Rhizopus arrhizus AS7-34 and its application in extracting Angelica polysaccharide

Abstract

The present invention discloses a Rhizopus arrhizus AS7-34 and its application in extracting Angelica polysaccharide. Rhizopus arrhizus AS7-34 is preserved in the Guangdong Provincial Culture Collection Center of Microorganisms, with the preservation number: GDMCC No: 62601, and the preservation date is July 6, 2022. Before extracting polysaccharide from Angelica, the present invention adds a fermentation pretreatment with the microbial strain Rhizopus arrhizus AS7-34. After that, the Angelica powder is added with water and incubated with enzymes. Substances such as cellulose, hemicellulose and lignin in the cell wall are hydrolyzed, which helps the soluble polysaccharide in Angelica to dissolve during ultrasonic water extraction, thus significantly improving the extraction yield of polysaccharide. Compared with the conventional method without fermentation pretreatment, the extraction yield of Angelica polysaccharide can be increased by 43.7%.

Description

(1) Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and particularly relates to a strain of Rhizopus arrhizus AS7-34 and its application in extracting Angelica polysaccharide. (2) Background Art

[0002] The traditional Chinese medicinal material Angelicae Sinensis Radix is the dried root of the perennial herb Angelica sinensis of the family Apiaceae. Angelicae Sinensis Radix is a commonly used traditional Chinese medicine, which is warm in nature, sweet and pungent in taste, and has the effects of enriching blood, promoting blood circulation, regulating menstruation and relieving pain, moistening the intestines and promoting defecation, and strengthening the healthy qi and consolidating the root. Angelicae Sinensis Radix contains a variety of active ingredients, including ligustilide, ferulic acid, Angelica polysaccharide, chalcone, and sesquiterpenes. Pharmacological studies in recent years have shown that Angelica polysaccharide has rich biological activities, plays a role in the body's immune system and hematopoietic system by activating the complement, and also has activities such as anti-tumor, anti-radiation damage, and promoting the healing of gastric ulcers. One of the main components of the Chinese patent medicines "Guiqi Oral Liquid" and "Guiqi Granules" is Angelica polysaccharide. Therefore, Angelica polysaccharide has broad application prospects in the medical and health food industries.

[0003] At present, there are many research reports on the extraction methods of Angelica polysaccharide. The basic method is the hot water extraction and ethanol precipitation method (abbreviated as "water extraction and alcohol precipitation method"). On this basis, microwave, ultrasonic, enzymatic hydrolysis and other auxiliary extractions are also used. Different extraction methods have their own advantages and disadvantages. For example, the traditional water extraction and alcohol precipitation method is simple to operate, but has disadvantages such as low extraction yield and long time consumption; the microwave-assisted extraction method has a short extraction time and high efficiency, but the activity of the polysaccharide decreases; the ultrasonic-assisted extraction method has low equipment requirements and does not significantly increase the extraction cost, but the effect of improving the extraction yield is not significant enough; the enzymatic hydrolysis-assisted extraction method can significantly improve the extraction yield, and the conditions are mild, and the polysaccharide extracted has good activity. The disadvantage is that it increases the cost of enzyme use and the extraction process takes a long time.

[0004] In recent years, enzymatic hydrolysis technology has been widely used in the extraction of plant active ingredients. It uses cellulase, pectinase, protease, etc. to hydrolyze plant raw materials under appropriate conditions, so that the plant cell wall is hydrolyzed, which is beneficial to the release of intracellular active ingredients during extraction. At present, cellulase is the most widely used enzyme in the extraction of plant active ingredients. The composition of the plant cell wall includes substances such as cellulose, hemicellulose, lignin, and pectin. Using cellulase alone often fails to achieve a very ideal effect. In order to improve the effect of enzymatic hydrolysis extraction, many studies adopt the composite enzyme method, that is, using 2 or more enzymes such as cellulase, pectinase, and protease at the same time. Although it can significantly improve the product extraction yield, the use of multiple enzymes undoubtedly increases the extraction cost.

[0005] Microorganisms have strong enzyme-producing abilities, especially some actinomycetes and molds, which can produce a variety of hydrolytic enzymes that decompose plant tissues, including cellulases, hemicellulases, ligninases, pectinases, and proteases. Therefore, if a certain microorganism is used to directly ferment plant materials, the various hydrolytic enzymes produced during the growth of the microorganism can synergistically decompose cell wall components, thereby facilitating the release of effective ingredients in the cells and significantly improving the extraction yield.

[0006] In order to improve the extraction rate of angelica polysaccharide, the present invention improves the traditional water extraction and alcohol precipitation extraction method, adds a microbial fermentation pretreatment step, and can greatly improve the extraction rate of angelica polysaccharide. (3) Summary of the invention

[0007] The present invention aims to provide a new microbial strain, Rhizopus arrhizus AS7-34, and its application in extracting angelica polysaccharides. After angelica is fermented by the strain, the extraction rate of angelica polysaccharides can be significantly improved.

[0008] The technical solution adopted in the present invention is:

[0009] The present invention provides a new microbial strain - Rhizopus arrhizus AS7-34, which is deposited in Guangdong Provincial Microbiological Culture Collection Center with a deposit number of GDMCC No: 62601 and a deposit date of July 6, 2022. The address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province; Postal Code: 510070.

[0010] The Rhizopus arrhizus AS7-34 described in the present invention is an excellent strain isolated from the microbial enrichment culture of Angelica sinensis, and obtained through screening and mutagenesis breeding. The colony morphology characteristics of the Rhizopus arrhizus AS7-34 are as follows: when cultured on potato agar plate medium (PDA) at 28°C, the colony is light white and fluffy at the beginning, and gradually turns gray after 1 day. The hyphae grown at the inoculation line are darker in color, and there are a large number of gray-black spores on the surface of the colony; the creeping hyphae and rhizoids are underdeveloped, the rhizoids are short and finger-shaped; the creeping hyphae are lighter in color; the sporangial stalks are mostly curved, rarely solitary, and mostly form umbrella-shaped aggregates, growing directly from the hyphae without corresponding to the rhizoids; the sporangia are spherical or nearly spherical, dark brown-gray; the sporangiospores are elliptical or polygonal, with faint stripes on the surface, and a diameter of 4-7μm. The colony photo of Rhizopus arrhizus AS7-34 cultured on PDA plate medium at 28°C for 2d is shown in Figure 1 .

[0011] The nucleotide sequence of the ribosomal DNA internal transcribed spacer (rDNA-ITS) of Rhizopus arrhizus AS7-34 is shown as SEQ ID NO.1.

[0012] The present invention also provides an application of the Rhizopus arrhizus AS7-34 in extracting Angelica polysaccharide. The method of the application is as follows: (1) Add the spore solution of Rhizopus arrhizus AS7-34 to the Angelica powder, stir evenly, and ferment at 28–30 °C for 60–72 h to obtain an Angelica ferment; (2) Add deionized water to the Angelica ferment, oscillate evenly, keep warm at 30–35 °C for 4–6 h, concentrate after ultrasonic water extraction to obtain an Angelica water extract concentrate; (3) Then add ethanol to the Angelica water extract concentrate to precipitate the polysaccharide. After the precipitate is washed with ethanol and dried, an Angelica polysaccharide extract is obtained.

[0013] Furthermore, the Angelica powder in step (1) is obtained by naturally air-drying or drying the traditional Chinese medicine Angelica at 80 °C, pulverizing it, and sieving it through a 40-mesh sieve.

[0014] Furthermore, the preparation method of the spore solution of Rhizopus arrhizus AS7-34 in step (1) is as follows: Inoculate the spores of Rhizopus arrhizus AS7-34 stored at low temperature on a potato dextrose (PDA) plate medium, incubate at a constant temperature of 28–30 °C for 48–60 h, then add a sterile sucrose aqueous solution with a concentration of 40–60 g / L to the culture, and stir with an inoculation loop to suspend the spores to obtain a spore solution; preferably, adjust the spore concentration of the spore solution to 5×10 6 –9×10 6 cells / mL with a sterile sucrose aqueous solution. The final concentration composition of the PDA plate medium is: 200 g / L of potato (cut into small cubes with a side length of about 1 cm, boiled for 20 min and then filtered to retain the juice), 20 g / L of glucose, 20 g / L of agar, the solvent is tap water, and the pH is natural (measured to be about 6.5).

[0015] Furthermore, the volume dosage of the spore solution of Rhizopus arrhizus AS7-34 added to the Angelica powder in step (1) is 1.0–1.6 mL / g based on the mass of the Angelica powder.

[0016] Furthermore, the volume addition amount of deionized water to the Angelica ferment in step (2) is 15–20 mL / g based on the mass of the raw Angelica powder in step (1) (i.e., the material-liquid ratio is 1:15–1:20).

[0017] Further, the preparation method of the angelica water extract concentrate in step (2) is as follows: Deionized water is added to the angelica ferment, and after stirring evenly, it is kept warm at 30–35 °C for 4–6 h, then transferred to an ultrasonic cleaner with a water temperature of 80–85 °C, and ultrasonically extracted at 100–200 W for 40–60 min. Then, the pH is adjusted to 9.0–10.0 with a saturated Ca(OH)₂ aqueous solution, and suction filtration is carried out with a Buchner funnel. The collected filtrate is adjusted to pH 4.0–5.0 with acetic acid, and suction filtration is carried out again with a Buchner funnel. The filtrate is concentrated under reduced pressure to 1 / 15–1 / 10 of the original volume at 60 °C and –0.1 MPa to obtain the angelica water extract concentrate; the added volume of deionized water in the angelica ferment is 15–20 mL / g based on the mass of the raw angelica powder (i.e., the solid-liquid ratio is 1:15–1:20).

[0018] Further, the preparation method of the angelica polysaccharide in step (3) is as follows: 95% ethanol (hereinafter referred to as "95% ethanol") is added to the angelica water extract concentrate to make the ethanol volume fraction of the solution reach 70%–75%. After standing at 4 °C for 12–16 h, centrifugation is carried out at 8000 r / min for 5–10 min, and the supernatant is discarded. The precipitate is washed once with 95% ethanol at 2 mL / g based on the mass of the raw angelica powder, and centrifuged again. The precipitate is dried to a constant weight under vacuum at 50 °C and –0.1 Mpa to obtain the angelica polysaccharide extract.

[0019] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in that: before extracting polysaccharides from angelica, the present invention adds microbial fermentation pretreatment. The microbial strain used is Rhizopus arrhizus AS7-34, which is purposefully screened for being able to hydrolyze the cell wall of angelica plants. It grows moderately in the angelica powder added with sucrose and produces various hydrolases. Then, the angelica powder is added with water and incubated for enzymatic hydrolysis, and substances such as cellulose, hemicellulose, and lignin in the cell wall are hydrolyzed, which helps the soluble polysaccharides in angelica to dissolve during ultrasonic water extraction, thereby significantly improving the extraction rate of polysaccharides. Compared with the conventional method without fermentation pretreatment, the extraction rate of angelica polysaccharide can be increased by 43.7%. (IV) BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a colony morphology photo of Rhizopus arrhizus AS7-34.

[0021] Figure 2 It is a standard curve for the determination of polysaccharides by the phenol-sulfuric acid method.

[0022] Figure 3 For the p-nitrophenol concentration—A 400 Standard curve. (V) SPECIFIC EMBODIMENTS

[0023] The present invention will be further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto.

[0024] The angelica described in the embodiment of the present invention is the dried root of Angelica sinensis, a perennial herb of the Apiaceae family; the angelica powder is a fine powder obtained by naturally drying the angelica or drying it at 80° C. and then grinding it through a 40-mesh sieve.

[0025] Example 1: Isolation and screening of microbial strains for fermentation of Angelica sinensis

[0026] (1) Add 5 g of angelica powder to a 100-mL triangular flask, then add 5 mL of sterile saline and stir evenly. Incubate at 28°C for 72 h. Dilute the enriched culture full of mold with sterile saline to 1×10 -6 , 1×10 -7 , 1×10 -8 After 2 times the dilution, 0.1 mL of the dilution solution was respectively applied to potato dextrose agar (PDA) plate medium and cultured at 28 °C for 48 h. Fungal colonies with different colors and morphologies were picked and transferred to fresh PDA plate medium and cultured at 28 °C for 60 h. Twelve pure culture strains were obtained. The strain numbers are shown in Table 1.

[0027] (2) Add 10 mL of 40 g / L sterile sucrose aqueous solution to each of the 12 strains. Use an inoculating loop to stir the spores to suspend them. Transfer the spore solution to a sterile test tube and adjust the spore concentration to 5.0 × 10 6 –9.0×10 6 The sterile sucrose aqueous solution was sterilized by high pressure steam at 121° C. for 15 min.

[0028] (3) 10 g of angelica powder was added to 12 250-mL Erlenmeyer flasks sterilized by dry heat at 160°C for 2 h, and 10 mL of each mold spore solution prepared in step (2) was added to each flask. After stirring evenly, the flasks were sealed with 8 layers of gauze and cultured at 28°C for 72 h to obtain angelica fermentation products.

[0029] (4) To the Erlenmeyer flasks containing all the Angelica sinensis fermentation products fermented by each strain in step (3), add 150 mL of deionized water (in the original Erlenmeyer flasks, the ratio of material to liquid is 1:15), shake evenly, keep warm in a water bath at 30 °C for 6 h, then transfer to an ultrasonic cleaner at 80 °C, perform ultrasonic extraction at 100 W for 60 min, adjust the pH to 9.0 with saturated Ca(OH)₂ aqueous solution, filter with a Buchner funnel while it is hot, adjust the pH of the filtrate to 5.0 with acetic acid, and filter again with a Buchner funnel. Take 1 mL of the filtrate in a test tube, add 3 mL of 95% ethanol (the ethanol volume fraction of the solution is 71.3%), shake well, let it stand at 4 °C for 12 h, centrifuge at 8000 r / min for 5 min, discard the supernatant, dissolve the precipitate with 5 mL of deionized water, and determine the content of soluble polysaccharides in the solution by the phenol-sulfuric acid method.

[0030] Under the same conditions, a blank fermentation control was made by adding 10 mL of 40 g / L sterile sucrose aqueous solution to 10 g of Angelica sinensis powder; Angelica sinensis polysaccharides were directly extracted with 150 mL of phosphate buffer solution (pH 6.0, 0.2 mol / L) containing cellulase (activity of 1000 U / mL) as a control for cellulase extraction. The polysaccharide extraction yields of Angelica sinensis fermented by different strains and the control are shown in Table 1.

[0031] Table 1 Polysaccharide extraction yields of Angelica sinensis fermented by different strains and the control

[0032]

[0033] It can be seen from the data in Table 1 that for the blank fermentation control with 10 mL of sterile sucrose aqueous solution added and the fermentation of most strains, the extraction yields of Angelica sinensis polysaccharides did not increase significantly and even decreased, indicating that there is a species selectivity for the microbial strains used to ferment Angelica sinensis to improve the polysaccharide extraction yield. Extracting Angelica sinensis polysaccharides with cellulase aqueous solution can also improve the polysaccharide extraction yield, which is 12.7% higher than that of the non-enzymatic hydrolysis control, but far less than the fermentation by strain AS7. After Angelica sinensis was fermented by strain AS7, the polysaccharide extraction yield was 11.8%, which was 27.8% higher than the 9.23% of the non-fermented control. In the present invention, strain AS7 was selected as the fermentation strain to improve the polysaccharide extraction yield of Angelica sinensis.

[0034] The composition of the PDA plate medium is as follows: 200 g / L of potato, 20 g / L of glucose, 20 g / L of agar, with water as the solvent and natural pH. It is prepared according to the following composition and method: Wash and peel fresh potatoes, cut them into small cubes with a side length of about 1 cm, weigh 200 g, add 1000 mL of tap water, boil for 20 min, filter with four layers of gauze to remove residues, make up the filtrate to 1000 mL, add 20 g of glucose and 20 g of agar, with natural pH (measured about 6.5), shake well and pour into Erlenmeyer flasks, tie the mouth with eight layers of gauze, sterilize at 121 °C under high-pressure steam for 20 min, and pour into sterile petri dishes with a diameter of 9 cm before solidification, 15–20 mL per dish.

[0035] The content of Angelica polysaccharide is determined by the phenol-sulfuric acid method. The specific method is as follows: When the sample to be measured is the Angelica polysaccharide extract, it is diluted appropriately with deionized water (the measured A 490 is between 0.2 and 0.8); when the sample to be measured is a solid polysaccharide extract, it is prepared into an aqueous solution with a mass concentration of 0.1 mg / mL. Pipette 1 mL of the sample solution to be measured into a test tube, add 1 mL of 5% phenol aqueous solution by volume fraction, shake well and then quickly add 5 mL of concentrated sulfuric acid (mass concentration 98%), shake well and let stand at room temperature for 10 min, heat in a boiling water bath for 15 min, and cool to room temperature with running water. Using the same treatment with 1 mL of deionized water as the blank control as the reference, measure the absorbance (A 490 ) at a wavelength of 490 nm. Measure the A of glucose samples with different mass concentrations in the same way 490 , and draw a glucose mass concentration - A 490 standard curve ( Figure 2 ), obtain the regression equation, and calculate the polysaccharide content in the Angelica polysaccharide sample to be measured from the regression equation.

[0036] The extraction yield of Angelica polysaccharide is calculated according to the following formula:

[0037]

[0038] Example 2: Mutation breeding of fermentation strain AS7

[0039] Perform mutation breeding on strain AS7 to screen strains with excellent performance in fermenting Angelica. The specific method is as follows:

[0040] (1) Preparation of spore suspension: After the strain AS7 was activated and cultured on a PDA plate medium at 28 °C for 48 h, 5 mL of sterile normal saline was added. The spores were suspended by stirring with an inoculation loop and then transferred into a triangular flask containing 45 mL of sterile normal saline (with 20 - 30 glass beads added). It was shaken at room temperature for 15 min. The spore suspension was filtered to remove hyphae (a small ball of absorbent cotton was placed at the bottom of the triangular funnel). The spores in the suspension were counted using a hemocytometer under a microscope and appropriately diluted with sterile normal saline to adjust the spore count to 1.33×10 6 per mL.

[0041] (2) Mutation: Under red light illumination, 1.5 mL of the above spore suspension was taken respectively into petri dishes with a diameter of 6 cm. The petri dishes were placed on a magnetic stirrer and irradiated at a distance of 30 cm from a preheated 15 W ultraviolet lamp for 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 4.0, 5.0 min respectively. After the irradiated spore suspension was appropriately diluted, 0.1 mL was taken and spread on the PDA plate medium respectively. Using the same operation, the spore suspension without ultraviolet irradiation was diluted and spread on the plate as a control to calculate the lethality rate. The inoculated PDA plates were wrapped with black cloth and inverted and cultured at 28 °C for 36 h. The colonies on the plates were counted to calculate the lethality rate.

[0042] (3) Screening: The colonies on the PDA plates with a lethality rate of over 90% were picked and transferred to fresh PDA plate media to obtain 52 strains. In the fresh plate cultures of each strain, 10 mL of sterile normal saline was added respectively, and the spores were suspended by stirring with an inoculation loop to obtain the spore suspension of each strain. 2 mL of the spore suspension of each strain was pipetted and inoculated into 50 mL of enzyme-producing medium. After enzyme-producing culture at 30 °C and 200 r / min under constant temperature oscillation conditions for 72 h, the fermentation broth was filtered by suction using a Buchner funnel, and the filtrate was collected to measure the β-glucosidase activity of the fermentation filtrate of each strain. 15 strains with a relatively large increase in enzyme activity were selected. Then, according to the method of Example 1, the spore suspensions of these 15 strains were used to inoculate angelica powder for fermentation, and polysaccharides were extracted by ultrasonic water extraction and ethanol precipitation method, and the polysaccharide content in the extract was measured. The polysaccharide extraction yields of the screened mutant strains fermenting angelica are shown in Table 2.

[0043] Table 2 Polysaccharide extraction yields of the screened mutant strains fermenting angelica

[0044]

[0045] As can be seen from the data in Table 2, among the 15 strains screened in the second screening, the strain numbered AS7-34 had a β-glucosidase activity of 32.5 U / mL during fermentation, which was 52.6% higher than that of the wild strain AS7 (21.3 U / mL). After fermenting Angelica sinensis with this strain, the polysaccharide extraction rate was 13.7%, which was 16.1% higher than that of the wild strain AS7 (11.8%) and 48.4% higher than that of the unfermented control (9.23%).

[0046] The final concentration composition and preparation method of the enzyme-producing medium are as follows: wheat bran 30 g / L, (NH4)2SO4 5 g / L, KH2PO4 5 g / L, MgSO4 0.5 g / L, CaCl2 0.2 g / L, FeSO4 0.1 g / L. The solvent is tap water and the pH is 6.0. A 250-mL Erlenmeyer flask is filled with 50 mL of the enzyme-producing medium, sealed with 8 layers of gauze, and sterilized at 121 °C for 20 min under high-pressure steam.

[0047] The method for determining the β-glucosidase activity is as follows: 0.8 mL of crude enzyme solution, 0.2 mL of 5 mmol / L p-nitrophenyl-β-D-glucopyranoside (pNPG) (prepared with 0.2 mol / L phosphate buffer at pH 6.0) are successively added to a test tube. After reacting at 35 °C for 15 min, 2 mL of 1 mol / L Na2CO3 solution is added and shaken well to terminate the reaction. Using the same treatment of the boiled and inactivated crude enzyme solution as the reference, the absorbance (A 400 ) is measured at a wavelength of 400 nm. From the p-nitrophenol (pNP) concentration - A 400 standard curve ( Figure 3 ), the pNP concentration in the reaction system is calculated.

[0048] Definition of the β-glucosidase activity unit (U): In a buffer system at 35 °C and pH 6.0, the amount of enzyme that hydrolyzes pNPG to generate 1 μmol of pNP within 1 min is defined as 1 enzyme activity unit.

[0049] The β-glucosidase activity is calculated according to the following formula (1):

[0050]

[0051] In formula (1), V1: total volume of the reaction system; C1: pNP concentration; V2: volume of the crude enzyme solution; T: reaction time.

[0052] p-nitrophenol concentration - A 400Preparation of standard curve: Prepare a pNP standard solution with a concentration of 1 mmol / L using deionized water. Respectively pipette 0.1, 0.2, 0.3, 0.4, and 0.5 mL of the standard solution into 10 mL volumetric flasks, make up the volume with 1 mol / L Na2CO3 solution and mix well, so that the concentrations of p-nitrophenol in each sample are 10, 20, 30, 40, and 50 μmol / L respectively. Using deionized water as the blank, measure the absorbance at a wavelength of 400 nm. With the p-nitrophenol concentration as the abscissa and A 400 as the ordinate, plot the p-nitrophenol concentration - A 400 standard curve( Figure 3 ).

[0053] Example 3: Taxonomic identification of strain AS7-34

[0054] Strain AS7-34 was streaked on a PDA plate medium and cultured at 28°C. The colonies were initially light white and fluffy, gradually turning gray after 1 day. The hyphae growing at the inoculation line were darker in color, and there were a large number of gray-black spores on the surface of the colonies; the stolons and rhizoids were not well-developed, the rhizoids were short and finger-shaped; the stolons were lighter in color; most of the sporangiophores were curved, rarely solitary, mostly formed umbrella-shaped aggregations, growing directly from the hyphae without corresponding to the rhizoids; the sporangia were spherical or nearly spherical, dark brownish-gray; the sporangiospores were oval or polygonal, with faint stripes on the surface, 4–7 μm in diameter. The colony photo of Rhizopus arrhizus AS7-34 cultured on PDA plate medium at 28°C for 2 days is shown in Figure 1 .

[0055] The rDNA-ITS nucleotide sequence of strain AS7-34 was shown as SEQ ID NO.1. This sequence was subjected to BLAST alignment in NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov), and had 100% homology with the rDNA-ITS sequence of the typical strain CBS112.07 of Rhizopus arrhizus. According to the colony morphological characteristics of strain AS7-34 and the results of rDNA-ITS nucleotide sequence alignment, the biological taxonomic position of strain AS7-34 can be determined (refer to Mycobank, http: / / www.mycobank.org): Fungi, Mucoromycota, Mucoromycetes, Mucorales, Mucoraceae, Rhizopus, Rhizopus arrhizus.

[0056] The rDNA-ITS sequence described above is:

[0057] GGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTGGTTTCAGGAGTACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGTTTTTCTATAGAGTACGCCTGCTTCAGTATCATCACAAACCCACACATAACATTTGTTTATGTGGTGATGGGTCGCATCGCTGTTTTATTACAGTGAGCACCTAAAATGTGTGTGATTTTCTGTCTGGCTTGCTAGGCAGGAATATTACGCTGGTCTCAGGATCTTTTTTTTTGGTTCGCCCAGGAAGTAAAGTACAAGAGTATAATCCAGTAACTTTCAAACTATGATCTGAAGTCAGGTGGGATTACCCGCTGAACTTA.

[0058] In summary, the strain AS7 isolated from the microbial enrichment of angelica powder was mutagenized by ultraviolet light, and the strain AS7-34, namely Rhizopus arrhizus AS7-34, was obtained by screening. This strain was deposited in the Guangdong Microbial Culture Collection Center, with the deposit number: GDMCC No: 62601, the deposit date: July 6, 2022, and the address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Guangdong Province; Postcode: 510070.

[0059] Example 4: Application of Rhizopus arrhizus AS7-34 in the extraction of angelica polysaccharide

[0060] The application of Rhizopus arrhizus AS7-34 in the extraction of angelica polysaccharide can be operated according to the following steps:

[0061] (1) The spores of Rhizopus arrhizus AS7-34 preserved by lyophilization were inoculated onto a fresh PDA plate medium and incubated at a constant temperature of 28 °C for 60 h. 10 mL of a 40 g / L sterile sucrose aqueous solution was added to the petri dish, and the spores were suspended by stirring with an inoculation loop. The spore suspension was transferred to a sterile test tube, and the spore concentration was adjusted to 6.80×10 6 cells / mL with a 40 g / L sterile sucrose aqueous solution to obtain a spore suspension of Rhizopus arrhizus AS7-34. The composition and preparation method of the PDA plate medium were the same as those in Example 1; the sterile sucrose aqueous solution was sterilized by high-pressure steam at 121 °C for 15 min.

[0062] (2) 25 g of angelica powder was placed in a 250-mL Erlenmeyer flask that had been sterilized by dry heat at 160 °C for 2 h, and then 25 mL of the spore suspension of Rhizopus arrhizus AS7-34 prepared in step (1) was added and stirred evenly. The Erlenmeyer flask was sealed with eight layers of gauze and cultured at 28 °C for 72 h to obtain an angelica ferment.

[0063] (3) All of the angelica ferment from step (2) was transferred to a 1-L Erlenmeyer flask, 400 mL of deionized water (the solid-to-liquid ratio was 1:16) was added, and after shaking evenly, it was incubated in a water bath at 30 °C for 6 h. Then, the Erlenmeyer flask was transferred to an ultrasonic cleaner with a water temperature of 80 °C and ultrasonically extracted at 100 W for 60 min. Then, the pH was adjusted to 9.0 with a saturated Ca(OH)2 aqueous solution, and it was filtered by suction through a Buchner funnel while it was still hot. The filtrate was adjusted to pH 5.0 with acetic acid and filtered by suction again through a Buchner funnel. All of the filtrate was concentrated under reduced pressure to 40 mL at 60 °C and -0.1 MPa to obtain a concentrated solution.

[0064] (4) To all of the concentrated solution obtained in step (3), 112 mL of 95% ethanol (the ethanol volume fraction of the solution was 70%) was added. After standing at 4 °C for 12 h, it was centrifuged at 8000 r / min for 5 min, and the supernatant was discarded. It was washed once with 50 mL of 95% ethanol and centrifuged again. The precipitate was dried to a constant weight under vacuum at 50 °C and -0.1 Mpa and ground into a fine powder to obtain an angelica polysaccharide extract.

[0065] According to the above steps, 5.32 g of an angelica polysaccharide extract was obtained from 25 g of angelica. The polysaccharide content was 61.8%, that is, 3.29 g of angelica polysaccharide was obtained, and the extraction yield was 13.2%. The product was an off-white powder.

[0066] Example 5: Application of Rhizopus arrhizus AS7-34 in the extraction of angelica polysaccharide

[0067] The application of Rhizopus arrhizus AS7-34 in the extraction of angelica polysaccharide can be operated according to the following steps:

[0068] (1) The spores on the PDA plate of Rhizopus arrhizus AS7-34 stored at 4°C were inoculated onto a fresh PDA plate medium and cultured at a constant temperature of 30°C for 54 h. 10 mL of a 50 g / L sterile sucrose aqueous solution was added to the petri dish, and the spores were suspended by stirring with an inoculation loop. The spore suspension was transferred to a sterile test tube, and the spore concentration was adjusted to 8.35×10 6 CFU / mL with a 50 g / L sterile sucrose aqueous solution to obtain a spore suspension of Rhizopus arrhizus AS7-34. The composition and preparation method of the PDA plate medium were the same as those in Example 1; the sterile sucrose aqueous solution was sterilized by high-pressure steam at 121°C for 15 min.

[0069] (2) 25 g of angelica powder was placed in a 250-mL Erlenmeyer flask that had been dry-heat sterilized at 160°C for 2 h, and then 30 mL of the spore suspension of Rhizopus arrhizus AS7-34 prepared in step (1) was added and stirred evenly. The Erlenmeyer flask was sealed with eight layers of gauze and cultured at 30°C for 66 h to obtain an angelica fermented product.

[0070] (3) All of the angelica fermented product from step (2) was transferred to a 1-L Erlenmeyer flask, 450 mL of deionized water (the material-liquid ratio was 1:18) was added, and after shaking evenly, it was incubated in a water bath at 32.5°C for 5 h. Then, the Erlenmeyer flask was transferred to an ultrasonic cleaner with a water temperature of 85°C and extracted by ultrasound at 150 W for 50 min. Then, the pH was adjusted to 9.5 with a saturated Ca(OH)2 aqueous solution, and it was filtered by suction with a Buchner funnel while it was hot. The filtrate was adjusted to pH 4.5 with acetic acid and filtered by suction again with a Buchner funnel. All of the filtrate was concentrated under reduced pressure to 40 mL at 60°C and -0.1 MPa to obtain a concentrated solution.

[0071] (4) To all of the concentrated solution obtained in step (3), 150 mL of 95% ethanol (the ethanol volume fraction of the solution was 75%) was added. After standing at 4°C for 14 h, it was centrifuged at 8000 r / min for 10 min, and the supernatant was discarded. It was washed once with 50 mL of 95% ethanol, centrifuged again, and the precipitate was dried to a constant weight at 50°C and -0.1 Mpa under vacuum and ground into a fine powder to obtain an angelica polysaccharide extract.

[0072] According to the above steps, 5.49 g of a polysaccharide extract was obtained from 25 g of angelica. The polysaccharide content was 63.2%, that is, 3.47 g of angelica polysaccharide was obtained, and the extraction yield was 13.9%. The product was an off-white powder.

[0073] Example 6: Application of Rhizopus arrhizus AS7-34 in the extraction of angelica polysaccharide

[0074] The application of Rhizopus arrhizus AS7-34 in the extraction of angelica polysaccharide can be operated according to the following steps:

[0075] (1) Spores of Rhizopus arrhizus AS7-34 stored at 4°C on a PDA plate were inoculated onto a fresh PDA plate medium and incubated at 30°C for 48 h. 10 mL of a 60 g / L sterile sucrose aqueous solution was added to the petri dish, and the spores were suspended by stirring with an inoculation loop. The spore suspension was transferred to a sterile test tube, and the spore concentration was adjusted to 7.85×10 6 cells / mL with a sterile 60 g / L sucrose aqueous solution. The composition and preparation method of the PDA plate medium were the same as in Example 1; the sterile sucrose aqueous solution was sterilized at 121°C for 15 min by high-pressure steam.

[0076] (2) 25 g of angelica powder was placed in a 250-mL Erlenmeyer flask that had been sterilized by dry heat at 160°C for 2 h, and 40 mL of the spore suspension of Rhizopus arrhizus AS7-34 prepared in step (1) was added and stirred evenly. The Erlenmeyer flask was sealed with eight layers of gauze and incubated at 30°C for 60 h to obtain an angelica fermented product.

[0077] (3) All of the angelica fermented product from step (2) was transferred to a 1-L Erlenmeyer flask, 500 mL of deionized water (the solid-liquid ratio was 1:20) was added, and after shaking evenly, it was kept warm in a 35°C water bath for 4 h. Then, the Erlenmeyer flask was transferred to an ultrasonic cleaner with a water temperature of 85°C and ultrasonically extracted at 200 W for 40 min. Then, the pH was adjusted to 10.0 with a saturated Ca(OH)2 aqueous solution, and it was filtered while hot with a Buchner funnel. The filtrate was adjusted to pH 4.0 with acetic acid and filtered again with a Buchner funnel. All of the filtrate was concentrated under reduced pressure to 40 mL at 60°C and -0.1 MPa to obtain a concentrated solution.

[0078] (4) To all of the concentrated solution obtained in step (3), 150 mL of 95% ethanol (the ethanol volume fraction of the solution was 75%) was added. After standing at 4°C for 16 h, it was centrifuged at 8000 r / min for 10 min, and the supernatant was discarded. It was washed once with 50 mL of 95% ethanol and centrifuged again. The precipitate was dried to a constant weight at 50°C and -0.1 Mpa under vacuum and ground into a fine powder to obtain an angelica polysaccharide extract.

[0079] According to the above steps, 5.46 g of a polysaccharide extract was obtained from 25 g of angelica. The polysaccharide content was 67.6%, that is, 3.69 g of angelica polysaccharide was obtained, and the extraction yield was 14.8%. The product was an off-white powder.

[0080] Comparative Example 1: Extraction of angelica polysaccharide by the conventional water extraction and alcohol precipitation method

[0081] (1) 25 g of angelica powder was placed in a 1-L Erlenmeyer flask, and 500 mL of deionized water was added (the material-liquid ratio was 1:20). After shaking evenly, it was placed in a water bath at 35 °C for 4 h. Then, the Erlenmeyer flask was transferred to an ultrasonic cleaner with a water temperature of 85 °C, and ultrasonic extraction was carried out at 200 W for 40 min. Then, the pH was adjusted to 10.0 with saturated Ca(OH)₂ aqueous solution, and it was filtered by Buchner funnel while it was hot. The filtrate was adjusted to pH 5.0 with acetic acid, and all the filtrate was concentrated under reduced pressure to 40 mL at 60 °C and -0.1 MPa to obtain a concentrated solution.

[0082] (2) To all the concentrated solution obtained in step (1), 150 mL of 95% ethanol was added (the volume fraction of ethanol in the solution was 75%). After standing at 4 °C for 16 h, it was centrifuged at 8000 r / min for 10 min, and the supernatant was discarded. It was washed once with 50 mL of 95% ethanol and centrifuged again. The precipitate was dried to a constant weight at 50 °C and -0.1 Mpa under vacuum and ground into fine powder to obtain the angelica polysaccharide extract.

[0083] According to the above steps, 4.15 g of polysaccharide extract was obtained from 25 g of angelica. The polysaccharide content was 61.9%, that is, 2.57 g of angelica polysaccharide was obtained, and the extraction yield was 10.3%.

[0084] Comparing the results of Example 6 and Comparative Example 1, it can be seen that: before ultrasonic water extraction of polysaccharides from angelica, the fermentation pretreatment with Rhizopus arrhizus AS7-34 was added, and the extraction yield of polysaccharides reached 14.8%. Compared with the 10.3% obtained by the conventional method without fermentation pretreatment, it increased by 43.7%.

Claims

1. Rhizopus arrhizus AS7-34, deposited in the Guangdong Microbial Culture Collection Center, deposit number: GDMCC No: 62601, deposit date: July 6, 2022, address: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Guangdong Province; Postcode 510070.

2. Use of Rhizopus arrhizus AS7-34 described in claim 1 in the extraction of Angelica polysaccharide, characterized in that, The method of the application is as follows: (1) Add the spore solution of Rhizopus arrhizus AS7-34 to angelica powder, stir evenly, and ferment at 28-30°C for 60-72h to obtain angelica fermented product; (2) Add deionized water to the angelica fermented product, shake evenly, keep warm at 30-35°C for 4-6h, concentrate after ultrasonic water extraction, and obtain concentrated angelica water extract; (3) Then add ethanol to the concentrated angelica water extract to precipitate polysaccharides, and after washing and drying the precipitate with ethanol, obtain angelica polysaccharide extract.

3. The application according to claim 2, wherein The angelica powder described in step (1) is obtained by naturally drying or drying at 80°C the traditional Chinese medicine angelica, pulverizing it, and sieving it through a 40-mesh sieve.

4. The application according to claim 2, wherein The preparation method of the spore solution of Rhizopus arrhizus AS7-34 described in step (1) is: inoculate the spores of Rhizopus arrhizus AS7-34 stored at low temperature on a PDA plate medium, culture at a constant temperature of 28-30°C for 48-60h, then add a sterile sucrose aqueous solution with a concentration of 40-60g / L to the culture, stir with an inoculation loop to suspend the spores, and obtain a spore solution; the final concentration composition of the PDA plate medium is: 200g / L of potato, 20g / L of glucose, 20g / L of agar, the solvent is tap water, and the pH is natural.

5. The application according to claim 2, characterized in that The volume dosage of the spore solution of Rhizopus arrhizus AS7-34 added to the angelica powder in step (1) is 1.0-1.6mL / g based on the mass of the angelica powder.

6. The application according to claim 2, wherein The volume addition amount of deionized water to the angelica fermented product in step (2) is 15-20mL / g based on the mass of the raw material angelica powder in step (1).

7. The application according to claim 2, characterized in that The method of ultrasonic water extraction in step (2) is: in an ultrasonic cleaner at 80-85°C, extract with ultrasound at 100-200W for 40-60min, then adjust the pH to 9.0-10.0 with a saturated Ca(OH)2 aqueous solution, filter with a Buchner funnel, adjust the pH of the collected filtrate to 4.0-5.0 with acetic acid, filter again with a Buchner funnel, and concentrate the filtrate.

8. The application according to claim 7, characterized in that The filtrate concentration condition is to concentrate the filtrate under reduced pressure at 60°C and -0.1MPa to 1 / 15-1 / 10 of the original volume to obtain concentrated angelica water extract.

9. The application according to claim 2, characterized in that, The preparation method of the angelica polysaccharide in step (3) is: add ethanol with a volume fraction of 95% to the concentrated angelica water extract to make the ethanol volume fraction of the solution reach 70%-75%, let it stand at 4°C for 12-16h, centrifuge at 8000r / min for 5-10min, discard the supernatant, add ethanol with a volume fraction of 95% to wash once, centrifuge again, and dry the precipitate at 50°C and -0.1Mpa in vacuum to constant weight to obtain angelica polysaccharide extract.

Images