Use of an expression promoter of miR-8072 in preparation of an antitumor drug

Through miR-8072 expression promoters and detection methods, miR-8072 has become an effective diagnostic and prognostic biomarker for triple-negative breast cancer, significantly prolonging overall survival and inhibiting tumor development. This addresses the issues of lack of targeted drugs and insufficient diagnostic biomarkers, achieving highly effective tumor treatment.

CN116019827BActive Publication Date: 2025-11-25NINGXIA MEDICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310027207.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-09
Publication Date
2025-11-25
Estimated Expiration
2043-01-09

AI Technical Summary

Technical Problem

Current technologies lack effective targeted drug therapy for triple-negative breast cancer. The mechanism of action of miR-8072 in the development and progression of breast cancer has not been reported, and there is a lack of relevant diagnostic and prognostic biomarkers.

Method used

We provide miR-8072 expression promoters, including recombinant expression plasmids, and detect miR-8072 using high-throughput sequencing, quantitative PCR, and probe hybridization methods. These methods are used to prepare anti-tumor drugs, and we found that elevated miR-8072 levels are associated with prolonged overall survival in patients. Overexpression of miR-8072 can inhibit the development of triple-negative breast cancer.

Benefits of technology

miR-8072 has become an effective diagnostic and prognostic biomarker for triple-negative breast cancer, significantly prolonging patients' overall survival and effectively inhibiting the development of triple-negative breast cancer in vitro and in vivo, thus enhancing the clinical efficacy of therapeutic targets.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116019827B_ABST
    Figure CN116019827B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to application of an expression promoter of miR-8072 in preparation of an antitumor drug. The tumor includes but is not limited to triple-negative breast cancer, the sequence of the miR-8072 is shown as SEQ ID NO. 1, and the expression promoter of the miR-8072 includes a recombinant expression plasmid containing the miR-8072. It is found for the first time that the expression level of miR-8072 in a triple-negative breast cancer patient has a significant correlation with a significant prolongation of total survival, overexpression of the miR-8072 can efficiently inhibit development of the triple-negative breast cancer, and results show that the miR-8072 is a potential diagnosis marker and a molecular target for treatment of the triple-negative breast cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of miR-8072 expression promoters in the preparation of antitumor drugs. Background Technology

[0002] Breast cancer is the most commonly diagnosed cancer among women and a leading cause of cancer death. According to the latest statistics in 2020, breast cancer has surpassed lung cancer to become the most common cancer in women. Triple-negative breast cancer (TNBC) is a subtype of breast cancer that has a higher recurrence and metastasis rate compared to other types. Studies have shown that patients with triple-negative breast cancer generally have a worse prognosis than those with other types of breast cancer and are more sensitive to chemotherapy. Therefore, chemotherapy is commonly used to treat triple-negative breast cancer in its early and late stages. However, there are currently no effective targeted therapies for triple-negative breast cancer, prompting researchers to search for molecular targets to treat it.

[0003] MicroRNAs are small, single-stranded RNA molecules found in eukaryotes, typically composed of 18-20 nucleotides. They usually bind to the 3'UTR region of mRNA and regulate its expression. Numerous studies have shown that miRNAs are closely related to tumorigenesis and development. In breast cancer cells, miRNAs often act as oncogenes or tumor suppressors, regulating cell cycle progression, proliferation, invasion, migration, and epithelial-mesenchymal transition. Some studies have indicated that miR-8072 is associated with the prognosis of patients who have undergone gastric cancer resection, but the role and mechanism of miR-8072 in the development of tumors, including breast cancer, have not yet been reported. Summary of the Invention

[0004] In view of the above-mentioned technical problems, the present invention provides the application of miR-8072 expression promoters in the preparation of antitumor drugs, wherein the tumor includes, but is not limited to, triple-negative breast cancer.

[0005] Furthermore, the sequence of miR-8072 is shown in SEQ ID NO.1.

[0006] Furthermore, the miR-8072 expression promoter includes a recombinant expression plasmid containing miR-8072.

[0007] Based on the same inventive concept, the present invention also provides the use of the formulation for detecting miR-8072 in the preparation of products for diagnosing and / or predicting triple-negative breast cancer.

[0008] Furthermore, formulations for detecting miR-8072 include those based on high-throughput sequencing and / or quantitative PCR and / or probe hybridization methods for detecting miR-8072 transcription.

[0009] Furthermore, elevated levels of miR-8072 in patients with triple-negative breast cancer indicate prolonged overall survival.

[0010] The present invention has the following beneficial effects:

[0011] This invention is the first to discover a significant correlation between miR-8072 expression levels and prolonged overall survival in patients with triple-negative breast cancer, making it an effective biomarker for the diagnosis and prognosis of triple-negative breast cancer. Furthermore, we explored the role of miR-8072 using animal and cell models. The results showed that, both in vivo and in vitro, overexpression of miR-8072 effectively inhibits the development of triple-negative breast cancer, enhancing its potential as a therapeutic target for improving the clinical efficacy of triple-negative breast cancer treatment. Attached Figure Description

[0012] Figure 1 To compare overall survival in TNBC patients with high and low miR-8072 expression.

[0013] Figure 2 The effect of miR-8072 on the proliferation capacity of TNBC cells is shown in Figure 1. A represents cell growth capacity, B represents cell colony formation capacity, and C represents cell proliferation rate.

[0014] Figure 3 The effect of miR-8072 on the migration ability of TNBC cells is shown in Figure A, where A represents the longitudinal migration ability of cells and B represents the horizontal migration ability of cells.

[0015] Figure 4 The effect of miR-8072 on the development of TNBC tumors in mice. In the figures, A is a mouse image, B is a tumor image, C is tumor weight, D is tumor volume, and E is the expression level of Ki67, a marker related to triple-negative breast cancer cell proliferation. Detailed Implementation

[0016] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0017] Example 1: Differential expression of miR-8072

[0018] The relationship between miR-8072 expression level and overall survival in 97 patients with TNBC breast cancer was analyzed using the TCGA database.

[0019] The results are as follows Figure 1As shown, patients with higher miR-8072 expression levels had significantly longer overall survival compared to patients with lower miR-8072 expression levels.

[0020] Example 2: Validation of miR-8072's in vitro anti-cancer ability

[0021] 1 Method

[0022] 1.1 mimics and lentiviral packaging overexpressing miR-8072

[0023] The sequence of miR-8072 (SEQ ID NO. 1) is: GCGUCAAGAUGGCGGCGGGGAG GUAGGCAGAGCAGGACGCCGCUGCUGCCGCCGCCACCGCCGCCUCCGC UCCAGUCGCC.

[0024] The overexpression of mimics was outsourced to Guangzhou Ruibo Biotechnology Co., Ltd., and the packaging of the overexpressed lentivirus was outsourced to Shanghai Jikai Biotechnology Co., Ltd.

[0025] 1.2 Cell transfection

[0026] MDA-MB-231 cells that have grown to the logarithmic growth phase (70%-80%) were digested and seeded into 6-well plates. After 24 hours, the cell density was increased to 70%-80%. Transfection reagents A (Opti-mem + miR-8072 mimics) and B (Opti-mem + lip 2000) were prepared. After standing for 5 minutes, solution A was added to solution B and gently mixed. After standing for 30 minutes, the mixture was added to the 6-well plates, and 1.6 ml of serum-free medium was added to each well. After 6 hours, the medium was replaced with normal 1640 medium. Subsequent experiments were performed after 24 hours.

[0027] 1.3 Cell Infection

[0028] MDA-MB-231 cells that have grown to the logarithmic growth phase (70%-80%) were digested and seeded into 6-well plates. After 24 hours, the cell density reached 30%-40%. The infection reagent was prepared by adding lentivirus overexpressing miR-8072 to the 6-well plates. The medium was changed after 12 hours. After 72 hours, the cells were screened under pressure with puromycin. After one week, subsequent experiments were carried out.

[0029] 1.4 Edu Experiment

[0030] Logarithmic growth phase cells were seeded into 96-well plates and cultured for 24 hours. After incubation with Edu reagent for two hours, the culture medium was discarded, the cells were washed with PBS, fixed with fixative, stained with Edu staining agent, observed and photographed under a microscope in the dark, and counted and statistically analyzed.

[0031] 1.5MTS Experiment

[0032] Tumor cells from the control and experimental groups were prepared into 1×10⁻⁶ cells using 10% fetal bovine serum culture medium. 3 Cell suspension of 100 μL per well was cultured in 96-well plates. At 0, 1, 2, 3, 4 and 5 days, 20 μL of MTS solution was added. After 2 hours of reaction, the absorbance of each well was measured at 490 nm using a full-wavelength microplate reader. The results were statistically analyzed after all measurements were completed.

[0033] 1.6 Plate Colony Formation Experiment

[0034] Tumor cells from the control group and the experimental group were seeded at 1000 cells per well in 6-well plates. After culturing for 2 weeks, the cells were washed twice with PBS, fixed with ice-cold methanol for 20 minutes, stained with crystal violet for 20 minutes, observed and photographed under a microscope, and the number of cells forming a clone was calculated.

[0035] 1.7 Migration Capability Analysis

[0036] Transmembrane experiments were performed using 24-well transmembrane chambers without matrix gel coating. The upper chamber contained 2 × 10⁻⁶ cells from both control and experimental groups treated with serum-free RPMI-1640 medium. 4 Cells were cultured in a chamber with 20% fetal bovine serum (FBS) in the lower chamber. Cells were cultured at 37°C and 5% CO2 for 24 hours (migration assay). The surface of the chamber was fixed with methanol for 20 minutes and stained with crystal violet for 20 minutes. Migrating cells were photographed in three randomly selected fields of view under a microscope, counted, and statistically analyzed.

[0037] 1.8 Scratch Healing Experiment

[0038] Cells from both the experimental and control groups were seeded in 6-well plates. After 12 hours of culture until confluence, the cell layer was gently scratched with the tip of a pipette, rinsed with PBS, and the culture medium was replaced. The width of the scratches was photographed under a microscope, and the initial image location of the scratched area was marked on the bottom of the culture plate. Cells were continued to be cultured in an incubator, and images of the same area were taken and recorded under a microscope every 12 or 24 hours.

[0039] 2 Results

[0040] like Figure 2 As shown, overexpression of miR-8072 significantly reduced cell growth capacity, cell colony formation capacity, and cell proliferation rate. These results indicate that miR-8072 can inhibit the in vitro proliferation of breast cancer cells.

[0041] like Figure 3As shown, overexpression of miR-8072 reduced the number of cells passing through the Transwell chamber and slowed the wound healing rate. These results indicate that miR-8072 can inhibit the migration ability of triple-negative breast cancer cells.

[0042] Example 3: Verification of miR-8072's in vivo anti-cancer ability

[0043] 1 Method

[0044] Four-week-old female nude mice were subcutaneously injected with stable overexpression of miR-8072 and control MDA-MB-231 cells (5 × 10⁻⁶). 6 Tumor volume was monitored weekly. Mice were euthanized 5 weeks after inoculation, and tumor masses were collected, weighed, and photographed.

[0045] 2 Results

[0046] like Figure 4 As shown, compared with the control group, MDA-MB-231 cells overexpressing miR-8072 exhibited significantly reduced growth capacity in nude mice, resulting in smaller and lighter tumor masses at the experimental endpoint; the expression level of the proliferation-related marker Ki67 was also weaker. This indicates that overexpression of miR-8072 can inhibit the in vivo proliferation of TNBC cells.

[0047] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0048] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of miR-8072 expression promoters in the preparation of antitumor drugs, characterized in that, The tumor is a triple-negative breast cancer, characterized in that the sequence of miR-8072 is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The miR-8072 expression promoter includes a recombinant expression plasmid containing miR-8072.

Citation Information

Patent Citations

  • Breast cancer detection kit or device, and detection method

    US20170130275A1