Kit and method for identifying porcine, chicken, and duck-derived components in meat or meat products based on crisper technology
By combining CRISPR-Cas12a technology with LAMP amplification and fluorescence detection, the problem of rapid on-site detection of meat adulteration has been solved, achieving high sensitivity and specificity in the detection of pork, chicken and duck-derived components and simplifying the detection process.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-16
- Publication Date
- 2026-03-31
AI Technical Summary
Existing methods for detecting adulterated meat require complex sample preparation steps and sophisticated instruments, making it difficult to achieve rapid on-site detection, and they lack high sensitivity and specificity.
Using a kit and method based on CRISPR-Cas12a technology, combined with LAMP amplification and fluorescence-quenched labeled single-stranded DNA reporter molecules, we detected pork, chicken and duck-derived components in meat or meat products through enzymatic digestion reactions, and utilized the single-base recognition specificity of the CRISPR-Cas12a system for visual detection.
It achieves highly sensitive and specific detection of components derived from pigs, chickens, and ducks, simplifies the detection process, reduces nucleic acid contamination, and is suitable for rapid on-site detection.
Smart Images

Figure CN116024350B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection technology, specifically relating to a kit and method for on-site visual detection of pork, chicken and duck-derived components in meat or meat products based on isothermal amplification combined with the CRISPR-Cas12a system. Background Technology
[0002] Meat adulteration occurs globally in various forms, affecting almost all meat and meat products. Adulteration is not only a significant economic problem but can also pose serious health risks to consumers. Therefore, food certification, particularly the identification of animal-derived components in imported minced meat, canned meat, and other meat products, is crucial for controlling food quality and safety and protecting consumer rights. As meat adulteration methods become increasingly sophisticated, highly effective and reliable technologies are needed to detect this fraudulent activity. In recent years, with the deepening research into the CRISPR / Cas system, detection technologies based on the CRISPR / Cas system have developed rapidly. Due to its single-base recognition specificity and low equipment requirements, it is becoming an irreplaceable technology in the field of nucleic acid detection.
[0003] In fact, methods for detecting meat adulteration have been developed over many years and are quite mature. Commonly used methods include microscopic identification, high-performance liquid chromatography, enzyme-linked immunosorbent assay (ELISA), and molecular biological detection of DNA. However, these methods all require complex sample preparation steps and sophisticated instruments before analysis, making the entire detection process difficult to conduct on-site and time-consuming. Therefore, based on the need for on-site nucleic acid testing, this invention develops a method based on LAMP combined with CRISPR / Cas12a to identify whether meat or meat products contain pork, chicken, and duck-derived components, which is very suitable for rapid on-site detection. Summary of the Invention
[0004] The purpose of this invention is to provide a reagent kit and method that can rapidly, sensitively, specifically, and conveniently detect pork, chicken, or duck-derived components in meat or meat products on-site.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] A kit for detecting porcine, chicken, and duck-derived components in meat or meat products based on CRISPR-Cas12a technology includes a LAMP primer set, Cas12a protein, crRNA, and a fluorescently quenched single-stranded DNA reporter molecule. The primer sequences for amplifying the porcine NADH4 gene in the LAMP primer set are shown in SEQ NO. 1-6, the primer sequences for the chicken ND2 gene are shown in SEQ ID NO. 7-12, the primer sequences for the duck D-loop gene are shown in SEQ ID NO. 13-18, and the crRNA sequences targeting the porcine NADH4 gene, chicken ND2 gene, and duck D-loop gene are shown in SEQ ID NO. 19-21.
[0007] Furthermore, the single-stranded DNA reporter molecule is fluorescently labeled with Texas Red.
[0008] Furthermore, the kit also includes an amplification reaction solution and an enzyme digestion buffer.
[0009] A method for visually detecting pork, chicken, and duck-derived components in meat or meat products based on the CRISPR-Cas12a system includes the following steps: amplifying the target component using a LAMP primer combination; mixing the amplified product with Cas12a protein, a fluorescently quenched single-stranded DNA reporter molecule, and crRNA, followed by an enzyme digestion reaction (preferably 15 min); and detecting the pork, chicken, and duck-derived components based on the color change or fluorescence change of the reporter molecule. The sequences of the LAMP primer combination are shown in SEQ ID NO.1-18, and the crRNA sequences are shown in SEQ ID NO.19-21.
[0010] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0011] 1. This invention provides for the first time a kit for detecting pig, chicken and duck-derived components in meat or meat products based on CRISPR-Cas12a technology, which can be used for highly sensitive detection of species-specific genes in pigs, chickens and ducks.
[0012] 2. This invention uses LAMP combined with CRISPR-Cas12a technology to detect pork, chicken and duck-derived components in meat or meat products. The detection method is more sensitive than PCR detection and more specific than LAMP detection, and makes the detection more intuitive and convenient, reducing nucleic acid contamination. Attached Figure Description
[0013] Figure 1 The study demonstrated the screening of highly active crRNAs targeting the porcine NADH4 gene.
[0014] Figure 2 The study showed that highly active crRNAs targeting the chicken ND2 gene were selected.
[0015] Figure 3 The study demonstrated the ability to screen for highly active crRNAs targeting the duck D-loop gene.
[0016] Figure 4 The comparison of LAMP reaction primer amplification efficiencies targeting the porcine NADH4 (A), chicken DN2 (B), and duck D-loop (C) genes is shown. Lanes 1 and 3 are experimental groups, and lanes 2 and 4 are non-template negative controls.
[0017] Figure 5 The conservation analysis of partial NADH4 gene sequences in different pig breeds is shown.
[0018] Figure 6 The conservation analysis of partial sequences of the ND2 gene in different chicken breeds was shown.
[0019] Figure 7 The conservation analysis of partial D-loop gene sequences among different duck breeds is shown.
[0020] Figure 8 The study demonstrated the sensitivity of detecting pork based on LAMP combined with CRISPR / Cas12a technology.
[0021] Figure 9 The study demonstrated the sensitivity of detecting chicken meat based on LAMP combined with CRISPR / Cas12a technology.
[0022] Figure 10 The study demonstrated the sensitivity of detecting duck meat based on LAMP combined with CRISPR / Cas12a technology.
[0023] Figure 11 The fluorescence intensity and background signal of the JOE-modified probe and the Texas Red-modified probe are shown.
[0024] Figure 12 The agarose gel electrophoresis image of species-specific PCR is shown.
[0025] Figure 13 The study demonstrated the specificity of LAMP combined with CRISPR / Cas12a technology for naked-eye detection of pork, chicken, and duck.
[0026] Figure 14 The results show the specific enzyme-linked immunosorbent assay (ELISA) signals for the naked-eye detection of pork, chicken, and duck meat using LAMP combined with CRISPR / Cas12a technology.
[0027] Figure 15 The chart displays the proportions of animal-derived components in the simulated mixed samples. The numbers marked on the bars represent the percentage of pork, chicken, and duck meat by weight in the simulated mixed meat products.
[0028] Figure 16 The images show the naked-eye identification of animal-derived components in simulated mixed meat products using LAMP primers and crRNA targeting mitochondrial genes in pigs, chickens, and ducks, respectively. Detailed Implementation
[0029] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.
[0030] Example 1: Screening for highly active crRNAs based on CRISPR-Cas12a technology for detecting porcine, chicken, and duck-derived components in meat or meat products.
[0031] To ensure the accuracy and sensitivity of nucleic acid detection of pork, chicken, and duck-derived components in meat or meat products, we need to screen for highly active crRNAs. PCR amplification primers were designed for the conserved NADH4, DN2, and D-Loop mitochondrial genes in pigs (AF486867), chickens (NC_040970), and ducks (NC_009684) (Table 1). Five crRNAs were designed using CRISPR-offinder software (https: / / sourceforge.net / projects / crispr-offinder-v1-2 / ), with TTTN as the PAM. In vitro transcription primer pairs were designed using the T7 promoter and crRNA scaffold vector as templates (Table 1). The experimental steps for detecting nucleic acid molecules using the CRISPR-Cas12a system are as follows:
[0032] (1) PCR amplification of target gene fragments: Prepare 50 μL of PCR reaction solution, including 25 μL of Ex Taq Mix, 10 pmol of each of different primer sets such as NADH4-1-F and NADH4-1-R, and 1 μL (approximately 100 ng) of pork, chicken, or duck genomic template. The PCR reaction program is set as follows: 94℃ for 30 s, 58℃ for 30 s, 72℃ for 20 s, for a total of 30 cycles, with a final extension at 72℃ for 5 min.
[0033] Table 1. Primer pairs for PCR and crRNA in vitro transcription template amplification
[0034]
[0035]
[0036] (2) In vitro transcription of crRNA: Using a plasmid containing a T7 promoter and crRNA scaffold (pUC57-T7-crRNA) as a template, the template for in vitro transcription of crRNA was amplified using PCR with T7-crRNA-F and different crRNA-R primers (Table 1). The experimental reaction volume was 50 μL, including 25 μL of Extaq Mix, 10 pmol each of forward and reverse primers, and 1 μL (approximately 10 ng) of the crRNA empty vector (pUC57-T7-crRNA) template. The reaction conditions were: 94℃ for 30 s, 55℃ for 30 s, and 72℃ for 5 s, for a total of 30 cycles, with a final extension at 72℃ for 5 min. The PCR products were recovered using an agarose gel DNA recovery kit (Tianmo). The reaction was performed according to HiScribe... TM crRNAs were synthesized using the Quick T7 High Yield RNA Synthesis Kit (NEB) under the following conditions: 37°C for approximately 16 hours. The transcribed crRNAs were purified using the phenol-chloroform method, and after concentration determination, aliquots were stored at -80°C for long-term preservation.
[0037] Partial sequence of pUC57-T7-crRNA vector:
[0038] T7 boot sequence: CGAGGGGACGGTGATTGGAGATCGGTACTTCGCGAATGCGTCGAGATGGATCCCTAATACG
[0039] crRNA scaffold (19nt): ACTCACTATAGGGAATTTCTACTGTTGTAGATAATCGCATTGCCTCCGTAGTGAATTTTTTAAAGGGCCCGTCGACTGCAGAGGCCTGCATGCAAGCTTATCGGATGCCGGGACCGACGAGTGCAGAGGCGTGCAAGCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAA
[0040] (3) Cas12a digestion reaction: In a 20 μL reaction system, add the purified crRNA (0.5 μM) from step 2, Cas12a (0.25 μM), 3 μL of the PCR amplification and purification product from step 1, ssDNA-reporter (JOE-N12-BHQ1, 2.5 μM) (Table 1), and NEB buffer 2.1. The negative control is set without the target gene template, i.e., without the gene amplification product corresponding to step (1). The positive control was set up with only ssDNA activator primers, with primers complementary to the corresponding crRNA, such as Pig-crRNA-1R, Pig-crRNA-2R, Pig-crRNA-3R, Pig-crRNA-4R, Pig-crRNA-5R, Chicken-crRNA-1R, Chicken-crRNA-2R, Chicken-crRNA-3R, Chicken-crRNA-4R, Chicken-crRNA-5R, Duck-crRNA-1R, Duck-crRNA-2R, Duck-crRNA-3R, Duck-crRNA-4R, and Duck-crRNA-5R, used as ssDNA activators to replace the target gene. The reaction was carried out at 37°C for 15 min, followed by incubation at 98°C for 2 min to terminate the reaction.
[0041] (4) Result detection and judgment: Centrifuge tubes containing the reaction solution were placed directly in a blue light gel cutter or a UV gel imaging system to detect changes in fluorescence intensity. Highly active crRNAs suitable for CRISPR-Cas12a nucleic acid detection experiments were screened.
[0042] Result: From Figure 1-3 As can be seen, the comparison revealed that the fluorescence signals of the five crRNAs targeting pig mitochondrial genes were all strong, indicating high activity. Pig-crRNA-5, which targets the NADH4 gene, was randomly selected as the highly active target for identifying pork. Figure 1 Next, the activity of crRNAs targeting chicken mitochondrial genes was evaluated. The results showed that the activity of crRNAs targeting different chicken genes varied, with the activity levels in the following order: Ch-crRNA-1, Ch-crRNA-3, Ch-crRNA-5, Ch-crRNA-4, and Ch-crRNA-2. Figure 2 Therefore, Ch-crRNA-1, targeting the ND2 gene, was selected as a highly active target for identifying chicken meat. Finally, the activity of crRNAs targeting the duck D-loop gene was evaluated; except for Du-crRNA-4, the other four crRNAs showed relatively high activity. Figure 3Therefore, Duck-crRNA-1, which has the highest activity, was selected as the highly active site for identifying duck meat. Thus, highly active crRNAs targeting the porcine NADH4 gene, chicken ND2 gene, and duck D-loop gene were screened, namely Pig-crRNA-5 (5'-gcaguacggcugcaaguacuauug-3'), Ch-crRNA-1 (5'-ggaugaauaauuauaauucucc-3'), and Duck-crRNA-1 (5'-cgccucugguuccucggucagggc-3').
[0043] Example 2: Screening primer sets with high LAMP amplification efficiency targeting porcine NADH4, chicken DN2, and duck D-loop genes.
[0044] To achieve highly sensitive on-site detection of pork, chicken, and duck meat, two different sets of LAMP reaction primers were designed near the crRNA site. The amplification efficiency of the primers was analyzed by gel electrophoresis, and the LAMP reaction primer with the highest efficiency was obtained. The experimental procedure is as follows:
[0045] (1) Based on the mitochondrial genes of pig NADH4, chicken DN2 and duck D-loop, specific LAMP amplification primer sets containing Pig-crRNA-5, Ch-crRNA-1 and Duck-crRNA-1 were designed using PrimerExplorer V5 software (http: / / primerexplorer.jp / lampv5e / ) (Table 2).
[0046] (2) LAMP amplification of the target fragment: Using pork, chicken, or duck genomic DNA as templates (approximately 10 ng), LAMP amplification was performed using the primer pairs listed in Table 2. The specific steps were as follows: 1 μL Bst 3.0 DNA Polymerase (NEB), 2.5 μL 10× Isothermal Amplification Buffer, 6 mM MgSO4, 14 mM dNTP Mix, and 2.5 μL primer mixture (10× primer: 1.6 μM FIP / BIP; 0.2 μM F3 / B3, 0.4 μM LF / LB). The reaction program was 65℃ for 35 min. 3 μL of the LAMP reaction product was then electrophoresed on a 1.5% agarose gel for identification.
[0047] Table 2. LAMP amplification primer pairs
[0048]
[0049]
[0050] (3) Result detection: The amplification efficiency of the primers was analyzed by the step-like shape and depth of the gel electrophoresis bands to obtain the LAMP reaction primers with the highest efficiency.
[0051] Result: From Figure 4 As can be seen from the electrophoresis results, the LAMP primers in the experimental group all amplified bands, while the negative control did not show any amplification bands. Figure 4 A, 4B, and 4C). Further analysis reveals that LAMP-pig-1 ( Figure 4 A) and LAMP-ch-2 ( Figure 4 B) No obvious amplification bands were observed, while LAMP-pig-2(4A) and LAMP-ch-1(4B) amplified clear ladder-like bands. Therefore, these two primer sets were selected as the LAMP reaction primer sets for amplifying the porcine NADH4 gene and the chicken ND2 gene. Figure 4 As shown in Figure C, LAMP-du-1 exhibits a brighter ladder-like pattern and higher efficiency; therefore, LAMP-du-1 was selected as the LAMP reaction primer set for amplifying the duck D-loop gene. Ultimately, three LAMP reaction primer sets targeting porcine NADH4, chicken DN2, and duck D-loop were screened, demonstrating high amplification efficiency.
[0052] Example 3: Intraspecific conservation analysis of LAMP primers and crRNA sequences of selected pork, chicken, and duck meat.
[0053] To verify the conservation of LAMP reaction primers and crRNA within species, mitochondrial genes from different breeds of pigs, chickens, and ducks were obtained using the NCBI database. The pig breeds were: Chinese Wuzhishan, Chinese Meishan, Chinese Jinhua, Berkshire, Bamei, Tibetan pig, Rongchang, Hampshire, pietrain, and Landrace; the chicken breeds were: Niya, Longsheng, Luhua, Qingyuan, Wanbei game, Huangshanblack, Wuhua three-yellow, Zhengyang Yellow, Red jungle fowl, Tibetan chicken, and Gushi; and the duck breeds were: LinWu, Mallard, Jinding, Longsheng, Xilin, Sichuan, Pekin, Rongshui, Shaoxing, and Jianchang. The genes were then compared using the Clustal Omega online software.
[0054] Results: In identifying pork-specific sequences, the SNP sites on the LF, F1c, and B3 primer sequences of the LAMP reaction were all located in the middle of the primer sequences. Figure 5 Since the site primarily affecting LAMP amplification efficiency is located at the 3' end of the primer, the detection efficiency of LAMP primers used to identify pork does not decrease. The only SNP site on the chicken-specific sequence is not located on the LAMP primer or crRNA sequence. Figure 6 SNP sites do not affect amplification and recognition efficiency. No SNP sites were found in the specific sequences for identifying duck meat. Figure 7 In summary, the LAMP reaction primers and crRNAs designed for the porcine NADH4 gene, chicken DN2 gene, and duck D-loop gene in this invention exhibit high intraspecific conservation.
[0055] Example 4 evaluates the sensitivity of CRISPR / Cas12a technology-enhanced fluorescence visualization for detecting pork, chicken, and duck meat.
[0056] To evaluate the sensitivity of CRISPR / Cas12a technology for enhanced fluorescence visualization in detecting pork, chicken, and duck meat, LAMP amplification was performed using 10-fold diluted genomic DNA from pigs, chickens, and ducks as templates. Then, using the LAMP product as a template and JOE-modified single-stranded DNA (JOE-N12-BHQ1) as an ssDNA reporter, Cas12a restriction enzyme digestion was performed. Finally, the results were detected using a blue light spectrometer and a UV gel imaging system. Simultaneously, to enable multi-platform detection, data were collected using a quantitative real-time PCR instrument and a microplate reader. The experimental procedure is as follows:
[0057] (1) LAMP amplification of the target gene fragment: Genomic DNA from pigs, chickens, and ducks was serially diluted 10-fold to 1 ng / μL, 0.1 ng / μL, 10 pg / μL, 1 pg / μL, 0.1 pg / μL, and 10 fg / μL, respectively. Using genomic DNA at different dilutions as templates (2 μL), LAMP amplification was performed using the primer pairs listed in Table 2. The specific steps were as follows: 1 μL Bst 3.0 DNA Polymerase (NEB), 2.5 μL 10× Isothermal Amplification Buffer, 6 mM MgSO4, 14 mM dNTP Mix, and 2.5 μL primer mixture (10× primer: 1.6 μM FIP / BIP; 0.2 μM F3 / B3, 0.4 μM LF / LB). The reaction procedure was as follows: 65℃, 35 min; 3 μL of the above LAMP reaction product was then subjected to electrophoresis on a 1.5% agarose gel for identification.
[0058] (2) In vitro transcription of crRNA: Using a plasmid containing a T7 promoter and crRNA scaffold (pUC57-T7-crRNA) as a template, the template for in vitro transcription was amplified using PCR with primers T7-crRNA-F, Pig-crRNA-5R, Ch-crRNA-1R, and Duck-crRNA-1R (Table 1). The specific steps were as follows: The reaction system was 50 μL, containing 25 μL of Extaq Mix, 10 pmol each of forward and reverse primers, and 1 μL (approximately 10 ng) of crRNA empty vector as template. The reaction program was: 94℃ for 30 s, 55℃ for 30 s, and 72℃ for 5 s, for a total of 30 cycles, with a final extension at 72℃ for 5 min. The PCR product was then electrophoresed on a 3% agarose gel, and the target band was recovered using a stenolol recovery kit. HiScribe was used to extract the PCR product. TM crRNA was synthesized using the Quick T7 High Yield RNA Synthesis Kit (NEB) at 37°C for approximately 16 hours. The transcribed crRNAs (5'-gcaguacggcugcaaguacuauug-3'; 5'-ggaugaauaauuauauaauucucc-3'; 5'-cgccucugguuccucggucagggc-3') were purified using the phenol-chloroform method and aliquoted for cryopreservation at -80°C.
[0059] (3) Cas12a reaction: In a 20 μL reaction system, add 3 μL of LAMP products (using different concentrations of genome as templates from step 1), 0.5 μM of purified crRNA from step (2), Cas12a (0.25 μM), ssDNA-reporter JOE-N12-BHQ1 (2.5 μM), and NEB buffer 2.1. Incubate at 37 °C for 15 min, then terminate the reaction at 98 °C for 2 min. The sensitivity of CRISPR-Cas12a nucleic acid visualization detection for pork, chicken, and duck meat is evaluated by detecting the fluorescence of the Cas12a reaction products under blue light or ultraviolet gel scanning.
[0060] (4) Quantitative PCR fluorescence value collection: After the reaction system in step (3) is prepared, it is immediately placed in a quantitative PCR instrument to detect the fluorescence value. The quantitative PCR program is set to 37℃, 99 cycles. The fluorescence signal is collected every 90 seconds (i.e., one cycle).
[0061] (5) Detection of fluorescence signal by microplate reader: Take 80 μL of DEPC water to dilute the solution after Cas12a enzyme digestion reaction, add the total solution to the microplate, and use microplate reader to detect fluorescence intensity.
[0062] Result: As Figure 8-10 As shown, the agarose gel electrophoresis results reveal that the detection limits of the LAMP reaction primers designed for the porcine NADH4 gene, chicken DN2 gene, and duck D-loop gene all reach 1 pg / μL. However, the results of agarose gel electrophoresis are not easily distinguishable, except... Figure 9 In sample A, the ladder-like bands of the LAMP reaction were relatively clear, while other electrophoresis results were difficult to distinguish. When the concentration of porcine DNA in the LAMP reaction system was 1 ng / μL and 0.1 ng / μL, distinct ladder-like bands could be observed. Figure 8 A) However, when the porcine DNA concentration decreased to 1 pg / μL and 0.1 pg / μL, the LAMP reaction bands became unclear. Similarly, Figure 10 The ladder-like bands in A are also not obvious. Therefore, resolving LAMP reaction results by agarose gel electrophoresis may result in false negatives. In contrast, Cas12a digestion based on a JOE-modified reporter probe can solve this problem, such as... Figure 8 As shown in B, 9B, and 10B, the Cas12a digestion reaction produced significant fluorescent signals with high intensity when the template concentration was between 1 ng / μL and 1 pg / μL. This is likely due to the very high trans-cleavage efficiency of the Cas12a enzyme, which can rapidly cleave a large number of fluorescent probes after binding to the target gene.
[0063] Results detected by a real-time PCR instrument Figure 8 C Figure 9 C and Figure 10 C) When the template concentration is between 1 ng / μL and 1 pg / μL, a smooth fluorescence curve is generated that initially rises rapidly over time before reaching a plateau. Further investigation revealed that the fluorescence signal increases more rapidly at higher template concentrations than at lower concentrations, and the fluorescence value reaches the plateau phase more quickly. Besides... Figure 8 In section C, when the template concentration was 10 pg / μL and 1 pg / μL, the fluorescence signal curve could not reach the plateau phase within 15 minutes, while other fluorescence signal curves could reach the plateau phase. Figure 9 C and Figure 10 C). Therefore, selecting 15 minutes as the enzyme digestion time allows for the detection of maximum fluorescence intensity within a short time. Although the results from the ELISA reader show... Figure 8 In sample D, the fluorescence value decreased with decreasing template concentration, but when the concentration decreased to 1 pg / μL, the fluorescence value was still significantly different from that at a template concentration of 0.1 pg / μL. Figure 9 D and Figure 10D. When the template concentration was 1 ng / μL-1 pg / μL, the fluorescence value showed no significant difference, but there was a highly significant difference compared with the fluorescence value when the template concentration was 0.1 pg / μL. LAMP combined with CRISPR / Cas12a technology to enhance fluorescence visualization achieved a detection limit of 1 pg / μL for detecting pork, chicken, and duck.
[0064] Example 5 establishes a method for detecting nucleic acid in pork, chicken, and duck meat using CRISPR / Cas12a technology without the aid of naked eye.
[0065] Portability of equipment is one of the requirements for on-site testing. To collect detection signals under excitation-free conditions, this study established a naked-eye visual detection method for three species—pigs, chickens, and ducks—by comparing the fluorescence signals and naked-eye color changes of the responses using JOE-modified probes and Texas Red-modified probes. The specific experimental procedure is as follows:
[0066] (1) LAMP amplification of the target gene fragment: Using genomic DNA from pigs, chickens, and ducks as templates (10 ng), LAMP amplification was performed using the primer pairs listed in Table 2. The specific steps were as follows: 1 μL Bst 3.0 DNA Polymerase (NEB), 2.5 μL 10× Isothermal Amplification Buffer, 6 mM MgSO4, 14 mM dNTP Mix, and 2.5 μL primer mixture (10× primer: 1.6 μM FIP / BIP; 0.2 μM F3 / B3, 0.4 μM LF / LB). The reaction program was 65℃ for 35 min. 3 μL of the LAMP reaction product was then electrophoretically identified on a 1.5% agarose gel.
[0067] (2) In vitro transcription of crRNA: Using a plasmid containing a T7 promoter and crRNA scaffold (pUC57-T7-crRNA) as a template, the template for in vitro transcription was amplified using PCR with primers T7-crRNA-F, Pig-crRNA-5R, Ch-crRNA-1R, and Duck-crRNA-1R (Table 1). The specific steps were as follows: The reaction system was 50 μL, containing 25 μL of Extaq Mix, 10 pmol each of forward and reverse primers, and 1 μL (approximately 10 ng) of crRNA empty vector as template. The reaction program was: 94℃ for 30 s, 55℃ for 30 s, and 72℃ for 5 s, for a total of 30 cycles, with a final extension at 72℃ for 5 min. The PCR product was then electrophoresed on a 3% agarose gel, and the target band was recovered using a stenolol recovery kit. HiScribe was used to extract the PCR product. TMcrRNA was synthesized using the Quick T7 High Yield RNA Synthesis Kit (NEB) at 37°C for approximately 16 hours. The transcribed crRNA was purified using the phenol-chloroform method and aliquoted for cryopreservation at -80°C.
[0068] (3) Cas12a reaction: In a 20 μL reaction system, the LAMP product (3 μL) containing the template from step 2, the purified crRNA (0.5 μM) from step 2, Cas12a (0.25 μM), and ssDNA-reporter JOE-N12-BHQ1 or TexasRed-N12-BHQ2 (10 μM) were added respectively, with NEB buffer 2.1 as the buffer. The reaction was carried out at 37℃ for 15 min, and then terminated at 98℃ for 2 min. The reaction results were evaluated by taking pictures under blue light, ultraviolet gel imaging, and no-excitation light conditions to assess the method of naked-eye detection of pork, chicken, and duck meat using CRISPR-Cas12a nucleic acid.
[0069] Result: As Figure 11 As shown, both the JOE-modified probe and the Texas Red-modified probe produced significant fluorescence signals in the experimental groups, while the negative control group showed no fluorescence signal. However, the fluorescence colors of the two probes differed under no-excitation conditions. Compared to the JOE-modified probe, the Texas Red-modified probe experimental group showed a greater color difference from the negative control group, making it suitable as a fluorescent probe under naked-eye conditions. Furthermore, the established method can obtain results under naked-eye conditions, reducing equipment investment.
[0070] Example 6 evaluates the specificity of CRISPR / Cas12a technology for naked-eye detection of pork, chicken, and duck.
[0071] To verify the specificity of CRISPR / Cas12a technology for naked-eye detection of pork, chicken, and duck, the PCR detection methods in national and local standards were compared with the CRISPR / Cas12a method for naked-eye visual detection of the three species of pigs, chickens, and ducks.
[0072] (1) Species-specific PCR reaction: Using DNA from pigs, chickens, ducks, cattle, sheep, dogs, and horses as templates (10 ng), PCR reactions were performed using 18S rDNA primer pairs and pig, chicken, and duck species-specific PCR primer pairs (Table 3). A DEPC-treated water was used as a negative control. The reaction products were identified by 2% agarose gel electrophoresis.
[0073] Table 3. Species-specific PCR primer pairs
[0074]
[0075]
[0076] (2) LAMP amplification reaction: 10 ng of porcine, duck, bovine, sheep, dog, and horse DNA were used as templates in the experimental groups, respectively. DEPC water was used instead of target DNA for the negative control. The specific steps were as follows: 1 μL Bst 3.0 DNA Polymerase (NEB), 2.5 μL 10×Isothermal Amplification Buffer, 6 mM MgSO4, 14 mM dNTP Mix, 2.5 μL primer mixture (10×primer: 1.6 μM FIP / BIP; 0.2 μM F3 / B3, 0.4 μM LF / LB (Table 2). The reaction conditions were: 65℃ for 40 min, and 98℃ for 2 min to terminate the reaction.
[0077] (3) In vitro transcription of crRNA: Using a plasmid containing a T7 promoter and crRNA scaffold (pUC57-T7-crRNA) as a template, the template for in vitro transcription was amplified using PCR with primers T7-crRNA-F, Pig-crRNA-5R, Ch-crRNA-1R, and Duck-crRNA-1R (Table 1). The specific steps were as follows: The reaction system was 50 μL, containing 25 μL of Extaq Mix, 10 pmol each of forward and reverse primers, and 1 μL (approximately 10 ng) of crRNA empty vector as template. The reaction program was: 94℃ for 30 s, 55℃ for 30 s, and 72℃ for 5 s, for a total of 30 cycles, with a final extension at 72℃ for 5 min. The PCR product was then electrophoresed on a 3% agarose gel, and the target band was recovered using a stenolol recovery kit. HiScribe was used to extract the PCR product. TM crRNA was synthesized using the Quick T7 High Yield RNA Synthesis Kit (NEB) at 37°C for approximately 16 hours. The transcribed crRNA was purified using the phenol-chloroform method and aliquoted for cryopreservation at -80°C.
[0078] (4) Cas12a digestion reaction: The reaction was carried out in a 20 μL reaction system, with the LAMP product (3 μL) of the template from step 2, the purified crRNA (0.5 μM) from step 3, Cas12a (0.25 μM), and Texas Red-N12-BHQ2 (10 μM) added separately, and the buffer was NEB buffer 2.1. The reaction was carried out at 37℃ for 15 min, and then terminated at 98℃ for 2 min. The reaction tubes were then examined under blue light gel cutting, ultraviolet gel imaging, and naked-eye conditions.
[0079] (5) Detection of fluorescence signal using an ELISA reader: First, take 80 μL of DEPC water to dilute the solution after Cas12a enzyme digestion reaction in (4), and then add the total solution to the ELISA plate. Then, use an ELISA reader to detect the fluorescence intensity.
[0080] Result: As Figure 12-14 As shown, firstly, PCR amplification was performed on DNA from all species using universal primers for the 18S rRNA gene. The results showed that all species amplified the expected PCR fragment (12A), indicating high genome quality, ready for further experiments. Then, PCR primers for pigs, chickens, and ducks according to national and local standards were used to amplify DNA from pigs, chickens, ducks, cattle, sheep, dogs, and horses, respectively. The results showed that only the target gene amplified the expected specific band (…). Figure 12 (B, 12C, and 12D). The amplified band sizes for pork, chicken, and duck were approximately 212 bp, 131 bp, and 201 bp, respectively.
[0081] The genomes of pigs, chickens, ducks, cattle, dogs, and horses were amplified using specific LAMP primers for detecting pork, chicken, and duck, respectively. Then, Cas12a digestion was performed using a Texas Red-modified probe. Reactions using the target gene as a template all produced fluorescent signals, while reactions using non-target genes and the negative control did not produce fluorescent signals. Figure 13 Similarly, the signals acquired by the ELISA reader were consistent with the results of naked-eye visualization, and the fluorescence values of the target reaction and the reactions with non-target genes and water showed extremely significant differences. Figure 14 Therefore, the CRISPR / Cas12a technology has good specificity for detecting pork, chicken, and duck meat with the naked eye, and can accurately distinguish the DNA of pork, chicken, and duck meat.
[0082] Example 7: Visually Distinguishing the Sources of Simulated Mixed Meat Products Using CRISPR / Cas12a Technology
[0083] (1) Preparation of simulated mixed meat product materials: Using sterile tweezers and scissors, cut the purchased pork, chicken, duck, buffalo, beef, goat, and sheep meat into small pieces, weigh them according to Table 4, and mix them into a 1.5 mL centrifuge tube containing 20 μL of LEPC water. Mix thoroughly. Extract the genome of the simulated mixed meat product using the crude extraction method. Add 20 μL of the mixed meat product to an EP tube containing 20 μL of Lucigen QuickExtract DNA Extraction Solution and react at 95 °C for 5 min.
[0084] Table 4 Simulated Mixed Meat Products
[0085]
[0086]
[0087] Note: Unit is mg.
[0088] (2) LAMP amplification reaction: 2 μL of the crude nucleic acid extracted in (1) was used as a template. The specific steps were as follows: 1 μL Bst3.0 DNA Polymerase (NEB), 2.5 μL 10×Isothermal Amplification Buffer, 6 mM MgSO4, 14 mM dNTP Mix, and 2.5 μL primer mixture (10×primer: 1.6 μM FIP / BIP; 0.2 μM F3 / B3, 0.4 μM LF / LB) (Table 2). The reaction conditions were: 65℃ for 40 min, and 98℃ for 2 min to terminate the reaction. DEPC water was used instead of target DNA for the negative control.
[0089] (3) Cas12a digestion reaction: The reaction was carried out in a 20 μL reaction system, with the LAMP product (3 μL) containing the template from step 2, purified crRNA (0.5 μM), Cas12a (0.25 μM), and Texas Red-N12-BHQ2 (10 μM) added separately, and the buffer was NEB buffer 2.1. The reaction was carried out at 37℃ for 15 min, and then terminated at 98℃ for 2 min. The reaction tubes were then examined under blue light gel cutting, ultraviolet gel imaging, and naked-eye conditions.
[0090] Result: As Figure 15-16 As shown, by mixing pork, chicken, and duck with other meats, binary, ternary, quaternary, and pentagonal mixtures are formed. Figure 15 To simulate real mixed meat products, nucleic acids rapidly extracted using a crude extraction method were used as templates, and LAMP-CRISPR / Cas12a methods were employed to detect pork, chicken, and duck meat, respectively. Figure 16 As shown, the simulated mixed meat products containing the target ingredient (1, 2, 3, 6, 7, 8, 11, 12, and 13) all exhibited strong fluorescence signals, while the simulated mixed meat products without the target ingredient (4, 5, 8, 10, 14, and 15) and the negative control showed no fluorescence signals. Therefore, CRISPR / Cas12a technology can identify animal-derived components in meat or meat products and is particularly suitable for rapid on-site detection.
[0091] In the above steps, any techniques not described in detail or specifically specified are conventional techniques already existing in the prior art, and can be carried out according to conventional molecular biology and cell biology experimental conditions or the conditions recommended in the manufacturer's instructions. sequence list <110> Wuhan Academy of Agricultural Sciences Huazhong Agricultural University <120> Kits and methods for identifying pork, chicken, and duck-derived components in meat or meat products based on CRISPR technology <160> twenty one <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <400> 1 gcatgcatca tagccttca 19 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <400> 2 ggttatgatt atacctcata tggaa 25 <210> 3 <211> 44 <212> DNA <213> Artificial Sequence <400> 3 aacctgcaat aggggcttct gtaaaaatac ctctatacgg actc 44 <210> 4 <211> 43 <212> DNA <213> Artificial Sequence <400> 4 actcggaggc tatggcataa gaatggatag gctatgtagt ttg 43 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <400> 5 acatgggctt ttggcagtca aag 23 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <400> 6 tgcgaatcac tactattcta aaccc 25 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <400> 7 ccctaatcgg aggctgaa 18 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <400> 8 ctttgatttg ggctaggga 19 <210> 9 <211> 43 <212> DNA <213> Artificial Sequence <400> 9 attcatccta aatggggagat ggatggggcc taaaccaaac aca 43 <210> 10 <211> 44 <212> DNA <213> Artificial Sequence <400> 10 aacccacaac tcactattct cactaggaat acagttgagg tcat 44 <210> 11 <211> twenty one <212> DNA <213> Artificial Sequence <400> 11 tttgtgtttg gtttaggccc a 21 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <400> 12 tctcaccttc atcctctaca caatt 25 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 cacctcacgt gaaatcagca 20 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <400> 14 cagaggcgcc aaaaagct 18 <210> 15 <211> 38 <212> DNA <213> Artificial Sequence <400> 15 aatgtgagga gggcgagggg tgtccgacgt gactagct 38 <210> 16 <211> 40 <212> DNA <213> Artificial Sequence <400> 16 ggttcactca cctctccttg cctgccgcga ttacgcattg 40 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <400> 17 gggaacgtat gggcctga 18 <210> 18 <211> twenty three <212> DNA <213> Artificial Sequence <400> 18 gcatctgtgg aatacttcca cca 23 <210> 19 <211> twenty four <212> RNA <213> Artificial Sequence <400> 19 gcaguacggc ugcaaguacu auug 24 <210> 20 <211> twenty four <212> RNA <213> Artificial Sequence <400> 20 ggaugaauaa uuauaauuau cucc 24 <210> twenty one <211> twenty four <212> RNA <213> Artificial Sequence <400> twenty one cgccucuggu uccucgguca gggc 24
Claims
1. A kit for detecting porcine, chicken and duck derived components in meat or meat products based on CRISPR-Cas12a technology, characterized in that, The single-stranded DNA reporter molecule comprises a LAMP primer set, a Cas12a protein, a crRNA and a fluorescence-quenching labeled single-stranded DNA reporter molecule, the LAMP primer set is composed of primers for amplifying a pig NADH4 gene, primers for amplifying a chicken ND2 gene and primers for amplifying a duck D-loop gene, the sequences of the primers for amplifying the pig NADH4 gene are shown as SEQ ID NO. 1-6, the sequences of the primers for amplifying the chicken ND2 gene are shown as SEQ ID NO. 7-12, and the sequences of the primers for amplifying the duck D-loop gene are shown as SEQ ID NO. 13-18, the crRNA is composed of a crRNA targeting the pig NADH4 gene, a crRNA targeting the chicken ND2 gene and a crRNA targeting the duck D-loop gene, the sequence of the crRNA targeting the pig NADH4 gene is shown as SEQ ID NO. 19, the sequence of the crRNA targeting the chicken ND2 gene is shown as SEQ ID NO. 20, and the sequence of the crRNA targeting the duck D-loop gene is shown as SEQ ID NO.
21.
2. The kit of claim 1, wherein The fluorescence label of the single-stranded DNA reporter molecule is Texas Red.
3. The kit of claim 1, wherein The amplification reaction solution and the enzyme digestion buffer are further included.
4. A method for visual detection of porcine, chicken and duck derived components in meat or meat products based on CRISPR-Cas12a system, characterized in that, The method comprises the following steps: amplifying a to-be-tested component by using a LAMP primer combination, mixing the amplification product with a Cas12a protein, a fluorescence-quenching labeled single-stranded DNA reporter molecule and a crRNA to perform an enzyme digestion reaction, and detecting a pig, chicken and duck derived component according to the color change or fluorescence change of the reporter molecule, the sequence of the LAMP primer combination is shown as SEQ ID NO. 1-18, and the sequence of the crRNA is shown as SEQ ID NO. 19-21.
5. The method of claim 4, wherein, The time of the enzyme digestion reaction is 15 min.
Citation Information
Patent Citations
Kit and method for rapidly identifying bovine-derived components in fish meal
CN114196745A