c, and OsNMS (Zhu Qinling, Liu Yaoguang, Chen Letian, et al. A rice fertility gene SAW1 and its application: 2021; Wu Changyin, Li Xingwang, Chang Yuxiao. Cloning and application of a rice fertility gene OsRPA2c: 2014; Li Xianghua, Wang Fulin, Lu Qing, et al. Fine mapping of a rice photosensitive genic male sterile gene pms3 [J]. Acta Agronomica Sinica, 2002, 28(3): 5.). Many genes have developed corresponding Indel, SSR or CAPS molecular markers, but due to the low detection efficiency of SSR, InDel and other markers, they also produce aerosol pollution of the environment, and are not suitable for high-throughput molecular detection platform.

[0004] Therefore, developing rice fertility molecular markers suitable for high-throughput molecular detection platform has important significance for popularizing the application of molecular marker technology and improving the breeding efficiency and level of high-quality rice in China. SUMMARY

[0005] The present application aims at the technical problems mentioned in the above background art, and realizes the following technical solutions:

[0006] A primer for detecting a molecular marker at the Ms-1 site in the rice fertility genome, the primer comprising Primer X, Primer Y and Primer R, wherein the nucleotide sequence of Primer X is shown in SEQ ID NO.1; the nucleotide sequence of Primer Y is shown in SEQ ID NO.2; and the nucleotide sequence of Primer R is shown in SEQ ID NO.3.

[0007] A method for molecular labeling using the primers of claim 1, characterized in that: the method is used to detect bases 27607862-27607863 on chromosome 1 of the rice genome.

[0008] Preferably, the specific steps of the method are as follows:

[0009] Step 1): Extract DNA from the rice samples to be tested;

[0010] Step 2): KASP reaction test, take 0.8 μL of 50 ng / μL genomic DNA and 0.03 μL of primer mixture for PCR amplification;

[0011] Step 3): Analyze the genotype of the amplified product using a fluorescence detection analyzer.

[0012] Preferably, the primer mixture in step 2) has a ratio of 100 pmol·L⁻¹ for the forward primer. -1 Primer X, 100 pmol·L -1 Primer Y 12 μL each, reverse primer 100 pmol·L⁻¹ -1 Primer R30μL, ddH2O 46μL.

[0013] Preferably, the PCR amplification reaction conditions in step 2) are: 95℃ pre-denaturation for 10 min, 1 cycle; 95℃ denaturation for 20 s, 55-62℃ annealing for 60 s, 40 cycles.

[0014] The application of the method in identifying or assisting in the identification of rice fertility.

[0015] The application of the method in identifying or assisting in the identification of sterile rice products.

[0016] The method described is applied in rice-assisted breeding or in the preparation of rice-assisted breeding products.

[0017] The application of the method in the breeding of sterile rice resources.

[0018] The substance used to detect the polymorphism or genotype of the Ms-1 site in the rice genome contains PCR primers for amplifying rice genomic DNA fragments including the Ms-1 site. The PCR primers are a primer set consisting of single-stranded DNA with nucleotide sequences of positions 22-46 of SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3 in the sequence listing; the PCR primers are a primer set consisting of single-stranded DNA shown in SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3 in the sequence listing.

[0019] The gene locus Ms-1 is an InDel site in the rice genome, and its nucleotide type is GT(+) or deletion(-), which is nucleotide 101-102 of SEQ ID No.4 in the sequence listing.

[0020] When the genotype of the Ms-1 locus is - / -, the rice is sterile or a candidate for sterility, wherein the - / - genotype indicates that the nucleotide type of the Ms-1 locus in the rice genome is a homozygous deletion (-).

[0021] When the genotype of the Ms-1 locus is + / + or + / -, the rice is fertile or a candidate for fertility. The + / + genotype indicates that the nucleotide type of the Ms-1 locus in the rice genome is GT(+); the + / - genotype indicates that the nucleotide type of the Ms-1 locus in the rice genome is GT(+) and deletion(-).

[0022] Molecular markers: In a broad sense, molecular markers refer to heritable and detectable DNA sequences or proteins. In a narrow sense, molecular markers refer to specific DNA fragments that can reflect certain differences in the genome of an individual or population.

[0023] The beneficial effects of the present invention are: (1) The molecular marker KASP of the present invention has high phenotypic selection efficiency and can quickly and accurately detect the rice fertility gene locus Ms-1 in different germplasm resources of rice; and the detection process does not require cumbersome procedures such as enzyme digestion, electrophoresis and sequencing, which reduces aerosol pollution and the use of toxic substances such as ethidium bromide (EB), and can carry out molecular marker-assisted selection in the early stage of breeding, reduce the field planting scale of the breeding population, reduce breeding costs and accelerate the breeding process.

[0024] (2) This invention utilizes KASP technology to rapidly identify the rice fertility gene locus Ms-1. Compared with SSR, InDel, and CAPS molecular markers, KASP markers are efficient, pollution-free, and easy to scale up, greatly improving the efficiency of molecular detection. They are more suitable for the rapidly developing high-throughput molecular detection platforms and can be applied in high-throughput molecular breeding. Attached Figure Description

[0025] Figure 1 .Optimization effect of KASP molecular markers at gene locus Ms-1. a) shows well-generated KASP molecular markers, b), c), and d) show poorly genotyped KASP molecular markers.

[0026] Figure 2 Genotyping results of the Ms-YJ113-F2 segregating population. Detailed Implementation

[0027] To facilitate a clear understanding of the technical means, creative features, objectives, and effects of this invention, the invention will be further described below in conjunction with specific embodiments.

[0028] Example 1

[0029] Identification of rice materials with different fertility traits and preparation of fertility gene mapping populations

[0030] EMS mutagenesis was performed on the japonica rice variety Yangjing 9538 to obtain a gene mutation population. Screening revealed a sterile mutant with a high abortion rate that could be stably inherited; this mutant was named ms-1. Crossing the ms-1 mutant with normal-fertile rice resulted in a normal-fertile F1 generation. To obtain materials showing fertility differences in rice, eight rice varieties were first field-planted, with three replicates per variety. Each plot contained eight rows (20 plants per row, plant spacing 13.5 cm, row spacing 16.5 cm), under conventional cultivation and management. The planting was conducted at the Yangzhou University field experimental base. Then, the fertility of the eight rice varieties was investigated. Self-pollination set rate was used as the evaluation index for rice fertility; a self-pollination set rate below 5% was considered sterile. The self-pollination set rate was measured as follows: 20 individual plants of each variety were bagged at the panicle tip emergence stage. After the grains matured, bagged rice was harvested on a per-plant basis. The total number of grains in all panicles of each plant was counted, and empty grains were removed by winnowing. The remaining actual grains on each plant were counted again. The seed setting rate of each plant was calculated using the formula (seed setting rate P = actual grain count N / total grain count N0). The average of these averages was then used to represent the self-pollination seed setting rate of each variety. The self-pollination seed setting rate survey showed that the mutant ms-1 had a low self-pollination seed setting rate and was therefore a sterile line, while the seed setting rates of the seven control varieties were all normal.

[0031] Table 1. Phenotypic information of 8 tested rice varieties

[0032] No. Variety name Fertility rate (%) Fertility No. Variety name Fertility rate (%) Fertility No. 01 Yangjing 9538 93.73±7.43 Ms No. 05 Jiafeng You 2 88.79±8.09 Ms No. 02 Yangjing 687 89.69±5.39 Ms No. 06 Jijing 816 78.83±6.81 Ms No. 03 Nanjing 46 91.62±6.79 Ms No. 07 Yangjing 113 76.39±5.62 Ms No. 04 Yangjing 5118 78.58±5.62 Ms No. 08 ms-1 3.39±0.77 ms

[0033] Note: Ms: fertile; ms: infertile.

[0034] To prepare a gene mapping population, Yangjing 687 was used as the male parent and ms-1 as the female parent for hybridization, resulting in a hybrid population containing 113 individual plants. This population was continuously self-pollinated to the F2 generation to obtain the F2 generation mapping population, which was then used for gene mapping. Planting and hybridization were carried out at the Yangzhou University field experimental base, using conventional cultivation and management methods.

[0035] Example 2

[0036] MS-1 localization and KASP marker optimization of linked gene loci

[0037] To obtain gene loci linked to rice fertility, field planting and fertility data surveys were first conducted on the aforementioned F2 generation mapping population. Field planting was carried out at the Yangzhou University field experimental base, and the fertility phenotype measurement method followed that in Example 1. Then, genotyping was performed on 29 sterile individual plants using 34 pairs of rice background genetic markers developed in our laboratory. The genotyping method is as follows:

[0038] 1) Extraction of DNA from rice: Genomic DNA was extracted from rice leaves using the conventional CTAB method;

[0039] 2) KASP reaction test: PCR amplification was performed using 0.8 μL of 50 ng / μL genomic DNA and 0.03 μL of primer mixture. The KASP reaction test was performed using the Douglas Scientific ArrayTape platform.

[0040] 3) The genotype of the amplified products was analyzed using a fluorescence detection analyzer.

[0041] The 1.6 μL PCR ArrayTape platform reaction system includes: 0.8 μL of genomic DNA (50 ng / μL) and 0.03 μL of primer mixture (preferred primer mixture ratio: forward primers Primer X and Primer Y 100 pmol·L⁻¹). -1 12 μL each, reverse primer Primer R 100 pmol·L -1 30 μL, 46 μL ddH2O (other reasonable primer mixture ratios can also achieve the same detection purpose), 0.8 μL LGC 2×KASP Mix (Std Rox), according to the ArrayTape platform instrument operation manual, compile the sample table, run the program, and read the data.

[0042] The above reaction system is the preferred reaction system for Douglas Scientific's ArrayTape platform. Other reasonable reaction systems can also achieve the same detection purpose.

[0043] The above are recommended detection methods. Other detection methods that can achieve the same detection purpose can also be applied to the molecular marker-assisted breeding process of the above markers.

[0044] The 2×KASP Mix consists of fluorescent probe A, fluorescent probe B, quencher probe A, and quencher probe B, as well as high-fidelity Taq enzyme, dNTPs, and Mg. 2+ The amplification program consists of the following components: Fluorescent probe A has the nucleotide sequence 5'-GAAGGTCGGAGTCAACGGATT-3', with a VIC fluorescent group attached to its 5' end; Fluorescent probe B has the nucleotide sequence 5'-GAAGGTGACCAAGTTCATGCT-3', with a FAM fluorescent group attached to its 5' end; Quencher probe A has the nucleotide sequence 5'-AATCCGTTGACTCCGACCTTC-3', with a BHQ quencher group attached to its 3' end; Quencher probe B has the nucleotide sequence 5'-AGCATGAACTTGGTCACCTTC-3', with a BHQ quencher group attached to its 3' end. The amplification program is as follows: 95℃ pre-denaturation for 10 min, 1 cycle; 95℃ denaturation for 20 s, annealing at 55-62℃ (preferably 55℃) for 60 s, 40 cycles.

[0045] Phenotypic measurements and analysis revealed that among the 113 F2 segregating populations, 29 individual plants were sterile and 84 were fertile. Genotyping was performed on the 29 sterile rice plants, and linkage analysis was conducted using QTL IciMapping 3.0 software. Analysis showed that the genetic distance between the marker OsMs071 and the gene controlling rice fertility was 0.15 cM (data shown in Table 2), indicating a high degree of genetic linkage between this locus and the rice fertility gene, making it suitable for rice fertility marker detection. The gene locus corresponding to the marker OsMs071 was named Ms-1, and this locus is anchored at base positions 27607862-27607863 on rice chromosome 1.

[0046] Table 2. Phenotypic and genotypic information of 29 fertile rice plants

[0047]

[0048]

[0049] Note: Ms: fertile; ms: infertile; '+ / +' indicates homozygous fertile genotype; '- / -' indicates homozygous infertile genotype; '+ / -' indicates heterozygous fertile genotype; '*' indicates no detection signal.

[0050] To better utilize the Ms-1 gene locus for rice fertility selection, the molecular markers for this locus were optimized as follows: Flanking sequences of the Ms-1 gene locus were downloaded from the NCBI database, and five sets of KASP primers were designed using Primer 5.0 software. After detection using the Douglas Scientific ArrayTape platform, one set of KASP primers with good polymorphism was selected for subsequent validation. The specific InDel marker primers used to detect the rice fertility gene locus Ms-1 are as follows:

[0051] Primer X: 5'-gaaggtcggagtcaacggattTTGATCTGACTTCACTGAGATTCCA-3' (SEQ ID No. 1, the lowercase part is the specific fluorescent tag sequence VIC);

[0052] Primer Y: 5'-gaaggtgaccaagttcatgctTTGATCTGACTTCACTGAGATTCCC-3' (SEQ ID No. 2, the lowercase part is the specific fluorescent tag sequence FAM);

[0053] Primer R: 5'-ATTTCCTAAACTGGATTTGGTTCCG-3' (SEQ ID No. 3).

[0054] The InDel site corresponding to the primer is the 27607862-27607863 bases on chromosome 1 of the rice genome (corresponding to nucleotides 101-102 in SEQ ID No. 4 in the sequence listing);

[0055] SEQ ID No.4:

[0056] TCGTGGATTCTTGCTCCATTCATTTTTAATCCTTCAGGATTGGATTGGCTGAAGAATTTTAATGATTTTGAGGATTTCCTAAACTGGATTTGGGTTCCGGGGGAATCTCAGTGAAGTCAGATCAAAGCTGGGAGAAGTGGTGGGAAGAAGAAACTGATCATCTTCGGACAACTGGTCTGTTTGGGAGCATATTGGAAATCA.

[0057] The scan data were analyzed, and the genotype of the Ms-1 locus in the rice genome was determined as follows (i.e., whether the bases at positions 27607862-27607863 on chromosome 1 of the rice genome are + or -). If the fluorescence signal data of the amplification product of the rice genome is close to the X-axis (VIC signal) as analyzed by Douglas genotyping software, then the genotype of the Ms-1 locus in the rice genome is + / + homozygous (i.e., the bases at positions 27607862-27607863 on chromosome 1 of the rice genome are + homozygous); if ...). If the fluorescence signal data of the amplification product of the rice being tested is located between the X and Y axes (VIC and FAM signals) as analyzed by Douglas genotyping software, then the genotype of the MS-1 locus in the rice genome is - / - homozygous (i.e., bases 27607862-27607863 on chromosome 1 of the rice genome are - homozygous). If the fluorescence signal data of the amplification product of the rice being tested is located between the X and Y axes (VIC and FAM signals) as analyzed by Douglas genotyping software, then the genotype of the MS-1 locus in the rice genome being tested is + / - heterozygous (i.e., bases 27607862-27607863 on chromosome 1 of the rice genome are both + and - heterozygous).

[0058] The five pairs of KASP molecular markers developed were detected on the Douglas Scientific ArrayTape platform, and the genotyping results were as follows: Figure 1 As shown, the amplification results of primers in Figures b and c are relatively loosely genotyped, which may lead to the inability to interpret edge results. Therefore, they are not recommended as markers for this locus. The amplification results of primers in Figure d are also loosely genotyped due to the different primer amplification efficiencies. Therefore, they are also not recommended as markers for this locus. The amplification results of primers in Figure a are relatively clear in genotype, with each genotype result closely distributed. At the same time, the amplification efficiencies of the two probes for heterozygous genotypes are relatively balanced, making them suitable as primers for the Ms-1 gene locus.

[0059] Example 3

[0060] Application of KASP markers at rice fertility-linked locus Ms-1 in marker-assisted selection of sterile rice plants

[0061] To test the practicality of the Ms-1 locus of this invention, an F1 population was obtained by crossing the fertile material Yangjing 113 with the sterile material ms-1. The F1 population was then naturally self-pollinated to produce an F2 segregating population of 81 plants. KASP marker detection and fertility phenotype verification were performed on the segregating population (Table 3). The methods for marker detection and fertility phenotype verification are as described in Example 1. Figure 2Phenotypic and genotypic analysis was performed on the segregating populations. The fertile rate of individual plants with genotypes + / + and + / - was 96.67%, while the sterile rate of individual plants with genotype - / - was 95.65%. The sterile rate of individual plants with genotype - / - was significantly higher than that of genotypes + / + and + / -, indicating that the Ms-1 gene locus has high practicality in the screening of fertile rice plants.

[0062] Table 3. Phenotypic and Genotypic Information of Rice Segregating Populations

[0063]

[0064]

[0065] Note: Ms: fertile; ms: infertile; '+ / +' indicates homozygous fertile genotype; '- / -' indicates homozygous infertile genotype; '+ / -' indicates heterozygous fertile genotype; '*' indicates no detection signal.

[0066] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and various changes and modifications can be made without departing from the spirit and scope of the invention, all of which fall within the scope of the claims. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A primer for detecting a fertility InDel molecular marker of rice, characterized in that: The primer comprises Primer X, Primer Y and Primer R, the nucleotide sequence of the Primer X is shown as SEQ ID NO. 1; the nucleotide sequence of the Primer Y is shown as SEQ ID NO. 2; and the nucleotide sequence of the Primer R is shown as SEQ ID NO.

3.

2. A method for InDel molecular marker detection using the primer of claim 1, characterized in that: The nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO. 4, wherein the InDel site is adding GT base at the 101-102th position of SEQ ID NO. 4 or not adding GT base.

3. The method of claim 2, wherein: The specific steps of the method are as follows: Step 1): extracting the DNA of the rice to be detected; Step 2): KASP reaction test, 50 ng / μL genomic DNA 0.8 μL, primer mixture 0.03 μL for PCR amplification; the ratio of the primer mixture is forward primer 100 pmol·L -1 Primer X and 100 pmol·L -1 Primer Y each 12 μL, reverse primer 100 pmol·L -1 Primer R 30 μL, ddH2O 46 μL; Step 3): analyzing the genotype of the amplification product by using a fluorescence detection analyzer.

4. The method of claim 3, wherein: The PCR amplification reaction condition in the step 2) is as follows: 95℃ pre-denaturation for 10 min, 1 cycle; 95℃ denaturation for 20 s, 55-62℃ annealing for 60 s, 40 cycles.

Citation Information

Patent Citations

  • Rice fertility recovery gene auxiliary breeding molecular marker and application thereof

    CN107385024A

  • Rice male sterility gene NSM1 and application thereof

    CN112522288A