Klebsiella oxytoca producing cyclodextrin glucanotransferase

Abstract

The application discloses a Klebsiella oxytoca strain for producing cyclodextrin glucosyltransferase and belongs to the technical field of microbiology. The KCEB04 strain is isolated from bitter orange and is classified and named as Klebsiella oxytoca, which is preserved in the China General Microbiological Culture Collection Center on July 25, 2022, has a preservation number of CGMCC NO. 25392 and a preservation address of No. 3, Yitianxiliujian, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. When soluble starch is used as a substrate, the strain produces alpha-cyclodextrin, beta-cyclodextrin and gamma-cyclodextrin under the action of cyclodextrin glucosyltransferase, has high reaction efficiency, few by-products, simple steps and is green, environment-friendly and pollution-free.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of microbiology, in particular to a Klebsiella oxytoca producing cyclodextrin glucosyltransferase. BACKGROUND

[0002] Cyclodextrins are generally a cyclic oligosaccharide consisting of 6 or more D-glucopyranose units linked head-to-tail by α-1,4-glycosidic bonds, usually containing 6-12 glucosyl units, and the most widely used cyclodextrin is α-cyclodextrin (α-CD), β-cyclodextrin (β-CD) and γ-cyclodextrin (γ-CD), which are composed of different glucosyl unit molecules. Cyclodextrins have special structures, with hydrophilic groups on the outside and relatively hydrophobic on the inside, which can complex and molecularly recognize various organic compounds, thereby changing and protecting the physicochemical properties of guest compounds. Since cyclodextrins are converted from starch, they are non-toxic and biodegradable, meaning they can be widely used in agriculture, food industry, cosmetics, pharmaceuticals and many other fields. Cyclodextrins are most commonly used in the cosmetics and food industries, and less than 10% of the produced cyclodextrins are used in pharmaceuticals. In the pharmaceutical industry, cyclodextrins are mainly used in drug formulations to improve drug bioavailability by increasing the solubility limit and dissolution rate of drug complexes. Cyclodextrins and their derivatives have applications in biosynthesis and natural antibacterial agents, removal of certain pollutants in soil and water.

[0003] Cyclodextrin glucosyltransferase (CGTase) is an extracellular enzyme that can synthesize cyclodextrin by intramolecular transglycosylation of starch and related substrates, belonging to the α-amylase family. By transferring the glucose group of the substrate, cyclodextrin is obtained. CGTase can catalyze disproportionation, cyclization, coupling and hydrolysis reactions (the first three are transglycosylation reactions). In industry, cyclodextrin glucosyltransferase is mainly used for cyclization to produce cyclodextrin from starch, providing new research resources for the application and development of cyclodextrin. There is no related report on the production of cyclodextrin glucosyltransferase by microorganisms. SUMMARY

[0004] The purpose of the present application is to provide a Klebsiella oxytoca producing cyclodextrin glucosyltransferase to solve the problems existing in the prior art. The present application found that the cyclodextrin glucosyltransferase produced by Klebsiella oxytoca KCEB04 has the function of catalyzing the conversion of soluble starch to generate cyclodextrin, providing a new strain source for the production and research of cyclodextrin.

[0005] To achieve the above purpose, the present application provides the following scheme:

[0006] The application provides a Klebsiella oxytoca, which is preserved in the China General Microbiological Culture Collection Center on July 25, 2022, and the address is No. 1, Beichen West Road, Haidian District, Beijing, and the preservation number is CGMCC No. 25392.

[0007] The application provides a method for producing a cyclodextrin glucosyltransferase by using the Klebsiella oxytoca, which comprises the following steps:

[0008] (1) activating the Klebsiella oxytoca and preparing a seed liquid by liquid culture;

[0009] (2) inoculating the seed liquid into a fermentation medium, and preparing a fermentation liquid containing the cyclodextrin glucosyltransferase by oscillation culture;

[0010] The cyclodextrin glucosyltransferase comprises an alpha-cyclodextrin glucosyltransferase, a beta-cyclodextrin glucosyltransferase and a gamma-cyclodextrin glucosyltransferase.

[0011] Preferably, in step (1), the liquid culture is carried out under the following conditions: the temperature is 37 DEG C, the rotation speed is 150 r / min, and the oscillation culture time is 24 h.

[0012] Preferably, in step (2), the optimal fermentation medium for producing the alpha-cyclodextrin glucosyltransferase or the beta-cyclodextrin glucosyltransferase comprises the following components: 10 g / L of sucrose, 5 g / L of ammonium sulfate, 5 g / L of yeast extract, 0.2 g / L of potassium phosphate dibasic, 0.2 g / L of magnesium sulfate heptahydrate and 0.2 g / L of sodium carbonate, and the pH is 7.

[0013] The fermentation culture conditions are as follows: the inoculation amount is 4%, the temperature is 35 DEG C, the rotation speed is 150 r / min, and the culture time is 72 h.

[0014] Preferably, in step (2), the optimal fermentation medium for producing the gamma-cyclodextrin glucosyltransferase comprises the following components: 10 g / L of potato starch, 5 g / L of urea, 5 g / L of yeast extract, 0.2 g / L of potassium phosphate dibasic, 0.2 g / L of magnesium sulfate heptahydrate and 0.2 g / L of sodium carbonate, and the pH is 8.

[0015] The fermentation culture conditions are as follows: the inoculation amount is 4%, the temperature is 35 DEG C, the rotation speed is 150 r / min, and the culture time is 72 h.

[0016] The application further provides a method for producing a starch hydrolytic enzyme by using the Klebsiella oxytoca, which comprises the following steps:

[0017] (1) activating the Klebsiella oxytoca and preparing seed liquid by liquid culture;

[0018] (2) inoculating the seed liquid into fermentation medium and preparing fermentation liquid containing the starch hydrolytic enzyme by oscillation culture.

[0019] Preferably, in step (1), the condition of the liquid culture is that the temperature is 37℃, the rotation speed is 150r / min, and the oscillation culture time is 24h.

[0020] In step (2), the optimal fermentation medium for producing the starch hydrolytic enzyme comprises the following components: lactose 10g / L, beef extract 5g / L, yeast extract 5g / L, potassium phosphate dibasic 0.2g / L, magnesium sulfate heptahydrate 0.2g / L, and sodium carbonate 0.2g / L, and the pH is 7.

[0021] The fermentation culture condition is that the inoculation amount is 4%, the temperature is 40℃, the rotation speed is 160r / min, and the culture time is 72h.

[0022] The application further provides a microbial agent comprising the Klebsiella oxytoca and / or metabolites thereof.

[0023] Preferably, the metabolites are the cyclodextrin glucosyltransferase obtained by the method for producing the cyclodextrin glucosyltransferase or the starch hydrolytic enzyme obtained by the method for producing the starch hydrolytic enzyme.

[0024] The application further provides application of the Klebsiella oxytoca or the microbial agent in catalyzing starch hydrolysis to produce alpha-cyclodextrin, beta-cyclodextrin and gamma-cyclodextrin.

[0025] The application discloses the following technical effects:

[0026] The Klebsiella oxytoca KCEB04 is screened from bitter orange. Experiments prove that the Klebsiella oxytoca KCEB04 not only has starch hydrolytic enzyme activity, but also has cyclodextrin glucosyltransferase activity, and can catalyze starch to produce alpha-CD, beta-CD and gamma-CD. The starch hydrolytic enzyme activity of the KCEB04 fermentation liquid obtained under the optimal fermentation condition is as high as 7959.18U / mL, the alpha-CGTase enzyme activity is 2.2U / mL, the beta-CGTase enzyme activity is 0.52U / mL, and the gamma-CGTase enzyme activity is 1.20U / mL.

[0027] The application utilizes the means of biological transformation, i.e. the endophytic bacteria of bitter orange, Klebsiella oxytoca KCEB04, to convert starch into cyclodextrin, compared with other traditional chemical production of cyclodextrin, the reaction efficiency is high, the byproduct is less, the step is simple, green, environmental protection and pollution-free, which provides a theoretical basis for the development and effective utilization of microbial resources, thereby laying a long-term development foundation for the conversion and application of cyclodextrin.

[0028] The application also optimizes the enzyme production conditions, which can not only improve the yield of alpha-CD, beta-CD and gamma-CD, provide technical support for industrial production of cyclodextrin, but also provide a basis for studying the glycosylation reaction of cyclodextrin glucosyltransferase, the cyclization reaction is the characteristic reaction of cyclodextrin glucosyltransferase, which is an intramolecular transglycosylation reaction, which can not only produce cyclodextrin, but also utilize the substrate glycosyl to biotransform flavonoids, such as rutin, hesperidin and naringin, change the physiological and biochemical characteristics of flavonoids, improve the stability and water solubility, and make the derivatives be applied in the fields of food, cosmetics, agriculture and medical treatment, and the like, and the research and application prospect is broad, and the optimization of enzyme production conditions can provide the enzyme production condition basis for the transglycosylation reaction of CGTase, and provide theoretical support for the future research and application of biotransformation of flavonoids. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below, and obviously, the drawings in the following description can only be some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0030] Figure 1 It is a KCEB04 strain effect picture on the screening plate, A is the colony morphology of the KCEB04 strain on the plate, B is the fading result of the KCEB04 strain crude enzyme liquid on the phenolphthalein-methyl orange screening plate, C is the fading result of the KCEB04 strain crude enzyme liquid on the starch-iodine screening plate;

[0031] Figure 2 It is the influence of carbon source types on the starch hydrolysis enzyme activity of the KCEB04 strain fermentation;

[0032] Figure 3 It is the influence of nitrogen source types on the starch hydrolysis enzyme activity of the KCEB04 strain fermentation;

[0033] Figure 4 It is the influence of fermentation temperature on the starch hydrolysis enzyme activity of the KCEB04 strain fermentation;

[0034] Figure 5 It is the influence of initial pH value on the starch hydrolysis enzyme activity of the KCEB04 strain fermentation;

[0035] Figure 6 Effect of liquid volume on the enzyme activity of KCEB04 strain in starch hydrolysis fermentation;

[0036] Figure 7 Effect of carbon source type on the enzyme activity of KCEB04 strain in α-CGTase fermentation;

[0037] Figure 8 Effect of nitrogen source type on the enzyme activity of KCEB04 strain in α-CGTase fermentation;

[0038] Figure 9 Effect of fermentation temperature on the enzyme activity of KCEB04 strain in α-CGTase fermentation;

[0039] Figure 10 Effect of initial pH value on the enzyme activity of KCEB04 strain in α-CGTase fermentation;

[0040] Figure 11 Effect of liquid volume on the enzyme activity of KCEB04 strain in α-CGTase fermentation;

[0041] Figure 12 Effect of carbon source type on the enzyme activity of KCEB04 strain in β-CGTase fermentation;

[0042] Figure 13 Effect of nitrogen source type on the enzyme activity of KCEB04 strain in β-CGTase fermentation;

[0043] Figure 14 Effect of fermentation temperature on the enzyme activity of KCEB04 strain in β-CGTase fermentation;

[0044] Figure 15 Effect of initial pH value on the enzyme activity of KCEB04 strain in β-CGTase fermentation;

[0045] Figure 16 Effect of liquid volume on the enzyme activity of KCEB04 strain in β-CGTase fermentation;

[0046] Figure 17 Effect of carbon source type on the enzyme activity of KCEB04 strain in γ-CGTase fermentation;

[0047] Figure 18 Effect of nitrogen source type on the enzyme activity of KCEB04 strain in γ-CGTase fermentation;

[0048] Figure 19 Effect of fermentation temperature on the enzyme activity of KCEB04 strain in γ-CGTase fermentation;

[0049] Figure 20Effect of initial pH on the activity of γ-CGTase produced by fermentation of strain KCEB04;

[0050] Figure 21 The effect of liquid volume on the activity of γ-CGTase produced by fermentation of strain KCEB04. Detailed Implementation

[0051] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0052] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0053] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0054] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0055] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0056] Example 1: Isolation and Identification of Klebsiella acidogenic bacteria KCEB04

[0057] Isolation of strain 1

[0058] 1.1 Collect healthy bitter orange fruits (collected in September 2021 from Suqiao Town, Yongfu County, Guangxi). Select 4-5 intact bitter orange fruits of the same size without virus damage. Wash the peel with clean water to remove foreign matter, wipe clean with filter paper, and sterilize the grinder with 75% ethanol (v / v), then rinse 2-3 times with sterile water to remove the ethanol. Place the bitter orange material on a sterile operating table and immerse the bitter oranges completely in 75% ethanol (v / v) for 1 minute. After soaking, rinse 3 times with sterile water. Take 0.5 mL of the sterile water used to clean the grinder and bitter oranges three times, spread it on LB agar plates, set up 3 parallel groups, let stand for 5 minutes, and incubate upside down in an incubator under the same conditions for 24 hours. Observe whether bacteria are present. If there are no bacteria, the sterilization is thorough; if bacteria are present, the sterilization is incomplete, and the material needs to be sterilized again.

[0059] 1.2 Place the disinfected and cleaned bitter oranges into a grinder and grind them. Add the bitter orange powder to the culture medium at a mass ratio of 1:10. The liquid culture medium consists of 5 g / L yeast powder, 10 g / L peptone and 10 g / L sodium chloride, with a pH of 7. Incubate at 37°C with shaking for 24 hours to allow natural fermentation and mold growth.

[0060] 1.3 Take 1 mL of the bacterial culture that has been cultured in a 37℃ shaking incubator for 24 hours, and dilute it with sterile water to a final concentration of 10. -2 -10 -5 Take 200 μL and dilute to 10. -2 -10 -5 The fractionally diluted solution was spread onto the selection medium, which consisted of: methyl orange 0.1 g / L, phenolphthalein 0.3 g / L, soluble starch 10 g / L, peptone 5 g / L, yeast extract 5 g / L, dipotassium hydrogen phosphate 0.2 g / L, magnesium sulfate heptahydrate 0.2 g / L, sodium carbonate 0.2 g / L, and agar powder 15 g / L. The medium was kept at natural pH and allowed to stand for 5 minutes. The culture was then inverted and incubated at 37°C for 24-48 hours. Colonies showing a yellow halo against a red background were picked and purified 2-3 times. Figure 1 As shown in Figure A, after obtaining pure cultures, they were numbered, and the strains were inoculated onto test tube slant culture medium, incubated at 37°C for 24 hours, and then stored at 4°C.

[0061] 1.4 Initial screening of strains producing cyclodextrin glucosyltransferase

[0062] The cyclodextrin glucosyltransferase screening medium was prepared, and the screening medium components were as follows: methyl orange 0.1 g / L, phenolphthalein 0.3 g / L, soluble starch 10 g / L, protein peptone 5 g / L, yeast extract 5 g / L, potassium phosphate dibasic 0.2 g / L, magnesium sulfate heptahydrate 0.2 g / L, sodium carbonate 0.2 g / L, and agar powder 15 g / L, natural pH. A puncher was used to punch (d = 1 cm), 200 μL of bacterial liquid cultured in a 37°C shaking incubator for 24 h was added dropwise into the hole, and a 40°C constant temperature water bath reaction was performed for 2 h. A yellow ring around the hole on a red background could be observed, as shown in FIG. 1B. The results showed that the strain produced cyclodextrin glucosyltransferase. Figure 1 The results showed that the strain produced cyclodextrin glucosyltransferase.

[0063] 1.5 Strain amylase primary screening

[0064] The amylase screening medium was prepared, and the screening medium components were as follows: soluble starch 10 g, agar 20 g, water to 1 L, natural pH, 121°C high temperature sterilization for 20 min, and 200 mL Goluobu iodine solution was added after cooling to 60°C. A puncher was used to punch (d = 1 cm), 200 μL of bacterial liquid cultured in a 37°C shaking incubator for 24 h was added dropwise into the hole, and a 40°C constant temperature water bath reaction was performed for 2 h. A colorless transparent ring around the hole on a blue background could be observed, as shown in FIG. 1C. The results showed that the strain produced amylase. Figure 1 The results showed that the strain produced amylase.

[0065] 2.2 Gene identification

[0066] 2.1 Physiological and biochemical reaction identification of strain KCEB04, and the results are shown in Table 1.

[0067] Table 1

[0068]

[0069] Note: "+" represents positive; "-" represents negative.

[0070] Combined with morphological identification and physiological and biochemical characteristics of the strain, and referring to the "Commonly Used Bacterial System Identification Manual", it was found that the isolated strain KCEBO4 was similar to Klebsiella oxytoca.

[0071] 2.2 Gene identification

[0072] The extraction of the DNA genome of the strain and the PCR amplification reaction were performed using the bacterial genome DNA extraction kit and the bacterial genome PCR amplification kit provided by Shengong Bioengineering (Shanghai) Co., Ltd. The specific extraction and amplification steps were performed according to the kit instructions. The PCR amplification primers were 1492R and 27F.

[0073] 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO. 1);

[0074] 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO. 2).

[0075] The amplification procedure is as follows: pre-denaturation at 95℃ for 5 min, 94℃ for 40 s; 55℃ for 40 s, 72℃ for 2 min, 40 cycles; extension at 72℃ for 10 min. After the PCR amplification reaction is completed, the PCR product is subjected to agarose gel electrophoresis by using 1% agarose gel, 0.5x TBE as the electrophoresis buffer and 80V voltage. After the PCR product is detected by agarose gel electrophoresis, it is sent to Shengong Bioengineering (Shanghai) Co., Ltd. for detection. The detection result (nucleotide sequence as shown in SEQ ID NO. 3) is registered on the NCBI website (http: / / blast.ncbi.nlm.nih.gov / ) of the United States for DNA Blast comparison, and the MEGA5.0 software is used to construct a phylogenetic tree to determine that the strain belongs to Klebsiella oxytoca.

[0076] The application provides a Klebsiella oxytoca, which was preserved in the China General Microbiological Culture Collection Center on July 25, 2022, has a preservation address of No. 3, Beichen West Road, Beijing City, China, and a preservation number of CGMCC No. 25392.

[0077] SEQ ID NO. 3 is as follows:

[0078]

[0079] Optimization of fermentation process of Klebsiella oxytoca KCEB04 starch hydrolytic enzyme

[0080] 1. Determination of starch hydrolytic enzyme activity of Klebsiella oxytoca KCEB04 strain fermentation broth

[0081] 1.1 The isolated and purified Klebsiella oxytoca KCEB04 endophytic bacteria of bitter orange was inoculated on LB culture plate and activated at 37°C for 12 h, and then the strain was picked into seed liquid and cultured in a 37°C incubator with 160 r / min shaking speed for 24 h. Then 4% of the seed liquid was inoculated into a 250 mL conical flask containing 50 mL of liquid culture medium, and the fermentation was continued under the same conditions for 72 h. The fermentation broth was centrifuged at 5000 r / min for 10 min, and the supernatant was collected as the crude enzyme solution and stored in a refrigerator at 4°C for subsequent experiments.

[0082] 1.2 10 μL of the crude enzyme solution was taken, 0.2 mL of glycine-NaOH buffer solution with a concentration of 0.2 mol / L (pH = 9.0) was added, and then 0.2 mL of 0.2% soluble starch solution was added. After shaking well, the mixture was heated in a constant temperature water bath at 40°C for 10 min. Then 0.5 mL of 0.5 mol / L acetic acid was immediately added to terminate the reaction, and then 3 mL of 0.005% iodine solution was added for color development. At the same time, the enzyme solution was not added as a control, and distilled water was used as a blank. The absorbance was measured at 700 nm wavelength. The enzyme amount that caused a 10% decrease in absorbance was defined as one enzyme unit.

[0083] 2. Study on culture conditions of Klebsiella oxytoca KCEB04 strain

[0084] On the basis of the basic fermentation medium (10 g / L soluble starch, 5 g / L peptone, 5 g / L yeast extract, 0.2 g / L potassium phosphate, 0.2 g / L magnesium sulfate heptahydrate, and 0.2 g / L sodium carbonate, natural pH value), the effects of carbon source type (10 g / L of soluble starch, sucrose, potato starch, glucose, or lactose), nitrogen source type (5 g / L of ammonium sulfate, tryptone, beef extract powder, ammonium citrate, or urea), temperature (25, 30, 35, 40, or 45°C), pH (6, 6.5, 7, 7.5, 8, or 9), and liquid volume (50, 70, 90, 110, or 130 mL / 250 mL) on the starch hydrolytic enzyme activity of KCEB04 strain fermentation broth were investigated by single factor test.

[0085] As Figures 2-6As shown in the results, the optimal culture conditions for the fermentation broth of Klebsiella oxytoca KCEB04 strain to produce starch hydrolyzing enzyme were as follows: the carbon source was lactose, the nitrogen source was beef extract, the temperature was 40℃, the pH was 7, the liquid loading was 70 / 250 mL, the enzyme activity was 7959.18 U / mL, which was 1.3 times higher than that under the basic culture conditions.

[0086] The present embodiment uses single factor test to investigate the effects of different fermentation medium compositions on the production of starch hydrolyzing enzyme, and finally obtains the optimal fermentation process of Klebsiella oxytoca KCEB04 to produce starch hydrolyzing enzyme.

[0087] Example 3 Optimization of the Fermentation Process of Klebsiella oxytoca KCEB04 to Produce α-CGTase

[0088] 1 Determination of α-CGTase Enzyme Activity in the Fermentation Broth of Klebsiella oxytoca KCEB04 Strain

[0089] 1.1 The isolated and purified Klebsiella oxytoca KCEB04 endophytic bacteria were inoculated on LB culture plates and activated at 37℃ for 12 h, and then the strain was picked into a seed solution and cultured in a 37℃ incubator with a shaking speed of 160 r / min for 24 h. Then, 4% of the strain was inoculated into a 250 mL conical flask containing 50 mL of liquid culture medium, and the fermentation was continued under the same conditions for 72 h. The fermentation broth was centrifuged at a speed of 5000 r / min for 10 min, and the supernatant was collected as the crude enzyme solution and stored in a refrigerator at 4℃ for subsequent experiments.

[0090] 1.2 0.1 mL of the crude enzyme solution was added to a test tube containing 0.9 mL of 1% (w / v) soluble starch solution prepared in advance using 50 mmol / L phosphate buffer (pH = 6), and the reaction was carried out in a 50℃ constant temperature water bath for 10 min. Then, 1.0 mL of 10 mol / L hydrochloric acid and 1.0 mL of 0.1 mmol / L methyl orange solution prepared using 50 mmol / L phosphate buffer were added, and the mixture was incubated at room temperature for 15 min. The absorbance was measured at 505 nm, and the α-CD content was calculated according to the standard curve. The amount of enzyme required to produce 1 μmol of cyclodextrin per minute was taken as one enzyme activity unit.

[0091] 2 Study on the Culture Conditions of Klebsiella oxytoca KCEB04 Strain

[0092] On the basis of the basic fermentation medium (10 g / L soluble starch, 5 g / L peptone, yeast extract 5 g / L, potassium phosphate dibasic 0.2 g / L, magnesium sulfate heptahydrate 0.2 g / L and sodium carbonate 0.2 g / L, natural pH value), the effects of carbon source type (10 g / L of soluble starch, sucrose, potato starch, glucose or lactose), nitrogen source type (5 g / L of ammonium sulfate, tryptone, beef extract powder, ammonium citrate or urea), temperature (25, 30, 35, 40 or 45 °C), pH (6, 6.5, 7, 7.5, 8 or 9), liquid volume (50, 70, 90, 110 or 130 mL / 250 mL) and other factors on the α-CGTase enzyme activity of KCEB04 strain fermentation broth were investigated by single factor test.

[0093] As shown in Figures 7-11 , the results show that the optimal culture conditions for the α-CGTase enzyme activity of Klebsiella oxytoca KCEB04 strain fermentation broth are: carbon source is sucrose, nitrogen source is ammonium sulfate, temperature is 35 °C, pH = 7, liquid volume (70 / 250 mL). Under the optimal enzyme production conditions, the enzyme activity is 2.2 U / mL, which is 1.1 times higher than that under the basic culture conditions.

[0094] This embodiment uses single factor test to investigate the effects of different fermentation medium compositions on the production of α-CGTase, and finally obtains the optimal fermentation process of Klebsiella oxytoca KCEB04 producing α-CGTase.

[0095] Example 4 Optimization of Klebsiella oxytoca KCEB04 β-CGTase Fermentation Process

[0096] 1 Determination of β-CGTase enzyme activity of Klebsiella oxytoca KCEB04 strain fermentation broth

[0097] 1.1 The isolated and purified Klebsiella oxytoca KCEB04 endophytic bacteria were inoculated on LB culture plates and activated at 37 °C for 12 h, and then the strain was picked into seed liquid and cultured in a 37 °C incubator with a shaking speed of 160 r / min for 24 h. Then 4% of the strain was inoculated into a 250 mL conical flask containing 50 mL of liquid medium, and the fermentation was continued under the same conditions for 72 h. The fermentation broth was centrifuged at a speed of 5000 r / min for 10 min, and the supernatant was taken as the crude enzyme solution and stored in a refrigerator at 4 °C for subsequent experiments.

[0098] 1.2 Take 0.1 mL of crude enzyme solution and add it to a test tube containing 0.9 mL of 1% (w / v) soluble starch solution prepared in advance with 50 mmol / L phosphate buffer (pH=6). React in a constant temperature water bath at 50℃ for 10 min. Add 3.5 mL of 30 mmol / L NaOH and 0.5 mL of 0.02% (w / v) phenolphthalein prepared with 5 mmol / L Na2CO3 solution. Incubate at room temperature for 15 min and measure the absorbance at 550 nm. Calculate the β-CD content according to the standard curve. The amount of enzyme required to produce 1 μmol of cyclodextrin per minute is defined as one enzyme activity unit.

[0099] 2. Study on culture conditions of Klebsiella acidogenic strain KCEB04

[0100] Based on the basic fermentation medium (10 g / L soluble starch, 5 g / L peptone, 5 g / L yeast extract, 0.2 g / L dipotassium hydrogen phosphate, 0.2 g / L magnesium sulfate heptahydrate, and 0.2 g / L sodium carbonate, natural pH), single-factor experiments were conducted to investigate the effects of carbon source type (10 g / L soluble starch, sucrose, potato starch, glucose, or lactose), nitrogen source type (5 g / L ammonium sulfate, trypone, beef extract, ammonium citrate, or urea), temperature (25, 30, 35, 40, or 45℃), pH (6, 6.5, 7, 7.5, 8, or 9), and liquid volume (50, 70, 90, 110, or 130 mL / 250 mL) on the β-CGTase enzyme activity of the fermentation broth of strain KCEB04.

[0101] like Figures 12-16 As shown, the results indicate that the optimal culture conditions for β-CGTase activity in the fermentation broth of Klebsiella acidogenic strain KCEB04 are: sucrose as the carbon source, ammonium sulfate as the nitrogen source, temperature 35℃, pH = 7, and liquid volume (70 / 250mL). The enzyme activity is 0.52U / mL, which is 1.2 times higher than the basal culture conditions.

[0102] Example 5: Optimization of the fermentation process for γ-CGTase production by Klebsiella acidogenic bacteria KCEB04

[0103] 1. Determination of γ-CGTase enzyme activity in fermentation broth of Klebsiella acidogenic strain KCEB04

[0104] 1.1 The isolated and purified endophytic bacteria of bitter orange, Klebsiella acid-producing bacteria KCEB04, was inoculated onto LB agar plates and activated at 37°C for 12 h. The strain was picked and cultured in seed culture at 37°C with shaking at 160 r / min for 24 h. Then, 4% of the culture was inoculated into a 250 mL Erlenmeyer flask containing 50 mL of liquid culture medium and cultured for another 72 h under the same conditions. The fermentation broth was centrifuged at 5000 r / min for 10 min, and the supernatant was collected as crude enzyme solution. It was stored in a refrigerator at 4°C, and the filtrate was collected for subsequent experiments.

[0105] 1.2 Take 0.1 mL of crude enzyme solution and add it to a test tube containing 0.9 mL of 1% (w / v) soluble starch solution prepared in advance with 50 mmol / L phosphate buffer (pH=6). Incubate at 50 °C for 10 min. Add 50 μL of 1.0 mol / L hydrochloric acid to stop the reaction. Then add 2 mL of 0.2 mol / L citrate buffer (pH=4.2) and 100 μL of 5 mmol / L bromocresol green solution. Incubate at room temperature for 15 min. Measure the absorbance at 615 nm. Calculate the γ-CD content according to the cyclodextrin standard curve. The amount of enzyme required to produce 1 μmol of cyclodextrin per minute is defined as one enzyme activity unit.

[0106] 2. Study on culture conditions of Klebsiella acidogenic strain KCEB04

[0107] Based on the basic fermentation medium (10 g / L soluble starch, 5 g / L peptone, 5 g / L yeast extract, 0.2 g / L dipotassium hydrogen phosphate, 0.2 g / L magnesium sulfate heptahydrate, and 0.2 g / L sodium carbonate, natural pH), single-factor experiments were conducted to investigate the effects of carbon source type (10 g / L soluble starch, sucrose, potato starch, glucose, or lactose), nitrogen source type (5 g / L ammonium sulfate, trypone, beef extract, ammonium citrate, or urea), temperature (25, 30, 35, 40, or 45℃), pH (6, 6.5, 7, 7.5, 8, or 9), and liquid volume (50, 70, 90, 110, or 130 mL / 250 mL) on the γ-CGTase enzyme activity of the fermentation broth of strain KCEB04.

[0108] like Figures 17-21 As shown, the results indicate that the optimal culture conditions for γ-CGTase enzyme activity in the fermentation broth of Klebsiella acidogenic strain KCEB04 are: potato starch as carbon source, urea as nitrogen source, temperature 35℃, pH=8, and liquid volume (110 / 250mL). The enzyme activity is 1.20U / mL, which is 1.3 times higher than the basal culture conditions.

[0109] The present embodiment uses single factor test to investigate the influence of different fermentation medium composition on the production of γ-CGTase, and finally obtains the optimal fermentation process of Klebsiella oxytoca KCEB04 producing γ-CGTase.

[0110] The above-described embodiments are only to describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements of the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. A method for producing a cyclodextrin glucosyltransferase using Klebsiella oxytoca, characterized by, The method comprises the following steps: (1) activating the Klebsiella oxytoca and preparing seed liquid by liquid culture; (2) inoculating the seed liquid into a fermentation medium and preparing a fermentation liquid containing the cyclodextrin glucosyltransferase by oscillation culture; The cyclodextrin glucosyltransferase is an alpha-cyclodextrin glucosyltransferase, a beta-cyclodextrin glucosyltransferase or a gamma-cyclodextrin glucosyltransferase; The Klebsiella oxytoca has a preservation number of CGMCC No. 25392. In step (1), the liquid culture is carried out at a temperature of 37℃ and a rotation speed of 150 r / min for 24 h. In step (2), the fermentation medium for producing the alpha-cyclodextrin glucosyltransferase or the beta-cyclodextrin glucosyltransferase comprises the following components: 10 g / L of sucrose, 5 g / L of ammonium sulfate, 5 g / L of yeast extract, 0.2 g / L of potassium phosphate dibasic, 0.2 g / L of magnesium sulfate heptahydrate and 0.2 g / L of sodium carbonate, and has a pH of 7. The fermentation culture conditions are as follows: the inoculation amount is 4%, the temperature is 35℃, the rotation speed is 150 r / min, and the culture time is 72 h. In step (2), the fermentation medium for producing the gamma-cyclodextrin glucosyltransferase comprises the following components: 10 g / L of potato starch, 5 g / L of urea, 5 g / L of yeast extract, 0.2 g / L of potassium phosphate dibasic, 0.2 g / L of magnesium sulfate heptahydrate and 0.2 g / L of sodium carbonate, and has a pH of 8. The fermentation culture conditions are as follows: the inoculation amount is 4%, the temperature is 35℃, the rotation speed is 150 r / min, and the culture time is 72 h.

2. A method for producing a starch-hydrolyzing enzyme using Klebsiella oxytoca, characterized by, The method comprises the following steps: (1) activating the Klebsiella oxytoca and preparing seed liquid by liquid culture; (2) inoculating the seed liquid into a fermentation medium and preparing a fermentation liquid containing the cyclodextrin glucosyltransferase by oscillation culture; In step (1), the liquid culture is carried out at a temperature of 37℃ and a rotation speed of 150 r / min for 24 h. In step (2), the fermentation medium for producing the alpha-cyclodextrin glucosyltransferase or the beta-cyclodextrin glucosyltransferase comprises the following components: 10 g / L of sucrose, 5 g / L of ammonium sulfate, 5 g / L of yeast extract, 0.2 g / L of potassium phosphate dibasic, 0.2 g / L of magnesium sulfate heptahydrate and 0.2 g / L of sodium carbonate, and has a pH of 7. The fermentation culture conditions are as follows: the inoculation amount is 4%, the temperature is 35℃, the rotation speed is 150 r / min, and the culture time is 72 h. The Klebsiella oxytoca has a preservation number of CGMCC No. 25392.

3. Use of a Klebsiella oxytoca in the catalytic hydrolysis of starch to produce a-, β- and γ-cyclodextrin, characterized in that, The Klebsiella oxytoca has a preservation number of CGMCC No. 25392.

Images