A Cladosporium strain from seabed sediments for controlling tobacco aphids
By using the marine fungus Cladosporium strain MFC2117 and its secondary metabolites, the environmental pollution and pesticide resistance problems of chemical pesticides in the control of tobacco aphids and tobacco common mosaic virus were solved, and efficient biological control effects were achieved.
Patent Information
- Application Number
- CN202210794252.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-05
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2042-07-05
AI Technical Summary
In the existing technology, chemical pesticides have the problems of environmental pollution and increased resistance in the control of tobacco aphids, and there are no reports on biological control methods using secondary metabolites of marine fungi.
Provided are a Cladosporium sp. strain MFC2117 from seabed sediments and its secondary metabolites. Metabolites with biological activity are obtained through fermentation and extraction and are used to control tobacco aphids and tobacco common mosaic virus.
When the treatment concentration was 500 mg/L, the fermentation liquid of the MFC2117 strain had a 100% lethality rate against tobacco aphids and a 95% inhibition rate against tobacco mosaic virus, showing a significant biological control effect.
Smart Images

Figure CN116024095B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of microbial control technology and specifically relates to a strain for controlling tobacco aphids, specifically a Cladosporium sp. strain derived from seafloor sediments, and a mixture of secondary small molecule compounds obtained from the strain. The strain and its metabolites can be used for controlling tobacco aphids. Background Art
[0002] As people become increasingly concerned about their health and the environment, the drawbacks of traditional chemical pest control methods have drawn significant attention. The widespread use of chemical pesticides has led to increased pesticide residues in the environment, the development of pesticide resistance, and the resurgence of pests and diseases. As countries around the world become more aware of the social, environmental, and human health issues associated with chemical pesticides, their use is increasingly restricted or banned. As biopesticides, a new type of pesticide with low toxicity, low residue levels, and a low resistance to pest resistance, have naturally become a hot topic of interest and development within the modern pesticide industry. Their research and development and industrialization have become a national strategic imperative.
[0003] Microbial pesticides are an important category of biopesticides, including agricultural antibiotics and live microbial pesticides. Isolated and purified from natural products, microbial pesticides can be used directly for pest control or as lead compounds for the synthesis of new pesticides. These pesticides retain the advantages of the original bioactive substances, such as low toxicity and low residue, while overcoming the limitations of some natural products, such as poor stability and low activity, thereby fully tapping the potential of bioactive substances.
[0004] Fungi are a valuable resource for the development of microbial pesticides, and countries around the world have invested significant research efforts in this area. Currently, over 70 registered biopesticides use terrestrial fungi or their metabolites as active ingredients. These microbial pesticides are widely used to control plant diseases, insect pests, and weeds. my country has also achieved remarkable results in both applied and basic research. Although biopesticide production in my country currently accounts for only 9% of total pesticide production, from the perspective of long-term human interests and pesticide development trends, the potential for biopesticide development is enormous. Marine fungi originate from the marine environment and are not parasites of terrestrial organisms. Therefore, marine fungi have no advantages over terrestrial fungi in the development of biopesticides that directly use living microorganisms as effective insecticides or fungicides. However, they offer significant advantages in the development of pesticides that use microbial metabolites as active ingredients.
[0005] Marine fungi thrive in harsh environments (high salinity, high pressure, hypoxia, low nutrition, and lack of light). To survive, they have evolved over long periods of time to produce unique secondary metabolites. Fungi that are symbiotic with marine plants and animals, in particular, actively participate in the metabolic processes of these organisms by secreting bioactive metabolites to maximize their survival. These metabolites play a crucial role in the ecological defense of animals and plants against infection and phagocytosis, and are considered promising candidates for antibiotic screening. 70%-80% of new compounds isolated from marine fungi exhibit a wide range of bioactivities, attracting significant attention from chemists and biologists. These compounds include terpenes, peptides, alkaloids, ketones, and esters, many of which are active ingredients or precursors of certain insecticides and fungicides. Regarding the functions and uses of marine fungal secondary metabolites, researchers have focused more on the development of medical drugs for treating human diseases, while less research has focused on their agricultural insecticide and fungicide properties.
[0006] The tobacco aphid, Myzus persicae (Sulzer), belongs to the Aphididae family in the order Homoptera. It is a major agricultural pest, damaging a variety of plants, including tobacco, cruciferous vegetables, and peaches. It also serves as a vector for several plant viruses, including cucumber mosaic virus (CMV) and potato virus Y (PVY). Currently, chemical control remains the most effective method for tobacco aphid control. While there have been several successful biological control approaches, such as the breeding and release of the natural enemy, the wasp Myzus persicae, there have been no reports on the development of biological agents for tobacco aphid control using secondary metabolites from marine microorganisms. Summary of the Invention
[0007] The present invention aims to provide a strain for controlling tobacco aphids, namely a Cladosporium sp. strain from seabed sediments and its use in the biological control of tobacco aphids. At the same time, the screened strain that can produce secondary metabolites that are bioactive against tobacco aphids is applied to the biological control of tobacco aphids, thereby overcoming the shortcomings of the existing technology.
[0008] The present invention first provides a Cladosporium sp. MFC2117 strain from seabed sediments, which was deposited in the General Microbiology Center of the China Culture Collection Administration on April 26, 2022. The deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is: CGMCC NO.40162.
[0009] The MFC2117 strain screened by the present invention is used for preventing and controlling tobacco aphids or tobacco common mosaic virus, and can also be used to prepare products with the function of preventing and controlling tobacco aphids or tobacco common mosaic virus.
[0010] The present invention also provides a metabolite of the MFC2117 strain, a specific preparation method of which is as follows:
[0011] The fermentation supernatant of the MFC2117 strain was extracted with ethyl acetate, and the obtained organic phase was concentrated under reduced pressure on a rotary evaporator, eluted with methanol, and evaporated to dryness at room temperature to obtain a crude metabolic extract of the MFC2117 strain.
[0012] The fermentation, as specifically described in one embodiment, is to inoculate the MFC2117 strain into PDB seawater culture medium and ferment at 28°C.
[0013] The metabolites are used to control tobacco aphids or tobacco common mosaic virus.
[0014] The MFC2117 strain obtained by the present invention has biological activity against tobacco aphids and can be used to control tobacco aphids. The micro-drip method for bioassay of tobacco aphids shows that the secondary metabolites in the fermentation liquid have a maximum lethality rate of 100% against tobacco aphids at a treatment concentration of 500 mg / L. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 : Colony morphology of strain MFC2117 on PDA medium;
[0016] Figure 2 :Antagonistic activity of strain MFC2117 against TMV;
[0017] Figure 3 : Photographs of liquid fermentation of strain MFC2117 for 14 days;
[0018] Figure 4 : Photographs of solid fermentation of strain MFC2117 for 7 days;
[0019] Figure 5 : HPLC spectrum of crude extract of secondary metabolism of strain MFC2117 (top is PDB culture, bottom is rice medium culture). DETAILED DESCRIPTION
[0020] The strain of the present invention is described in detail below with reference to specific examples.
[0021] Example 1: Isolation, identification and cultivation of marine fungus MFC2117 strain
[0022] Sediment collected from the No. 1 Bathing Beach in Qingdao, Shandong Province, in December 2020, was plated on PDA culture medium (prepared by peeling potatoes, cutting 200g into small pieces, adding 1L of seawater, and boiling for 30 minutes. Filter through 4-6 layers of gauze, add 20g of glucose, dissolve, and replace lost moisture with distilled water. For solid culture, add 1.5-2% agar and sterilize by autoclaving at 121°C for 20 minutes). The strain MFC2117 was isolated and purified from a single spot at 28°C. 18s rDNA ITS gene sequence analysis identified it as Cladosporium sp.
[0023] Its 18s rDNA ITS gene sequence is as follows:
[0024] ACGGTAGTGACTGCGGATGACATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGT CTATTATACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGCGCCTTTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATG CAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTA TTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGT CCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGAAA.
[0025] The colony culture morphology is as follows: after 7 days of culture on PDA medium, the colony is 9 cm in diameter, flat, with dense, yellow-white aerial hyphae, and filamentous, white edges; the middle of the back is yellow-white, with white edges. The conidial stalks are yellow-green and black, and are produced in large quantities ( Figure 1 After cultivation in PDB liquid medium, the bacteria were spherical (Figure 3). The optimal growth temperature of MFC2117 strain was 28°C, the optimal pH was 10, the optimal culture time was 8 days, and the optimal culture medium was seawater PDB medium.
[0026] The microscopic morphology is as follows: conidiophores grow on creeping hyphae, are upright, 400-700 μm high and 8-13 μm in diameter; sporangium cysts are spherical, 40-55 μm in diameter; conidial cells are ampoule-shaped, grow in a single layer on the sporangium cysts, without septa, and are 2.5-4×5-8 μm; conidia are chain-like, spherical, smooth, colorless, and 2-5 μm in diameter.
[0027] Example 2: Field test on the efficacy of fermentation supernatant of marine fungus strain MFC2117 against tobacco aphids
[0028] The marine fungus strain MFC2117 was inoculated into PDB liquid medium and incubated at 28°C for approximately 40 days. The fermentation supernatant was then collected for field control. During the peak infestation period of tobacco aphids, the fermentation supernatant was evenly sprayed onto the front and back of the leaves above the tobacco plants, where aphids were present, using a 1L sprayer. The baseline insect population was surveyed before spraying, and the number of remaining live insects was surveyed 1, 3, and 7 days after spraying. Based on these survey results, the corrected control efficacy of the fermentation supernatant against tobacco aphids was calculated to be 75.28%, 89.05%, and 91.11% on days 1, 3, and 7, respectively. These results demonstrate that the fermentation supernatant of the MFC2117 strain is effective against tobacco aphids in the field.
[0029] Example 3: Bioassay of Secondary Metabolism Active Substances of Marine Fungus Strain MFC2117 against Myzus persicae
[0030] The marine fungus strain MFC2117 was inoculated into PDB liquid medium and incubated at 28°C for approximately 40 days. After fermentation, the supernatant was extracted three times with equal volumes of ethyl acetate. The resulting organic phase was concentrated on a rotary evaporator under reduced pressure, eluted with methanol, and evaporated to dryness at room temperature to obtain a crude metabolic extract of the MFC2117 strain.
[0031] The toxicity of crude extracts of its secondary metabolites to tobacco aphids was tested using the insect-leaf dip method. A 9-cm diameter Petri dish was lined with filter paper and 1 mL of distilled water was added to maintain an appropriate humidity. A tobacco leaf of appropriate size was immersed in the solution for 10 seconds, allowed to dry, and then placed in the Petri dish. The leaf stalk was moistened with absorbent cotton and water. A tobacco leaf with aphids was immersed in the diluted crude extract solution for 10 seconds. Thirty healthy, wingless aphids of uniform size were then placed in the Petri dish.
[0032] The crude extract was prepared with acetone to a 10,000 mg / L stock solution. This was then serially diluted with water to prepare solutions at 5,000 mg / L, 2,500 mg / L, 1,250 mg / L, 625 mg / L, and 312.5 mg / L, respectively. Three replicates were set for each experiment. Mortality of Myzus persicae at each crude extract concentration was statistically analyzed over 24 hours. Data were processed using SPSS software to calculate LC50 values, regression equations, and correlation coefficients.
[0033] Results showed that the active ingredients in the crude extract of the secondary metabolite of the marine fungus strain MFC2117 were highly toxic to Myzus persicae (P. mesydis), with higher concentrations resulting in a higher insecticide rate, reaching 100% at a treatment concentration of 500 mg / L. Statistical analysis using SPSS software revealed that the LC50 value of the MFC2117 fermentation broth extract against Myzus persicae was 288.35 mg / L. The toxicity regression equation was: y = -7.952 + 3.232x, R = 0.85, and 95% confidence limits were 176.499 to 381.814.
[0034] The above results indicate that the MFC2117 strain screened by the present invention has a good control effect on tobacco aphids and has great promotion and application value.
[0035] Example 4: Inhibitory effect of marine fungus strain MFC2117 on tobacco common mosaic virus
[0036] The inhibitory activity of the MFC2117 strain against TMV was determined using the localized necrosis spot assay. 1 g of fresh TMV-infected leaves was weighed and mixed with 10 mL of sterile phosphate buffer to form a homogenate. The supernatant was filtered through sterile gauze and used as the inoculum. The strain was then inoculated into PDB liquid medium for large-scale fermentation. The fermentation supernatant was then used as the anti-TMV bacterial solution. This bacterial solution was mixed with equal amounts of TMV inoculum, and PDB liquid medium and TMV inoculum were mixed with equal amounts of TMV inoculum. After each mixture was allowed to rest at room temperature for 10 minutes, it was then inoculated with Sansheng-NN tobacco by friction. An appropriate amount of corundum was sprayed on the leaf surface before inoculation. The left half of the leaf was inoculated with the mixture of bacterial solution and TMV inoculum, while the right half was inoculated with the mixture of PDB medium and TMV inoculum as a control. 200 μL of the solution was inoculated into each leaf half. After inoculation, the leaves were rinsed with water three times. The results were observed three days after inoculation, and the number of necrosis spots was counted to calculate the inhibition rate. The results showed that the fermentation broth of the strain had a good inhibitory effect on TMV, with the necrosis inhibition rate reaching 95% (Table 1, Figure 2 ), the biocontrol strains produced resistance substances that inhibited TMV activity during their growth and metabolism.
[0037] Inhibition rate (%) = [1-(average number of necrotic spots in treatment group / average number of necrotic spots in control group)] × 100.
[0038] Table 1: Inhibitory effect of MFC2117 strain fermentation supernatant on TMV
[0039]
[0040] Example 5: Analysis of the richness of secondary metabolites of marine fungus strain MFC2117
[0041] The marine fungus MFC117 strain was inoculated into liquid PDB medium ( Figure 3 ) and solid rice medium ( Figure 4 ) at 28°C, and static fermentation was cultured for approximately 40 days. After fermentation, the supernatant of the liquid PDB medium was extracted three times with an equal volume of ethyl acetate. The solid-state fermentation rice culture was directly extracted three times with an equal volume of ethyl acetate. The resulting organic phases were concentrated under reduced pressure on a rotary evaporator, eluted with methanol, and evaporated to dryness at room temperature to obtain crude extracts of secondary metabolism from the liquid and solid-state fermentations of the MFC2117 strain.
[0042] Table 2: HPLC standard procedure table
[0043]
[0044]
[0045] The crude extracts of MFC2117 obtained by the two culture methods were dissolved in an appropriate amount of methanol and analyzed by high performance liquid chromatography (HPLC). The number of chromatographic peaks and ultraviolet absorption curves were compared and analyzed to analyze the variety richness and content of secondary metabolites of strain MFC2117 under the two different culture methods of liquid and solid. Figure 5 The results showed that there were certain differences in the richness of secondary metabolites produced by strain MFC2117 under the two culture methods. The number of chromatographic peaks of secondary metabolites produced by strain MFC2117 under liquid fermentation was greater than that produced under rice culture, but the main peak of the chromatographic peak was more obvious under rice culture.
Claims
1. A Cladosporium strain, characterized in that The deposit number of the strain is CGMCC NO.40162.
2. Use of the Cladosporium strain according to claim 1 in preventing and controlling tobacco aphids or tobacco common mosaic virus.
3. Use of the Cladosporium strain according to claim 1 in the preparation of a product for controlling tobacco aphids or tobacco common mosaic virus.
4. A product for controlling tobacco aphids or tobacco common mosaic virus, characterized in that: The product contains the Cladosporium strain according to claim 1.
Citation Information
Patent Citations
Bacterial strain with antiviral activity and application thereof
CN104694399A