A molecular switch and its applications

Abstract

The present invention provides a molecular switch and its application. The molecular switch includes an aptamer sequence, a first linear strand, and a second linear strand. The aptamer sequence can bind to a protein to be detected, and the aptamer sequence includes a repressor group at the 3'-end. The first linear strand sequentially includes a first sequence, a second sequence, and a third sequence starting from the 5'-end. The first sequence includes a second primer sequence, and the second sequence and the third sequence are complementary to the aptamer sequence and the second linear strand respectively. The 3'-end of the second linear strand is adjacent to the aptamer sequence, and the second linear strand sequentially includes a fourth sequence, a fifth sequence, and a sixth sequence starting from the 5'-end. The fourth sequence and the sixth sequence are complementary to the third sequence and the second sequence respectively, and the fifth sequence forms an opening loop, and the opening loop includes a first primer sequence and a probe sequence. The molecular switch has the advantages of low cost, high sensitivity, and rapidity when used for protein detection.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a molecular switch and application thereof. Background Art

[0002] Biomarkers include a large class of molecular indicators, such as nucleic acid molecules, proteins, polysaccharides or lipid molecules. They can objectively reflect some medical indicators, can be accurately detected outside the patient's body, and have good repeatability. 1 In recent years, due to the rapid development of transcriptomics and proteomics, more and more disease-related biomarkers have been discovered, playing an important role in the early screening and prognosis of diseases. 2,3 Compared to traditional medical diagnostic tools (such as MRI) that require advanced equipment, in many cases, biomarker detection only requires simple instruments that can be operated even by non-professionals. This has many applications in the detection of new coronaviruses. 4 .

[0003] Among the numerous biomarkers, proteins account for a large proportion, such as tumor immunity and microenvironment biomarkers PD1, PDL1, VEGF, genetic variant biomarkers FEGR1 (fibroblast growth factor receptor 1), DDR2 (discoid domain receptor tyrosine kinase 2), epithelial-mesenchymal transition-related biomarkers TGFβ 5 Current detection methods for protein-based biomarkers include mass spectrometry (MS), magnetic resonance imaging (MRI), enzyme-linked immunosorbent assay (ELISA), Western blot, immunohistochemistry (IHC), and flow cytometry (xMAP). 6 As shown in Table 1, these methods have some problems in practical applications. The most important problems are long time, low detection accuracy and high cost.

[0004] Table 1: Limitations of protein detection methods

[0005]

[0006] Therefore, a protein detection method with short time, high detection accuracy and low cost is needed. Summary of the invention

[0007] The present invention designs a molecular switch composed of two DNA single strands and an aptamer, amplifies the signal by recombinase polymerase reaction, and performs real-time signal detection through a fluorescent probe, realizing the rapid and highly sensitive detection of a target protein (which can also be called a protein to be detected). Designs that do not affect the core reaction principle, such as replacing the aptamer sequence, replacing the template sequence without changing the overall molecular switch design, replacing the types of nucleic acid modification groups without changing their purpose, replacing the types of probes, and replacing the isothermal amplification system at room temperature, should all fall within the scope of protection of the present invention.

[0008] Specifically, the present invention provides the following technical solutions:

[0009] On the one hand, the present invention provides a molecular switch, the molecular switch includes an aptamer sequence, a first linear strand, and a second linear strand, and is characterized in that:

[0010] The aptamer sequence can bind to the protein to be detected, and the aptamer sequence includes a repressor group at the 3' end;

[0011] The first linear strand sequentially includes a first sequence, a second sequence, and a third sequence starting from the 5' end. The first sequence includes a second primer sequence. The second sequence and the third sequence are complementary to the aptamer sequence and the second linear strand. The second primer sequence is used for DNA polymerase to extend the second linear strand with the first linear strand as a template after the molecular switch is turned on, generating a binding site for the second primer on the second linear strand, so that the second primer can replicate with the second linear strand as a template;

[0012] The 3' end of the second linear strand is close to the aptamer sequence, and the second linear strand sequentially includes a fourth sequence, a fifth sequence, and a sixth sequence starting from the 5' end. The fourth sequence and the sixth sequence are respectively complementary to the third sequence and the second sequence. The fifth sequence forms an opening loop, and the opening loop includes a first primer sequence and a probe sequence. The first primer sequence and the probe sequence are used for the second primer to replicate with the second linear strand as a template. When the opening loop is opened into a linear strand, generating a binding site for the first primer and the probe in the complementary sequence of the second linear strand, so that the first primer can replicate with the complementary strand of the second linear strand as a template, further generating a binding site for the probe.

[0013] In some embodiments, the repressor group is selected from a phosphate group, a C3-Spacer, and an amine group.

[0014] In some embodiments, the aptamer sequence binds to the protein to be detected and separates from the second strand, and the molecular switch is turned on.

[0015] In some embodiments, the probe sequence comprises a recognition site for an exonuclease, a fluorophore, a quencher, and a modification group.

[0016] In some embodiments, the fluorophore and the quencher are located on both sides of the recognition site for the exonuclease.

[0017] In some embodiments, the distance between the fluorophore and the quencher is 2 - 4 nt.

[0018] In some embodiments, the modification group is located at the 3'-end of the probe sequence.

[0019] In some embodiments, the modification group is used to block DNA polymerase, and the modification group is selected from an amino group, a phosphate group, and a C3-spacer.

[0020] In some embodiments, in the second linear strand, the fourth sequence is not amplified.

[0021] In some embodiments, the aptamer sequence is as shown in SEQ ID NO:7 or SEQ ID NO:17.

[0022] In some embodiments, the sequence of the first linear strand is as shown in SEQ ID NO:1 or SEQ ID NO:11.

[0023] In some embodiments, the sequence of the second linear strand is as shown in SEQ ID NO:4 or SEQ ID NO:14.

[0024] In some embodiments, the sequence of the probe is as shown in SEQ ID NO:8 or SEQ ID NO:18.

[0025] In some embodiments, the sequence of the first primer is as shown in SEQ ID NO:9 or SEQ ID NO:19.

[0026] In some embodiments, the sequence of the second primer is as shown in SEQ ID NO:10 or SEQ ID NO:20.

[0027] On the other hand, the present invention provides a method for detecting a protein, characterized in that the method is carried out by using the above-mentioned molecular switch and recombinase polymerase reaction.

[0028] On the other hand, the present invention provides the application of the above-mentioned molecular switch in protein detection.

[0029] Definition

[0030] Asymmetric PCR method: A method that uses an unequal amount of a pair of primers to generate a large amount of single-stranded DNA (ssDNA). It can be divided into primer concentration asymmetric PCR and thermal asymmetric PCR. These two primers are respectively called the limiting primer and the non-limiting primer, and the key is the absolute amount of the limiting primer. Too much or too little of the limiting primer is not conducive to the preparation of ssDNA. It is also possible to use ordinary PCR to prepare the target DNA double-stranded DNA (dsDNA), and then use only one of the excessive primers for single-primer PCR to prepare ssDNA with dsDNA as the template.

[0031] Phanta Max polymerase: A high-fidelity DNA polymerase. There is no special requirement for the DNA polymerase in this invention, and any high-fidelity short-fragment DNA polymerase can be used.

[0032] N protein: There are four main structural proteins in the novel coronavirus: spike protein (S protein), nucleocapsid protein (N protein), membrane protein (M protein), and envelope protein (E protein). The S protein is a very important surface protein of the coronavirus and is closely related to the infectivity of the virus. The S protein contains S1, S2, and the receptor-binding domain (RBD). The N protein is abundant in the coronavirus, is a highly immunogenic protein, and is involved in genome replication and regulation of cell signaling pathways. The S protein and the N protein are key raw materials for the novel coronavirus immune detection kit and have important value for the diagnosis and screening of the novel coronavirus.

[0033] Tau protein: Tau protein is the main component of neurofibrillary tangles and is also a biomarker for a series of neurodegenerative diseases such as Alzheimer's disease (AD).

[0034] RPA reaction: That is, the recombinase polymerase reaction, which is a technology that realizes exponential amplification of nucleic acids under isothermal conditions with the participation of multiple enzymes and proteins, and is called a nucleic acid detection technology that can replace PCR. The RPA reaction mainly depends on three enzymes: a recombinase that can bind single-stranded nucleic acids (oligonucleotide primers), a strand-displacing DNA polymerase, and a single-stranded DNA-binding protein (SSB) that binds to single-stranded DNA to prevent the displaced single strand from re-complementary pairing. The mixture of these three enzymes is also active at room temperature, and the optimal reaction temperature is around 37°C.

[0035] Aptamer: That is, nucleic acid aptamer, an oligonucleotide with high affinity for the target molecule. The aptamer in this invention is obtained through literature and is modified with C3-Spacer at the 3' end, which can prevent DNA polymerase from using the aptamer strand as a primer for amplification.

[0036] Molecular switch: A sensor composed of biological macromolecules that can control the opening or closing of a specific reaction. In this invention, the molecular switch refers to a DNA complex composed of an NA strand, an AP strand, and an aptamer.

[0037] NA strand: That is, the non-aptamer strand, referring to a single-stranded DNA without an aptamer sequence in the complete sequence. The NA strand is the longest single strand in the present invention and is divided into three parts: starting from the 5' end, the first part is the sequence of primer 2 + the common sequence (i.e., the sequence that only acts as a backbone and has no special function), and the complementary sequence of this part is incomplete, that is, primer 2 has no binding site; the second part is the aptamer complementary sequence + a partial complementary sequence of the AP strand, and the second part is equivalent to a scaffold for binding to the aptamer and the 3' end of the AP strand; the third part is the AP strand complementary sequence. The ends of the second part and the third part of the NA strand are both sequences complementary to the AP strand, but these two parts of the sequence are not continuous for the AP strand, that is, the two parts of the NA strand are not continuous for the AP strand. In fact, it still means that there is a loop on the AP strand, which is another expression of non-complementary.

[0038] AP strand: That is, the with Aptamer strand, referring to a single-stranded DNA containing an aptamer sequence in the complete sequence. The AP strand can be divided into three parts. Starting from the 5' end, the first and third parts are completely complementary to the NA strand, and the second part is primer 1 + the probe sequence. Since this part of the sequence has no corresponding complementary sequence on the NA strand and can form double strands on both sides, it will bulge into a loop. In the present invention, by designing the two parts of "incompleteness" and "loop", it is ensured that the binding sites of the primer and the probe will not appear, so as to achieve the effect of reaction shutdown. The length of the primer is preferably between 20 and 40 nt, and as long as the complementary sequence parts of the NA strand and the AP strand can ensure that the loop on the AP strand can bulge.

[0039] Fluorescent probe: In the middle of the upstream and downstream primers, a sequence with a length of 46 - 52 nt complementary to the target fragment is designed as the fluorescent probe; the sequence avoids palindromic sequences, internal secondary structures, and continuous repeated bases. The probe has a total of four modification sites: 1. A dSpacer (tetrahydrofuran, THF) is marked at the middle position 30 - 35 nt away from the 5' end as the recognition site for exonuclease (any base, no special requirement); 2. A fluorescent group (such as FAM) is marked on the T base upstream of the THF site, and a quenching group (such as BHQ1) is marked on the T base downstream, and the distance between the two groups is 2 - 4 nt; 3. THF is about 15 nt away from the 3' end, and a modification group, such as an amino group, a phosphate group, or a C3-spacer, is marked at the 3' end. In the present invention, FAM (5-carboxyfluorescein) is used as the fluorescent group, BHQ (black hole quenching group) is used as the quenching group, and C3-Spacer is used as the 3' modification group. Since the initial distance between the fluorescent group and the quenching group is very close, the photons emitted by the fluorescent group will all be absorbed by the quenching group, and there is no fluorescent signal. The fluorescent probe follows the design principle of the real-time fluorescence recombinase polymerase reaction probe.

[0040] Exo enzyme: An exonuclease that can recognize the THF site in the middle of the fluorescent probe. After the probe forms a double strand, the exo enzyme will recognize this site as an exposed 3'-OH end and cleave it. After cleavage, the fluorophore and the quencher are separated, and the photons emitted by the fluorophore will not be absorbed by the quencher, so the fluorescence signal can be detected.

[0041] Beneficial effects

[0042] Through the interaction between the aptamer and the protein and the RPA reaction, the present invention has successfully achieved the high-sensitivity, rapid and low-cost detection of proteins. The present invention can detect the N protein of the novel coronavirus (SARS-COV-2) at the level of 0.1 pg / ml within half an hour at 37°C.

[0043] In addition, the inventors summarized the work on protein concentration detection using aptamers, electrochemistry and immunology methods in other articles reported in recent years (Table 2), and conducted a comprehensive analysis in terms of sensitivity, time, cost and operational convenience. The analysis results show that the present invention has the advantages of low cost, high sensitivity and rapidity compared with the currently common quantitative detection methods. Moreover, the present invention has strong universality and can be used for various different protein-aptamer groups. In theory, as long as the appropriate aptamer is selected, the present invention can be used for micro-quantification.

[0044] Table 2: Comparison of different detection methods

[0045] Brief description of the drawings

[0046] Figure 1 Shows the principle of the RPA reaction. 1. The primer binds to the recombinase to form a complex; 2. The complex searches for the corresponding sequence on the DNA double strand; 3. When the primer finds the corresponding sequence, the recombinase will unwind part of the DNA double strand; 4. With the participation of DNA polymerase, strand displacement reaction starts, and the displaced strand binds to the single-stranded binding protein; 5. Repeat the process from 1 to 4 to amplify the complete fragment; 6. Obtain a complete copy of the template strand.

[0047] Figure 2 Shows the basic principle of fluorescence probe detection. When the switch of the fluorophore on the probe is closed, since the distance between the fluorophore and the quencher is too close, all the photons emitted by the fluorophore are absorbed by the quencher, resulting in no fluorescence signal. A: When the probe forms a double strand with its binding site, its tetrahydrofuran site is cleaved by exonuclease. B: The fluorophore and the quencher are separated, the quencher and the modification group leave the fluorophore, and the modification group is used to block DNA polymerase. C: Fluorescence can be detected.

[0048] Figure 3Shows a schematic diagram of the principle of Captamer according to an embodiment of the present invention.

[0049] A: The NA strand and the AP strand can form a partially complementary dsDNA, and the aptamer can form dsDNA with the 5'-end of the NA. The AP strand is adjacent to the aptamer in sequence, that is, the aptamer and the AP strand are completely adjacent in sequence but there is no phosphodiester bond binding in the middle. The exposed 5'-end of the NA strand (i.e., the first part of the sequence) includes the sequence of primer 2, which means that the complementary sequence of primer 2 does not exist. The second part of the sequence of the AP strand is not complementary to the NA strand, forming a loop in the figure, and the loop includes the sequences of primer 1 and the probe. In the absence of the target protein, the binding sites of primer 1, 2, and the probe do not exist. The switch state is "off".

[0050] B: Since the binding between the aptamer and the NA strand is a thermodynamic equilibrium process with a dissociation equilibrium, there will still be a small part of the aptamer dissociating from the molecular switch, and very weak fluorescence will be detected. The departure of the aptamer from the molecular switch is a sign of the switch being turned on. As long as the target protein is added, the aptamer will bind to the target protein, causing the dissociation equilibrium between the aptamer and the molecular switch to shift in the direction of dissociation, and the aptamer will leave the molecular switch and enter the solution, thus making the molecular switch in the "on" state.

[0051] C: Since there is a C3-spacer at the 3'-end of the aptamer to block DNA polymerase, when the aptamer is bound and taken away by the target protein, the AP strand will form a naked 3'-OH end, so the 3'-end of the AP strand will be complemented using the NA strand as a template.

[0052] D: After replication using the NA strand as a template, the complementary sequence of the first part of the NA strand will appear, which happens to be the binding site of primer 2. When primer 2 extends using the AP strand as a template, the complementary sequence of the loop will appear, that is, the binding sites of primer 1 and the probe will appear. In this way, the loop is no longer a loop because it has a complementary sequence.

[0053] E: After replication twice, the template will have the binding sites of both primer 1 and 2, and exponential amplification of the template can be carried out.

[0054] F: Two primers perform RPA amplification.

[0055] G: The amplified template double-strand. Since primer 1 does not contain the first part of the AP strand, that is, the template actually used for exponential amplification does not have the third part of the NA strand and the first part of the AP strand. Obviously, the shorter the strand, the faster the nucleic acid amplification, which is to improve the response speed of the system. The third part of the NA strand and the first part of the AP strand are set additionally for the appearance of the loop, and they are no longer necessary after the loop unfolds.

[0056] H: The fluorescent probe binds to its complementary sequence, and the exo enzyme cuts the THF site.

[0057] I: The fluorophore and quencher are separated.

[0058] J: The more the fluorescent probe is cut, the stronger the fluorescent signal.

[0059] Figure 4 The curves showing the change of fluorescence intensity with time at different N protein concentrations are shown.

[0060] Figure 5 The standard curve showing the change of fluorescence intensity with N protein concentration is shown. R 2 = 0.9937.

[0061] Figure 6 The curves showing the change of fluorescence intensity with time at different Tau protein concentrations are shown.

[0062] Figure 7 The standard curve showing the change of fluorescence intensity with Tau protein concentration is shown. R 2 = 0.9963 Detailed implementation manners

[0063] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to specific embodiments and the accompanying drawings.

[0064] In the present invention, the inventors combined the advantages of nucleic acid aptamers and recombinase polymerase reactions to construct a system based on nucleic acid aptamers and recombinase polymerase reactions for detecting target proteins, which we call "Captamer" (catch + aptamer). Among them, the aptamer forms a molecular switch, which can initiate the recombinase polymerase reaction by the target (i.e., the protein to be detected) protein, and the signal is output through a fluorescent probe. Taking the nucleocapsid protein N of the novel coronavirus (hereinafter referred to as N protein) and the Alzheimer's disease marker Tau protein as examples, the present invention has demonstrated that the system has good sensitivity and response efficiency to target proteins and can be extended to a wider range of biological assays.

[0065] The present invention designs as Figure 3The molecular switch shown in A in the figure: the top chain is a chain without aptamer sequence, called NA chain (non-aptamer chain). The bottom chain (long chain) is a chain with aptamer sequence, called AP chain (with aptamer chain). The NA chain is bound to the AP chain and the aptamer by hydrogen bonds, and the AP chain is close to the aptamer without phosphodiester bond connection, and there is a repressor group at the 3' end of the aptamer, such as C3-spacer. The repressor group is to prevent DNA polymerase from extending the aptamer as a template. As long as the repressor group can block the DNA polymerase, it can be used in the present invention. The bases of the second part of the sequence of the AP chain are not complementary to the NA chain, forming a loop, and its complementary sequence is the binding site of primer 1 and the fluorescent probe.

[0066] The determination principle of the present invention is: when the target protein is not present in the solution, the repressor group of the aptamer will block the DNA polymerase from extending the AP chain, and the two primers and the probe have no binding sites and do not emit light. When the target protein is present in the solution, the target protein will specifically bind to the aptamer and cause it to detach from the molecular switch, resulting in the formation of a naked 3'-OH end of the AP chain. The DNA polymerase completes the AP chain, exposes the primer 2 binding site, and starts the recombinase polymerase reaction. After that, the probe binding site also appears, and the fluorescence signal begins to rise. The final fluorescence intensity is related to the concentration of the target protein.

[0067] 1) Construction of molecular switches

[0068] NA / AP dsDNA was obtained by PCR, and NA / AP ssDNA was obtained by asymmetric PCR. After gel recovery, the single-strand calibration formula was used to obtain the accurate single-strand concentration, and the molecular switch was constructed by step-by-step cooling using a PCR instrument.

[0069] 2) Recombinase polymerase reaction

[0070] In a 50 μl reaction system, prepare the recombinase polymerase reaction system, that is, add 11.5 μl of the N protein sample to be tested, 2 μl of 10 -12 mol / L molecular switch, 2 μL primer Prime1 (SEQ ID NO.9), 2 μL Prime2 (SEQ ID NO.10), 2.5 μL buffer B, 29.4 μL buffer A, 0.6 μL fluorescent probe (SEQ ID NO.8), The conditions were set in a 96 fluorescence quantitative PCR instrument according to the method in reference 8, and the fluorescence intensity was detected.

[0071] 3) Replace the N protein sample to be tested in the method described in the second item with N protein standard samples with 10-fold concentration gradients from 0.1 pg / ml to 100 pg / ml. Perform protein detection according to the method described in the second item, and draw a standard curve. In the range of N protein concentration from 0.1 pg / ml to 100 pg / ml, the fluorescence intensity at 30 min = 0.1425 lg (protein concentration / pg * mL) + 1.406. The N protein concentration in the sample can be measured and calculated based on the standard curve.

[0072] The sequences used in the present invention are as follows. All sequences are from 5' to 3'. The target proteins are the N protein and Tau protein of the novel coronavirus.

[0073] N protein

[0074] SEQ ID NO:1 N-NA dsDNA

[0075] acatacagccaagcgttaaccctaactcggtattgcgctggatgtgtcaatgtagcggtgcccctaaggaatattgtcgtaagcgacatccagctaaatctttccaagcatcgttcagatgatctacagaatgcatcgagcccctttcaacctcgagtcgtcagtccttctgtgatctctat

[0076] SEQ ID NO:2 N-NA- primer 1

[0077] atagagatcacagaaggactgacgac

[0078] SEQ ID NO:3 N-NA- primer 2

[0079] acatacagccaagcgttaaccctaactcgg

[0080] SEQ ID NO:4 N-AP dsDNA

[0081] taaatctttccaagcatcgttcagatgatctacagaatgcatcgagcccctttcaatattaactgccaactcactttgagtgtttaacactgtatcgctactgtcattaggtactaccgaggcaatatccgcgcctcgagtcgtcagtccttctgtgatctctat

[0082] SEQ ID NO:5 N-AP-Primer 1

[0083] taaatctttccaagcatcgttcagatgatctac

[0084] SEQ ID NO:6 N-AP-Primer 2

[0085] atagagatcacagaaggactgacgac

[0086] SEQ ID NO:7 N–Aptamer Sequence

[0087] cgcttacgacaatattccttaggggcaccgctacattgacacatccagc[C3-spacer]

[0088] SEQ ID NO:8 N–Probe

[0089] agtagcgatacagtgttaaacactcaaag[FAM-dT][THF]ag[BHQ-dT]tggcagttaata[C3spacer]

[0090] SEQ ID NO:9 N–Primer 1

[0091] cgcggatattgcctcggtagtacctaatgac

[0092] SEQ ID NO:10 N–Primer 2

[0093] acatacagccaagcgttaaccctaactcgg

[0094] Tau Protein

[0095] SEQ ID NO:11 Tau-NA dsDNA

[0096] gctgacgcaacttacgctcttcgtgaggaaacgtcagtttaatacttttactggtgctgaagaagaaaagcctcgtcaaagacctgacaggaatccatcgatatctccacattccttcagattcctccatgcatacacgaaggtatgccatcgcctgtgaagccgaagtcaagttcgaaggtgacaccttggtgaacagaagactg

[0097] SEQ ID NO:12 Tau-NA-Primer 1

[0098] gctgacgcaacttacgctcttcgtgaggaaacg

[0099] SEQ ID NO:13 Tau-NA-Primer 2

[0100] cagtcttctgttcaccaaggtgtcaccttcg

[0101] SEQ ID NO:14 Tau-AP dsDNA

[0102] aatccatcgatatctccacattccttcagattcctccatgcatacacgaaggtatgccatcgcctgtgaaggaatcatgagttccgatgatgctgtcgcgccgaagtcaagttcgaaggtgacaccttggtgaacagaa

[0103] SEQ ID NO:15 Tau-AP-Primer 1

[0104] aatccatcgatatctccacattccttc

[0105] SEQ ID NO:16 Tau-AP-Primer 2

[0106] ttctgttcaccaaggtgtcacc

[0107] SEQ ID NO:17 Tau-Aptamer

[0108] cctgtcaggtctttgacgaggcttttcttc[C3spacer]

[0109] SEQ ID NO:18 Tau-Probe

[0110] gaatttcagaggctatagcgatctcagg[FAM-dT]a[THF]a[BHQ-dT]cgatagatcgcta[C3spacer]

[0111] SEQ ID NO:19 Tau-Primer 1

[0112] gctgacgcaacttacgctcttcgtgaggaaacg

[0113] SEQ ID NO:20 Tau-primers 2

[0114] gcgacagcatcatcggaactcatgattcc

[0115] Example 1 Determination of the N protein of the novel coronavirus

[0116] 1. Obtaining single-stranded DNA by asymmetric PCR

[0117] Using Phanta Max polymerase (P505-d1, Vazyme, Nanjing) (a high-fidelity DNA polymerase), single-stranded NA and AP were obtained by asymmetric PCR. When the ratio of the upstream primer to the downstream primer was 20:1, the best effect of obtaining single-stranded fragments was achieved.

[0118] *PCR system

[0119]

[0120] *PCR program

[0121]

[0122] 2. Separating single-stranded DNA by 2.2% agarose gel electrophoresis

[0123] 1) Prepare a 2% agarose recovery gel with the following formula: 4 g of agarose, made up to 200 mL with 1×TAE solution (when the agarose concentration is lower than 2%, it is difficult to separate single-stranded and double-stranded DNA).

[0124] 2) Electrophoresis was carried out at 120 V for 60 min. The migration rate of ssDNA with the same sequence is faster than that of dsDNA, and the band of ssDNA will appear below the band of dsDNA.

[0125] 3) After electrophoresis, cut the single-stranded DNA fragment with a clean knife. The cut agarose gel should be as thin as possible.

[0126] 3. Recovery of single-stranded DNA gel

[0127] Note: Use II Gel Extraction Kit (QIAGEN) and operate according to the kit instructions as follows:

[0128] 1) Place the cut gel in a 1.5 mL EP tube. Each EP tube can hold at most 250 mg of agarose gel.

[0129] 2) Weigh the gel mass and add different amounts of Buffer QX1 according to the size of the DNA fragment: When the DNA fragment is shorter than 100 bp, add 6 volumes of Buffer QX1; when the DNA fragment is between 100 bp and 4 kb, add 3 volumes of Buffer QX1; when the DNA fragment is longer than 4 kb, add 3 volumes of Buffer QX1 and 2 volumes of ddH 2 O; when using an agarose gel with a concentration greater than 2%, add 6 volumes of Buffer QX1.

[0130] 3) Add QIAEX II suspension to the sample and mix well: When the DNA content is less than or equal to 2 μg, add 10 μL of QIAEX II; when the DNA content is between 2 - 10 μg, add 30 μL of QIAEX II; for every additional 10 μg of DNA, add 30 μL more of QIAEX II to the sample. Vortex the sample for 30 s to resuspend the QIAEX II suspension.

[0131] 4) Incubate in a 50 °C water bath for 10 min to completely dissolve the agarose. Vortex every two minutes to keep the QIAEX II suspension suspended. Check to ensure that the color of the mixture is yellow. If the color of the mixture is orange or purple, add 10 μL of 3 M sodium acetate (pH = 5.0) and mix, then continue the water bath incubation for at least 5 min.

[0132] 5) Centrifuge the sample at 17900 × g for 30 s and remove the supernatant with a pipette.

[0133] 6) Add 500 μL of Buffer QX1 to the sample tube and vortex to resuspend the pellet. Centrifuge the sample at 17900 × g for 30 s and carefully remove all the supernatant with a pipette. This step will wash away the residual agarose.

[0134] 7) Wash the pellet twice with 500 μL of Buffer PE. Vortex to resuspend the pellet. Centrifuge the sample at 17900 × g for 30 s and carefully remove all the supernatant with a pipette. This step will wash away the residual salts.

[0135] 8) Open the lid and dry the pellet for 10 - 15 min or until the pellet turns white. If 30 μL of QIAEX II suspension was used, open the lid and dry the pellet for about 30 min. Do not use vacuum evaporation to prevent over - drying, which may lead to a decrease in recovery efficiency.

[0136] 9) To extract the DNA, add 20 μL of 10 mM Tris - CL, pH 8.5, TE buffer or ddH 2O, and resuspend the precipitate by shaking. When the DNA fragment length is less than 4 kb, let it stand at room temperature (15 - 25 °C) for 5 min; when the DNA fragment is 4 - 10 kb, water bath at 50 °C for 5 min; when the DNA fragment is longer than 10 kb, water bath at 50 °C for 10 min.

[0137] 10) Centrifuge at 17900×g for 30 s, and carefully transfer the supernatant to a clean tube with a pipette. The supernatant contains purified DNA.

[0138] 11) (Optional) Repeat steps 9 and 10, and combine the eluates. This step can increase the DNA yield by 10 - 15%.

[0139] 4. Construct the molecular switch

[0140] In the present invention, the molecular switch is a DNA complex formed by the prepared NA ssDNA, AP ssDNA and aptamer through thermodynamic equilibrium. Since the three DNA strands of the final molecular switch are complementary, it is theoretically in the most thermodynamically stable conformation. Therefore, we simulate the PCR process, denature all DNA at high temperature to make it in a single-stranded extended state, and then slowly cool it down to form the structure we need.

[0141] 1) After gel extraction, the accurate concentration of ssDNA needs to be obtained. Since the present invention has very precise requirements for the concentration of single-stranded DNA, the influence of the gel background on the measurement of the single-stranded DNA concentration by the spectrophotometer needs to be considered. To obtain the accurate single-stranded DNA concentration, an empty gel with a size approximate to that of the single-stranded fragment needs to be extracted according to the same steps during gel extraction. Measure the absorbances of the single-stranded DNA and the empty gel at 230 nm, 260 nm, and 280 nm respectively. Subtract the absorbance of the empty gel from the absorbance of the single-stranded DNA, which is the actual absorbance of ssDNA excluding the influence of the empty gel and the extraction steps. Calculate the concentration of the single-stranded DNA and the values of 260 / 230 and 260 / 280 from this, and compare them with the predicted values of 260 / 230 and 260 / 280 to judge the purity of the recovered single-stranded DNA. The concentration of the single-stranded DNA can be calculated using the following formula:

[0142]

[0143] 2) According to the calculation results, add NA single-stranded DNA, AP single-stranded DNA and aptamer with a volume ratio of 1:1:2 into a PCR tube, and mix well; dilute stepwise to 10 -12 M.

[0144] 3) Use a PCR instrument to construct the molecular switch, and the temperature settings of the corresponding PCR system are as follows:

[0145] 95℃ 89℃ 83℃ 77℃ 71℃ 65℃ 59℃ 53℃ 47℃ 41℃ 35℃ 29℃ 5 min 5 min 5 min 5 min 5 min 5 min 5 min 5 min 5 min 5 min 5 min 5 min

[0146] 5. Detection of Protein Concentration by Recombinase Polymerase Reaction

[0147] Use the DNA Thermostat Rapid Fluorescence Kit (Nanjing warbioBiotechnology Co., Ltd) to perform the recombinase polymerase reaction. The specific operation is as follows:

[0148] 1) Add 11.5 μL of ddH 2 O and 2 μL of nucleic acid template to the inner lid of the reaction tube (the volume of the nucleic acid template added can be adjusted according to the nucleic acid concentration, and the volume of ddH 2 O can be adjusted accordingly. A protein solution can also be added, and the volume of ddH 2 O is adjusted accordingly so that the sum of the volumes of the nucleic acid template (the template to be amplified, which refers to the assembled molecular switch in the present invention), ddH 2 O, and the protein solution is 13.5 μL).

[0149] 2) Add 2.5 μL of Buffer B to the inner lid of the reaction tube.

[0150] 3) Add 2 μL of the upstream primer (10 μM), 2 μL of the downstream primer (10 μM), and 0.6 μL of the probe (10 μM) to the inner lid.

[0151] 4) Add 29.4 μL of Buffer A to each tube of enzyme dry powder. After the enzyme dry powder is completely dissolved, transfer all the solutions to the same EP tube, mix well, and add 29.4 μL of the mixed solution to each reaction tube to eliminate the inter-tube differences of the enzyme.

[0152] 5) Invert the reaction tube onto the lid, tightly cap it, and quickly invert it up and down to mix. After mixing, quickly centrifuge the reaction solution to the bottom of the tube, and immediately place the reaction tube into the fluorescence detection device. The fluorescence detection program is set as follows: keep the temperature constant at 37 °C; collect the fluorescence value of the 5-carboxyfluorescein channel every 20 s.

[0153] * Recombinase Polymerase Reaction System

[0154]

[0155]

[0156] * During the reaction, it is necessary to pay attention to avoiding nucleic acid contamination and set a blank control.

[0157] * Buffer A needs to be completely dissolved and mixed well before use, otherwise it will affect the experimental results.

[0158] 6. Detection Results

[0159] As Figure 3 and 4 shown, we used Captamer to detect the N protein of the novel coronavirus, presenting a good discrete curve. Even for a protein as low as 0.1 pg / ml, there was a high fluorescence signal. Taking the fluorescence intensity at 20 min and performing a linear fit on the logarithm of the N protein concentration, a curve with an excellent linear relationship was obtained, with R 2 = 0.993. This indicates that N protein samples with concentrations between 0.1 pg / ml and 100 pg / ml can all be measured using this method.

[0160] Example 2 Determination of Tau Protein

[0161] Except for changing the protein to be measured to Tau protein and replacing the corresponding sequence with the Tau protein sequence, the other conditions were the same as those for measuring the N protein.

[0162] As Figure 5 and 6 shown, the detection accuracy of Tau can reach 0.1 pg / μl. Taking the fluorescence intensity at 20 min for linear fitting, R 2 = 0.9950.

[0163] These results indicate that the Captamer method has good measurement accuracy and universality, and has the potential for industrialization.

[0164] References:

[0165] 1. Strimbu, K. & Tavel, J. A. What are biomarkers?: Curr. Opin. HIV AIDS 5, 463–466 (2010).

[0166] 2. Mayerle, J. et al. Metabolic biomarker signature to differentiate pancreatic ductal adenocarcinoma from chronic pancreatitis. Gut 67, 128–137 (2018).

[0167] 3.Davis,A.A.&Patel,V.G.The role of PD-L1 expression as a predictivebiomarker:an analysis of all US Food and Drug Administration(FDA)approvals ofimmune checkpoint inhibitors.J.Immunother.Cancer 7,278(2019).

[0168] 4.Liu,R.,He,L.,Hu,Y.,Luo,Z.&Zhang,J.A serological aptamer-assistedproximity ligation assay for COVID-19diagnosis and seeking neutralizingaptamers.Chem.Sci.11,12157–12164(2020).

[0169] 5.Vargas,A.J.&Harris,C.C.Biomarker development in the precisionmedicine era:lung cancer as a case study.Nat.Rev.Cancer 16,525–537(2016).

[0170] 6.Shui,B.et al.Biosensors for Alzheimer’s disease biomarkerdetection:A review.Biochimie 147,13–24(2018).

[0171] 7.Aptamers:An Emerging Class of Molecules That Rival Antibodies inDiagnostics|Clinical Chemistry|Oxford Academic.https: / / academic.oup.com / clinchem / article / 45 / 9 / 1628 / 5643446.

[0172] 8. Lyu, C., Khan, I. M. & Wang, Z. Capture-SELEX for aptamer selection: A short review. Talanta 229, 122274 (2021).

[0173] 9. Aptamer–Drug Conjugates|Bioconjugate Chemistry. https: / / pubs.acs.org / doi / 10.1021 / acs.bioconjchem.5b00291.

[0174] 10. Park, K. S. Nucleic acid aptamer-based methods for diagnosis of infections. Biosens. Bioelectron. 102, 179–188 (2018).

[0175] 11. Protein detection using proximity-dependent DNA ligation assays - PubMed. https: / / pubmed.ncbi.nlm.nih.gov / 11981560 / .

[0176] 12. Piepenburg, O., Williams, C. H., Stemple, D. L. & Armes, N. A. DNA detection using recombination proteins. PLoS Biol. 4, e204 (2006).

[0177] 13. Lisi, S. et al. Non-SELEX isolation of DNA aptamers for the homogeneous-phase fluorescence anisotropy sensing of tau Proteins. Anal. Chim. Acta 1038, 173–181 (2018).

[0178] 14. Shi, L., et al. Aptamer-Functionalized Nanochannels for One-Step Detection of SARS-CoV-2 in Samples from COVID-19 Patients. Anal. Chem. 93, 16646–16654 (2021).

[0179] 15. Olson, X., Kotani, S., Yurke, B., Graugnard, E. & Hughes, W. L. Kinetics of DNA Strand Displacement Systems with Locked Nucleic Acids. J. Phys. Chem. B 121, 2594–2602 (2017).

[0180] 16. Taneja, V., et al. An Aptamer Linked Immobilized Sorbent Assay (ALISA) to Detect Circulatory IFN-α, an Inflammatory Protein among Tuberculosis Patients. ACS Comb. Sci. (2020) doi:10.1021 / acscombsci.0c00108.

[0181] 17. Chen, Y. & Corn, R. M. DNAzyme Footprinting: Detecting Protein–Aptamer Complexation on Surfaces by Blocking DNAzyme Cleavage Activity. J. Am. Chem. Soc. 135, 2072–2075 (2013).

[0182] 18. Chen, J., et al. Aptamer-based cell-free detection system to detect target protein. Synth. Syst. Biotechnol. 6, 209–215 (2021).

[0183] 19. Yang, J., Dou, B., Yuan, R. & Xiang, Y. Aptamer / Protein Proximity Binding-Triggered Molecular Machine for Amplified Electrochemical Sensing of Thrombin. Anal. Chem. 89, 5138–5143 (2017).

[0184] 20. Yang, J., Wu, Y., Gan, C., Yuan, R. & Xiang, Y. Target-programmed and autonomous proximity binding aptasensor for amplified electronic detection of thrombin. Biosens. Bioelectron. 117, 743–747 (2018).

[0185] 21. Fu, Y. et al. Highly Sensitive Detection of Protein Biomarkers with Organic Electrochemical Transistors. Adv. Mater. Deerfield Beach Fla 29, (2017).

[0186] 22. Li, T. et al. Serum SARS-COV-2 Nucleocapsid Protein: A Sensitivity and Specificity Early Diagnostic Marker for SARS-COV-2 Infection. Front. Cell. Infect. Microbiol. 10, 470 (2020).

[0187] 23. Lind, K. & Kubista, M. Development and evaluation of three real-time immuno-PCR assemblages for quantification of PSA. J. Immunol. Methods 304, 107–116 (2005).

[0188] 24.I,L.,Sj,K.,M,S.,Ps,H.&Js,D.Highly Sensitive Immuno-CRISPR Assay for CXCL9 Detection.Anal.Chem.93,(2021).

[0189] The specific embodiments described above further elaborate on the purpose, technical solutions, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A molecular switch, the molecular switch comprising an aptamer sequence, a first linear strand, and a second linear strand, characterized in that: the aptamer sequence is capable of binding to a protein to be detected, and the aptamer sequence includes a repressor group at the 3'-end; the first linear strand sequentially includes a first sequence, a second sequence, and a third sequence starting from the 5'-end. The first sequence includes a second primer sequence. The second sequence and the third sequence are complementary to the aptamer sequence and the second linear strand respectively. The second primer sequence is used for generating a binding site for the second primer on the second linear strand when DNA polymerase extends the second linear strand using the first linear strand as a template after the molecular switch is turned on, so that the second primer can replicate using the second linear strand as a template; the 3'-end of the second linear strand is adjacent to the aptamer sequence, and the second linear strand sequentially includes a fourth sequence, a fifth sequence, and a sixth sequence starting from the 5'-end. The fourth sequence and the sixth sequence are complementary to the third sequence and the second sequence respectively. The fifth sequence forms an opening loop, and the opening loop includes a first primer sequence and a probe sequence. The first primer sequence and the probe sequence are used for generating binding sites for the first primer and the probe in the complementary sequence of the second linear strand when the second primer replicates using the second linear strand as a template and the opening loop is opened to become a linear strand, so that the first primer can replicate using the complementary strand of the second linear strand as a template and further generate a binding site for the probe.

2. The molecular switch according to claim 1, characterized in that, when the aptamer sequence binds to the protein to be detected, it separates from the second linear strand, and the molecular switch is turned on.

3. The molecular switch according to claim 1, characterized in that, the probe sequence includes a recognition site for exonuclease, a fluorophore, a quencher group, and a modification group.

4. The molecular switch according to claim 2, characterized in that, the fluorophore and the quencher group are located on both sides of the recognition site for exonuclease.

5. The molecular switch according to claim 4, characterized in that, the distance between the fluorophore and the quencher group is 2 - 4 nt.

6. The molecular switch according to claim 3, characterized in that, the modification group is located at the 3'-end of the probe sequence.

7. The molecular switch according to claim 1, characterized in that, the repressor group is selected from a phosphate group, a C3-Spacer, and an amine group.

8. The molecular switch according to claim 1, characterized in that, in the second linear strand, the fourth sequence is not amplified.

9. A method for detecting a protein, characterized in that the method is carried out using the molecular switch according to any one of claims 1 - 8 and a recombinase polymerase reaction.

10. Use of the molecular switch according to any one of claims 1 - 8 in protein detection.

Images