A Cre recombinase regulation system and its application

Abstract

The present invention discloses a Cre recombinase regulatory system and its application, wherein the Cre recombinase regulatory system includes the ER50 gene. The present invention constructs a Cre recombinase regulatory system by introducing 4OHT to induce degradation of the protein ER50. In the Cre recombinase regulatory system constructed by the present invention, 4OHT achieves more stringent regulation of the functional gene Cre through dual regulation of ER50 and ERT2, reducing background issues in the Cre system. The application of this system will enable more rigorous spatiotemporal regulation of gene expression in cells and animals in the future, providing a more reliable research tool for conditional gene knockout in cells and animals.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a Cre recombinase regulation system and applications thereof. Background Art

[0002] Conditional gene knockout (CKO) is a new method for studying gene gain of function. It restricts the expression of a gene to specific cell tissues or developmental stages, thereby achieving spatiotemporal specific modification of the mouse genome. CKO technology mainly uses specific recombinase systems such as the Cre-LoxP system and the FLP-Frt system to achieve spatiotemporal specific gene knockout. Among them, the Cre-LoxP system is the most widely used conditional gene knockout system, which achieves gene editing by combining the Cre recombinase system with an inducible gene expression control system. By inserting the LoxP sequence at both ends of the target gene DNA sequence, mutant mice containing two LoxP sites can be obtained. When these mice are crossed with Cre recombinase mice, striped gene knockout mice can be obtained. This mouse model is an important tool for genetic research.

[0003] Traditional gene knockout techniques, which ablate the entire target gene within the organism, offer significant advantages for studying gene function, but they also present significant drawbacks. These include developmental defects or early embryonic lethality resulting from gene knockout, which can hinder further investigation. Furthermore, the complexity of knockout effects across multiple tissues can hinder the identification of the precise site of action and function of the target gene, making it difficult to analyze its actual function later in development. In contrast, conditional gene knockout offers spatiotemporal controllability, enabling the conditional ablation of target genes in specific locations within the body under the influence of inducers or genes. This overcomes the challenges of embryonic lethality or abnormal growth and development that can occur after complete gene ablation. The use of versatile knockout models in conjunction with various mouse models allows for comprehensive investigation of the effects of target genes on growth and development, disease development, and therapeutic effects and mechanisms across diverse tissues and organs. This overcomes the limitations of previous gene editing techniques and provides a superior model for exploring gene function and pathogenic mechanisms.

[0004] Thanks to the rapid development of molecular biology and the continuous advancement of life science research technologies, gene knockout technology has been widely used in basic experimental research and is closely related to human life. As a new molecular biology technique, gene knockout uses DNA recombination principles to edit gene fragments to inactivate or delete target genes within the body. The Cre-LoxP system, as a highly efficient and specific recombinase technology, meets the growing demand for in vivo gene function studies by regulating gene expression at specific locations and time periods. It can induce target gene inactivation at specific developmental stages or in specific tissues and cells, enabling conditional gene editing. This avoids the risks of early embryonic lethality and complex gene expression caused by target gene deletion. The Cre recombinase system overcomes the specific operational challenges encountered in the development of gene editing technology. By deleting and screening target genes, comprehensive analysis of their function is facilitated, facilitating in-depth research on functional and disease-causing genes. International efforts in animal transgenics have achieved significant success, and Cre-LoxP conditional knockout mice have become the preferred choice for many basic research studies due to their excellent experimental performance. It provides key technical support for the establishment of human animal disease models, identification of gene functions, viral pathogenesis and antiviral immunity research.

[0005] The Cre recombinase regulatory system is an important means of achieving specific target gene knockout and a key genetic manipulation tool for studying gene expression in specific tissues and at specific times. Currently, the most widely used Cre-loxP recombination regulatory systems are Cre-ERT2 (CE) or ERT2-Cre-ERT2 (ECE). In the absence of 4-hydroxytamoxifen (4OHT), the fusion protein consisting of Cre recombinase and estrogen receptor remains in the cytoplasm and does not recombine with genomic LoxP site sequences. However, in cells with 4OHT, Cre recombinase enters the nucleus, recognizes LoxP sites, and undergoes recombination. However, the Cre-loxP recombination regulatory system suffers from problems such as loose Cre recombinase regulation, unclear specific targeting, and low efficiency. Summary of the Invention

[0006] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes a Cre recombinase regulation system.

[0007] The present invention also proposes the application of the Cre recombinase regulatory system.

[0008] According to a first aspect of the present invention, a Cre recombinase regulatory system is provided, wherein the Cre recombinase regulatory system includes the ER50 gene.

[0009] In some embodiments of the present invention, the nucleotide sequence of the ER50 gene is shown as SEQ ID NO.1.

[0010] In some embodiments of the present invention, the Cre recombinase regulatory system is a stringent Cre recombinase regulatory system.

[0011] In some embodiments of the present invention, the Cre recombinase regulatory system further includes the ERT2 gene.

[0012] In some embodiments of the present invention, the Cre recombinase regulatory system includes the following functional elements in sequence: an inducible promoter, ER50, a nucleotide sequence of the Cre recombinase, ERT2, and an sgRNA sequence, wherein the ERT2 sequence and the Cre recombinase sequence are interchangeable; the sgRNA sequence targets the target gene.

[0013] In some embodiments of the present invention, the Cre recombinase regulatory system includes the following functional elements in sequence: an inducible promoter, ER50, ERT2, Cre recombinase, ERT2, and an sgRNA sequence, wherein the ERT2 sequence and the Cre recombinase sequence are interchangeable; the sgRNA sequence targets the target gene.

[0014] In some embodiments of the present invention, the inducible promoter comprises EFS promoter, Mx1 or TRE promoter.

[0015] In some embodiments of the present invention, the inducible promoter further includes a fluorescent gene.

[0016] In some embodiments of the present invention, the fluorescent sequence is the EGFP gene.

[0017] In some embodiments of the present invention, the nucleotide sequence of ERT2 is shown as SEQ ID NO.2.

[0018] In some embodiments of the present invention, the Cre recombinase includes Escherichia virus P1 Cre recombinase, Sphingomonas sp. ERG5 Cre recombinase or Salmonella phage SJ46 Cre recombinase.

[0019] In some embodiments of the present invention, the coding sequence of the Cre recombinase is shown as SEQ ID NO.3.

[0020] In some embodiments of the present invention, the sgRNA sequence further includes a constitutive promoter, and the constitutive promoter includes CMV, MSCV or U6 promoter.

[0021] In some embodiments of the present invention, the sgRNA sequence is an sgRNA sequence targeting the p53 gene and / or the RB1 gene.

[0022] In some embodiments of the present invention, the sgRNA sequence targeting the p53 gene is shown as SEQ ID NO.4.

[0023] In some embodiments of the present invention, the sgRNA sequence targeting the RB1 gene is shown as SEQ ID NO.5.

[0024] According to a second aspect of the present invention, a cell containing the above-mentioned Cre recombinase regulatory system is provided.

[0025] In some embodiments of the invention, the cells include human cells, non-human mammalian cells, and stem cells.

[0026] In some embodiments of the invention, the non-human mammalian cells include mouse cells.

[0027] According to a third aspect of the present invention, a kit containing the above-mentioned Cre recombinase regulatory system is provided.

[0028] According to a fourth aspect of the present invention, applications of the above-mentioned Cre recombinase regulatory system, cells, drugs and kits are provided, wherein the applications are applications in preparing products for modifying genes or regulating gene expression.

[0029] In some embodiments of the invention, the product comprises a pharmaceutical product.

[0030] In some embodiments of the present invention, the application is application in preparing a drug regulation system.

[0031] In some embodiments of the present invention, the application is application in preparing a gene knockout research tool.

[0032] In some embodiments of the present invention, the gene knockout research tool is a gene knockout research tool that can be used for CRISPR / CAS9.

[0033] According to some embodiments of the present invention, at least the following beneficial effects are achieved: The present invention constructs a Cre recombinase regulatory system by introducing 4OHT to induce degradation of the protein ER50. In this Cre recombinase regulatory system, 4OHT achieves stricter regulation of the functional gene Cre through dual regulation of ER50 and ERT2, reducing background issues in the Cre system. The application of this system will enable more rigorous spatiotemporal regulation of gene expression in cells and animals in the future, providing a more reliable research tool for conditional gene knockout in cells and animals. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] The present invention will be further described below with reference to the accompanying drawings and embodiments, in which:

[0035] Figure 1 Schematic diagram of the vector of the Cre recombinase regulatory system in the test example of the present invention;

[0036] Figure 2 This is a graph showing the results of EGFP fluorescence localization detection in a test example of the present invention;

[0037] Figure 3 Schematic diagram of the PB-CMV-L-Cherry-L-EGFP vector in the test example of the present invention;

[0038] Figure 4 This is a graph showing the results of the fluorescent reporter cell expression test in the test example of the present invention;

[0039] Figure 5 This is a morphological diagram of LRLG monoclonal cells in a test example of the present invention;

[0040] Figure 6 Schematic diagram of the carrier structure in the test example of the present invention;

[0041] Figure 7 This is a diagram showing the working principle of the Cre recombination system reporter cell in the test example of the present invention;

[0042] Figure 8 This is a flow cytometry test result diagram in a test example of the present invention;

[0043] Figure 9 This is a diagram showing the working principle of the red fluorescent gene editing tool mouse in the test example of the present invention;

[0044] Figure 10 Schematic diagram of the carrier structure in the test example of the present invention;

[0045] Figure 11 The graph shows the expression results of tdTomato after electroporation of mNSCs with different combinations in the test examples of the present invention;

[0046] Figure 12 Graph showing the expression results of tdTomato after electroporation of MEFs with different combinations in the test examples of the present invention. DETAILED DESCRIPTION

[0047] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0048] The plasmids in Examples 1-21 of the present invention were all obtained by gene synthesis by Jinweizhi Biotechnology Co., Ltd.

[0049] Example 1

[0050] In this example, a Cre recombinase regulatory system, designated plasmid PB-EFS-GC, was prepared. The original vector was the PB vector (a piggybac transposon vector, kindly provided by Lai Liangxue's research group at the Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences). The EFS-GC sequence, consisting of the EFS promoter, green fluorescent protein (EGFP), and Cre recombinase, was obtained by gene synthesis (Jinweizhi Biotechnology Co., Ltd.) and inserted into the transposable element of the PB vector by enzyme ligation.

[0051] EFS promoter sequence:

[0052] GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG (SEQ ID NO. 6).

[0053] EGFP gene nucleotide sequence:

[0054] ATGGTAAGCAAAGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG(SEQ ID NO.: 22).

[0055] Nucleotide sequence of CRE recombinase:

[0056]

[0057] Example 2

[0058] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-GCE, which includes the EFS promoter, green fluorescent protein EGFP, Cre recombinase, and estrogen receptor (ER) ligand binding domain mutant (ERT2) connected in sequence.

[0059] Nucleotide sequence of ERT2:

[0060] GCTGGAGACATGAGAGCTGCCAACCTTTGGCCAAGCCCGCTCATGATCAAACGCTCTAAGAAGAACAGCCTGGCCTTGTCCCTGACGGCCGACCAGATGGTCAGTGCCTTGTTGGATGCTGAGCCCCCCATACTCTATTCCGAGTATGATCCTACCAGACCCTTCAGTGAAGCTTCGATGATGGGCTTACTGACCAACCTGGCAGACAGGGAGCTGGTTCACATGATCAACTGGGCGAAGAGGGTGCCAGGCTTTGTGGATTTGACCCTCCATGATCAGGTCCACCTTCTAGAATGTGCCTGGCTAGAGATCCTGATGATTGGTCTCGTCTGGCGCTCCATGGAGCACCCAGTGAAGCTACTGTTTGCTCCTAACTTGCTCTTGGACAGGAACCAGGGAAAATGTGTAGAGGGCATGGTGGAGATCTTCGACATGCTGCTGGCTACATCATCTCGGTTCCGCATGATGAATCTGCAGGGAGAGGAGTTTGTGTGCCTCAAATCTATTATTTTGCTTAATTCTGGAGTGTACACATTTCTGTCCAGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTGGAGGCGGCGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGCGGGCTCTACTTCATCGCATTCCTTGCAAAAGTATTACATCACGGGGGAGGCAGAGGGTTTCCCTGCCACA(SEQ ID NO.2).

[0061] Gene sequence (EGFP to ERT nucleotide sequence):

[0062]

[0063] Example 3

[0064] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-GECE, which includes the EFS promoter, green fluorescent protein EGFP, ERT2, Cre recombinase and ERT2 connected in sequence.

[0065] Gene sequence (EGFP to ERT2 nucleotide sequence):

[0066]

[0067] Example 4

[0068] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-50GC, which includes an EFS promoter, an estrogen receptor (ER50), a green fluorescent protein (EGFP), and a Cre recombinase linked in sequence.

[0069] Nucleotide sequence of ER50:

[0070] (SEQ ID NO. 1).

[0071] From ER50 to Cre nucleotide sequence:

[0072]

[0073] Example 5

[0074] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-50GCE, which includes the EFS promoter, estrogen receptor (ER50), green fluorescent protein EGFP, Cre recombinase and ERT2 connected in sequence.

[0075] From ER50 to ERT2 nucleotide sequence:

[0076]

[0077] Example 6

[0078] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-50GECE, which includes the EFS promoter, estrogen receptor (ER50), green fluorescent protein EGFP, ERT2, Cre recombinase and ERT2 connected in sequence.

[0079] From ER50 to ERT2 nucleotide sequence:

[0080]

[0081] Example 7

[0082] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-50ECE, which includes the EFS promoter, estrogen receptor (ER50), ERT2, Cre recombinase and ERT2 connected in sequence.

[0083] From ER50 to ERT2 nucleotide sequence:

[0084]

[0085] Example 8

[0086] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-C, which includes an EFS promoter and a Cre recombinase connected in sequence.

[0087] Example 9

[0088] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-CE, which includes the EFS promoter, Cre recombinase, and the ligand binding domain mutant (ERT2) of the estrogen receptor (ER50) connected in sequence.

[0089] From Cre recombinase to ERT2 nucleotide sequence:

[0090]

[0091] Example 10

[0092] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-ECE, which includes the EFS promoter, ERT2, Cre recombinase and ERT2 connected in sequence.

[0093] From ERT2 to ERT2 nucleotide sequence:

[0094]

[0095] Example 11

[0096] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-50C, which includes an EFS promoter, an estrogen receptor (ER50), and a Cre recombinase linked in sequence.

[0097] From ER50 to Cre recombinase nucleotide sequence:

[0098]

[0099] Example 12

[0100] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-50CE, which includes the EFS promoter, estrogen receptor (ER50), Cre recombinase and ERT2 connected in sequence.

[0101] From ER50 to ERT2 nucleotide sequence:

[0102]

[0103] Example 13

[0104] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-50C50, which includes the EFS promoter, estrogen receptor (ER50), Cre recombinase and ER50 connected in sequence.

[0105] From ER50 to ER50 nucleotide sequence:

[0106]

[0107] Example 14

[0108] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-50EC50, which includes the EFS promoter, estrogen receptor (ER50), ERT2, Cre recombinase and ER50 connected in sequence.

[0109] From ER50 to ER50 nucleotide sequence:

[0110]

[0111] Example 15

[0112] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-T50ECE, which includes the EFS promoter, estrogen receptor (T50) with three point mutations (G96V / M239A / L240A), ERT2, Cre recombinase, and T50 connected in sequence.

[0113] From T50 to T50 nucleotide sequence:

[0114]

[0115] Example 16

[0116] In this example, a Cre recombinase regulatory system was prepared, named plasmid PB-EFS-T50ECT50, which includes the EFS promoter, T50, ERT2, Cre recombinase and T50 connected in sequence.

[0117] From T50 to T50 nucleotide sequence:

[0118]

[0119] Example 17

[0120] In this example, a Cre recombinase regulatory system was prepared, named plasmid px601-EFS-C-gP53.RB1, based on the plasmid px601 purchased from Ubao Biotechnology Co., Ltd. (Addgene), including the EFS promoter, Cre recombinase, U6 promoter, and gRNA targeting P53 and RB1 genes connected in sequence.

[0121] P53 gRNA: 5'-GAAAATGTCTCCTGGCTC-3' (SEQ ID NO. 4).

[0122] RB1 gRNA: 5'-GGCCCCGAAGAGCTGCCCC-3' (SEQ ID NO. 5).

[0123] Example 18

[0124] In this example, a Cre recombinase regulatory system was prepared, named plasmid px601-EFS-50C-gP53.RB1, which includes the EFS promoter, ER50, Cre recombinase, U6 promoter and gRNA targeting P53 and RB1 genes connected in sequence.

[0125] Example 19

[0126] In this example, a Cre recombinase regulatory system was prepared, named plasmid px601-EFS-CE-gP53.RB1, which includes the EFS promoter, Cre recombinase, ERT2, U6 promoter and gRNA targeting P53 and RB1 genes connected in sequence.

[0127] Example 20

[0128] In this example, a Cre recombinase regulatory system was prepared, named plasmid px601-EFS-ECE-gP53.RB1, which includes the EFS promoter, ERT2, Cre recombinase, ERT2, U6 promoter and gRNA targeting P53 and RB1 genes connected in sequence.

[0129] Example 21

[0130] In this example, a Cre recombinase regulatory system was prepared, named plasmid px601-EFS-50ECE-gP53.RB1, which includes the EFS promoter, ER50, ERT2, Cre recombinase, ERT2, U6 promoter and gRNA targeting P53 and RB1 genes connected in sequence.

[0131] Test Case

[0132] 1. Detection of Cre expression and localization of Cre recombinase regulatory system under 4OHT conditions

[0133] The vector diagram of the Cre recombinase regulatory system constructed in Examples 1-6 is shown in FIG. Figure 1 The Cre recombinase regulatory system, with and without 4OHT, showed Cre expression and localization as follows:

[0134] Cell transfection:

[0135] (1) HEK 293T cells were cultured until the cell confluence reached 70%-80%.

[0136] (2) Using Opti-MEM TM The plasmid DNA (the Cre recombinase regulatory system prepared in Examples 1-6) and Lipofectamine were diluted in the culture medium. TM 8000 reagent, use a gun to gently blow to mix, be careful not to vortex or centrifuge. TM Culture medium and Lipofectamine TM The mass-to-volume ratio of 8000 reagent is 0.1 μg:5 μL:0.16 μL.

[0137] (3) Each well of the 96-well plate containing cells was replaced with 130 μL of fresh culture medium, and DNA-lipid complexes were added to HEK 293T cells. 4OHT was added and not added sequentially for 3 consecutive days. The cells were then placed under laser confocal microscopy for observation and photography.

[0138] The results are as follows Figure 2As shown in the figure, in the absence of the small molecule drug 4OHT, green fluorescent protein is primarily located in the cytoplasm. Compared to cells without the ER50 fusion protein, the cytoplasmic EGFP fluorescence is weaker in cells containing the ER50 fusion protein. In cells with 4OHT, green fluorescent protein is primarily located in the nucleus. This indicates that in the absence of the small molecule drug 4OHT, the fusion protein consisting of Cre recombinase and estrogen receptor is localized in the cytoplasm. Containing the estrogen receptor (ER50), these largely unfolded domains fused to the transcription factor target the fusion protein for rapid proteasomal degradation. In other words, in the absence of 4OHT, green fluorescent protein is primarily located in the cytoplasm. Compared to cells without the ER50 fusion protein, the cytoplasmic EGFP fluorescence is weaker in cells containing the ER50 fusion protein. In cells with 4OHT, the fusion Cre protein undergoes conformational changes, dissociates from the anchoring protein HSP90, enters the nucleus, recognizes the loxP sites, and undergoes recombination. In this way, by controlling the time of adding 4OHT, the time-specific regulation of gene recombination can be achieved.

[0139] 2. Verification of the rigor of Cre recombinase regulation system to control LoxP

[0140] (1) Construction of reporter cells for Cre recombinase function verification

[0141] 1) Construction of reporter vector

[0142] By designing the reporter vector PB-CMV-L-Cherry-L-EGFP, the structure of the plasmid is as follows Figure 3 The plasmid PB-CMV-L-Cherry-L-EGFP is based on the PB transposon and includes a T7 promoter, a CMV enhancer, a CMV promoter, a loxP site, a red fluorescent protein mCherry, a BGH poly(A) signal, a loxP site, a green fluorescent protein EGFP, and an SV40 poly(A) signal.

[0143] The nucleotide sequence from the T7 promoter to EGFP is as follows:

[0144]

[0145] 2) Cell transfection

[0146] ① Culture HEK 293T cells until the cell confluence reaches 70%-90%.

[0147] ②Use Opti-MEM TM Dilute Lipofectamine in culture medium TM 3000 reagents to obtain Lipofectamine TM 3000 dilution. Opti-MEM TM Culture medium and Lipofectamine TM The volume ratio of 3000 reagent is 25:1.

[0148] ③Use Opti-MEM TM The reporter vector (PB-CMV-L-Cherry-L-EGFP) and transposase were diluted in culture medium to obtain a DNA premix. P3000 was then added to the DNA premix. TM Reagents were added to obtain DNA transfection solution.

[0149] The mass ratio of the reporter vector to the transposase was 2:1, and the DNA premix was mixed with P3000. TM The mass volume ratio of the reagent is 0.5 μg:1 μL.

[0150] ④Lipofectamine TM Mix the 3000 dilution with the DNA transfection solution and incubate at room temperature for 10-15 minutes to obtain a DNA-lipid complex.

[0151] ⑤ Add DNA-lipid complex to HEK 293T cells, place the transfected cells in the incubator and continue to observe and culture. 24 hours after transfection, the cell expression is as follows: Figure 4 shown.

[0152] 3) Cell passaging

[0153] ① Remove the old culture medium, add 0.05% trypsin, digest at 37℃ for 3 min, add 500 μL culture medium to terminate the digestion, pipette to mix well and transfer to a 1.5 mL centrifuge tube.

[0154] ② Centrifuge at 1000 rpm for 5 minutes and remove the supernatant.

[0155] ③ Add 300 μL of culture medium, use a pipette to mix evenly, and blow into a cell suspension.

[0156] ④ Take 10 μL of cell suspension and transfer it to a 10 cm culture dish. Place it in a 37°C, 5% CO2 incubator for culture. Observe the cell morphology every day and select single clones after about one week.

[0157] 4) Monoclonal selection

[0158] After about one week of cell culture, cell clones were observed under a microscope. The clones with smooth outer edges, normal cell morphology, good growth and uniform red fluorescence expression were selected. Figure 5 shown.

[0159] The specific steps are as follows:

[0160] ① In a 24-well plate, add culture medium containing double antibodies and 10% fetal bovine serum (FBS) to each well.

[0161] ② Under a microscope, use a 10μL pipette to scrape the clones and transfer them to the 24-well plate prepared in step ①.

[0162] ③ Place the 24-well plate in a constant temperature incubator at 37°C and 5% CO2 for culture.

[0163] 5) Expand training

[0164] After the cells in the 24-well plate were observed to be fully grown (coverage rate reached 80%), the cells were digested, centrifuged, resuspended, and transferred to a 6-well plate for expansion culture to obtain a stable genetic cell line for use, referred to as the LRLG cell line.

[0165] A reporter vector, PB-CMV-L-Cherry-L-EGFP, was constructed and transfected into 293T cells. Single clones were screened and cultured to generate a reporter cell line (LRLG cell line) that stably expressed red fluorescence. Optimized vectors combining estrogen receptors ERT2 and ER50 were constructed and transfected into the selected stably expressing LRLG cell line. Cells were then divided into drug-treated and non-drug-treated groups for continued culture to verify the effectiveness of the Cre recombinase regulatory system.

[0166] (2) Verification of the Cre recombinase regulatory system

[0167] The vector diagram of the Cre recombinase regulatory system constructed in Examples 7-16 is shown in FIG. Figure 6 As shown, the Cre recombinase regulatory system constructed in Example 7-16 was integrated with the reporter vector pCMV-loxP-mCherry-loxP-EGFP into the Cre recombinase reporter cell. Figure 7As shown, in the absence of the small molecule drug 4-hydroxytamoxifen (4OHT), the cells only emit red fluorescence and do not activate the expression of the EGFP gene. In the presence of the small molecule drug 4-hydroxytamoxifen (4OHT), the sequence between the two LoxP sites in the same direction (mCherry and terminator sequence) is effectively removed by the Cre recombinase, thereby activating the expression of the EGFP gene. The specific verification process is as follows:

[0168] 1) Cell transfection

[0169] ① Culture LRLG cells until the cell confluence reaches 70%-80%.

[0170] ②Use Opti-MEM TM Dilute the plasmid DNA (respectively, the Cre recombinase regulatory system constructed in Examples 7-16) and Lipofectamine TM 8000 reagent, use a gun to gently blow to mix, be careful not to vortex or centrifuge. TM Culture medium and Lipofectamine TM The mass-to-volume ratio of 8000 reagent is 0.25 μg:12.5 μL:0.4 μL.

[0171] ③ Replace each well of the 48-well plate containing cells with 200 μL of fresh culture medium, add DNA-lipid complexes to HEK 293T cells, and add or not add different concentrations of 4OHT (0, 0.1, 0.5, 2.5, 10, 50, 200, 1000 nM, respectively).

[0172] 2) Flow cytometry

[0173] Different concentrations of 4OHT were added or not for 3 days, and the cells were photographed under a microscope and collected for flow cytometry verification. The results are as follows Figure 8 As shown in the figure, it can be seen that in the Cre recombination system reporter cells integrated with the reporter vector pCMV-loxP-mCherry-loxP-EGFP, by adjusting the 4OHT dose, the upregulation of EGFP, that is, the ratio of red fluorescence to green fluorescence, can be controlled within a similar range.

[0174] 3. Cre recombinase regulatory system in vivo Cre regulation in animals under 4OHT conditions

[0175] The schematic diagram of the working principle of the Cre recombinase regulatory system in regulating Cre verification experiments in animals under 4OHT conditions is shown in the figure. Figure 9As shown, specifically as follows: Rosa26-LsL-cas9-tdTomato is a red fluorescent gene editing tool mouse (purchased from Jicui Yaokang Biotechnology Co., Ltd.). After mating with a strain that expresses Cre recombinase systemically or tissue-specifically, the stop element will be deleted in cells expressing Cre, turning on the expression of Cas9 and tdTomato. Mouse neural stem cells (mNSC) and mouse fibroblasts (MEF) were isolated from the tool mice, and the Cre recombinase regulatory system constructed in Examples 17-21 (schematic diagram as shown) was respectively inserted into the mouse. Figure 10 The results are shown in Figure 2. The results were electroporated into two cell lines. In the presence of the small molecule drug 4-hydroxytamoxifen (4OHT), the stop element was deleted in cells expressing Cre, thereby initiating the expression of Cas9 and tdTomato. The specific verification experiments are as follows:

[0176] (1) Isolation of primary mNSC and MEF cells

[0177] 1) Isolation of mouse neural stem cells (mNSCs)

[0178] ① LSL-Cas9-tdTomato mice at 13.5 days of gestation were sacrificed by cervical dislocation and disinfected by soaking in a beaker of 75% ethanol.

[0179] ② In a clean bench, remove the fetus and soak it in 75% ethanol and PBS multiple times. Dissect the head by cervical dissection, and sequentially remove the scalp, skull, meninges, and blood vessels to isolate the cerebral hemispheres. Mince the hemispheres with ophthalmic scissors and collect them in a 6-cm dish. Digest the hemispheres in 0.25% trypsin-EDTA at 37°C for 10 minutes. Terminate the digestion by adding culture medium containing 10% fetal bovine serum. Gently pipette 15 times with a 5-mL pipette to create a suspension.

[0180] ③ Transfer the suspension to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 min. Discard the supernatant and add neural stem cell culture medium (the culture medium formula is shown in Table 1) to resuspend the pellet. Inoculate the pellet into a 6 cm dish at an appropriate cell concentration and culture in a cell culture incubator with a volume fraction of 5% CO2 and 37°C.

[0181] Table 1 Mouse neural stem cell culture medium

[0182]

[0183] 2) Isolation of mouse fibroblasts (MEFs)

[0184] ① LSL-Cas9-tdTomato mice at 13.5 days of gestation were sacrificed by cervical dislocation and disinfected by soaking in a beaker of 75% ethanol.

[0185] ② Take the fetal mouse from the clean bench and soak it in 75% ethanol and PBS multiple times. Take the back skin and soak it in 75% ethanol for disinfection. Rinse the skin with PBS, cut the skin into pieces, and evenly spread it on a sterile 10 cm plate. Then add 0.25% trypsin-EDTA and digest it at 37°C for 15 minutes. Add DMEM medium containing 10% fetal bovine serum to terminate the digestion, and use a 5 mL pipette to gently pipette 15 times to obtain a suspension.

[0186] ③ Transfer the suspension to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 min. Discard the supernatant and resuspend the pellet in DMEM medium containing 10% fetal bovine serum. Inoculate the pellet into a 10 cm dish at an appropriate cell concentration and culture in a cell culture incubator with a volume fraction of 5% CO2 and 37°C.

[0187] (2) In vivo regulation of Cre by different combinations in mNSCs with and without 4OHT

[0188] Electroporation of mNSCs:

[0189] 1) Collect mNSC cells with a cell confluence rate of 70-90%, remove the culture medium, wash the cells twice with DPBS, discard the solution, add accutase, and incubate at 37°C for 3 minutes.

[0190] 2) Add DPBS, mix thoroughly by pipetting, and transfer to a 1.5 mL centrifuge tube.

[0191] 3) Centrifuge at 1000 rpm for 5 minutes.

[0192] 4) Add 11 μL Neon TM Buffer R in the kit was added to the EP centrifuge tube, and then the reporter plasmid PB-CMV-L-Cherry-L-EGFP (LR for short) or the Cre recombinase regulatory system constructed in Examples 17-21 (schematic diagram as shown in FIG Figure 10 The cell pellet was resuspended to a final cell density of 1.0 × 10 7 / mL.

[0193] 5) Fill Neon with 2.5 mL of Buffer E TM Tube, Neon TM Tube Insertion Neon TM Press the pipette station until a click is heard.

[0194] 6) Neon TM Press the button on the pipette to the second position to open the clamp and insert the Neon TM Suction the tip until the clamp fully grasps the piston's mounting rod.

[0195] 7) Neon TM Immerse the tip in the cell-RNP complex and slowly press the button to draw the cell-RNP complex into the Neon TM Tips to avoid air bubbles during pipetting.

[0196] 8) Place the Neon containing the sample TM The pipette is inserted vertically into the Neon TM Neon in the Pipette Station TM tube until you hear a click.

[0197] 9) Set the electroporation parameters as shown in Table 2 below:

[0198] Table 2 Electroporation parameters

[0199]

[0200] 10) Press Start on the touch screen. The touch screen displays Complete, indicating that the electroporation is complete.

[0201] 11) From Neon TM Remove Neon from the pipette station TM Pipette, press the button on the pipette to the first stop position and immediately remove the sample from the Neon TM The tips were transferred to a 24-well plate pre-coated with Matrigel matrix, 500 μL of neural stem cell culture medium was added to each well, and 4OHT was added or not added, respectively. 4OHT was added or not added for 3 consecutive days, and the plates were photographed under a fluorescence microscope.

[0202] The results are as follows Figure 11 As shown, in the presence of the small molecule drug 4-hydroxytamoxifen (4OHT), all five plasmids showed red fluorescence after electroporation of mouse neural stem cells. In the absence of 4OHT, groups C, CE, and 50C showed red fluorescence, with leakage, while ECE and 50ECE had almost no red fluorescence, and in the drug-treated group, 50ECE showed more red fluorescence than ECE.

[0203] (3) In vivo regulation of Cre by different combinations in MEFs with and without 4OHT

[0204] MEF electroporation:

[0205] 1) MEF cells with a cell confluence rate of 70-90% were collected, the culture medium was removed, the cells were washed twice with PBS, the PBS was discarded, and 0.05% trypsin-EDTA was added and digested at 37°C for 3 minutes.

[0206] 2) Add PBS, mix thoroughly by pipetting, and transfer to a 1.5 mL centrifuge tube.

[0207] 3) Centrifuge at 1000 rpm for 5 minutes.

[0208] 4) Add 11 μL Neon TM Buffer R in the kit was added to the EP centrifuge tube, and then the reporter plasmid PB-CMV-L-Cherry-L-EGFP (LR for short) or the Cre recombinase regulatory system constructed in Examples 17-21 (schematic diagram as shown in FIG Figure 10 The cell pellet was resuspended to a final cell density of 5.0 × 10 6 / mL.

[0209] 5) Fill Neon with 2.5 mL of Buffer E TM Tube, Neon TM Tube Insertion Neon TM Press the pipette station until a click is heard.

[0210] 6) Neon TM Press the button on the pipette to the second position to open the clamp and insert the Neon TM Suction the tip until the clamp fully grasps the piston's mounting rod.

[0211] 7) Neon TM Immerse the tip in the cell-RNP complex and slowly press the button to draw the cell-RNP complex into the Neon TM Tips to avoid air bubbles during pipetting.

[0212] 8) Place the Neon containing the sample TM The pipette is inserted vertically into the Neon TM Neon in the Pipette Station TM tube until you hear a click.

[0213] 9) Set the electroporation parameters as shown in Table 3 below:

[0214] Table 3 Electroporation parameters

[0215]

[0216] 10) Press Start on the touch screen. The touch screen displays Complete, indicating that the electroporation is complete.

[0217] 11) From Neon TM Remove Neon from the pipette station TM Pipette, press the button on the pipette to the first stop position and immediately remove the sample from the Neon TMThe tips were transferred to a 24-well plate, 500 μL of DMEM medium containing 10% fetal bovine serum was added to each well, and 4OHT was added or not added, and the addition and non-addition of 4OHT was continued for 5 days, and the plates were photographed under a fluorescence microscope.

[0218] The results are as follows Figure 12 As shown in the figure, it can be seen that in the presence of the small molecule drug 4-hydroxytamoxifen (4OHT), the five plasmids all showed red fluorescence after electroporation of mouse fibroblasts. In the absence of 4OHT, the C, CE, and 50C groups showed red fluorescence and leakage, while ECE and 50ECE had almost no red fluorescence, and the red fluorescence of 50ECE in the drug-added group was more than that of ECE.

[0219] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. A Cre recombinase regulatory system, characterized in that: The Cre recombinase regulatory system is composed of the following functional elements in sequence: Inducible promoter, ER50, ERT2, nucleotide sequence of Cre recombinase, ERT2, sgRNA sequence; sgRNA sequence targets the target gene; the nucleotide sequence of the ER50 gene is shown in SEQ ID NO.

1.

2. The Cre recombinase regulatory system according to claim 1, characterized in that The inducible promoter is EFS promoter, Mx1 or TRE promoter.

3. The Cre recombinase regulatory system according to claim 1, characterized in that The Cre recombinase is Escherichia virus P1 Cre recombinase, Sphingomonas sp. ERG5 Cre recombinase or Salmonellaphage SJ46 Cre recombinase.

4. The Cre recombinase regulatory system according to claim 1, characterized in that The sgRNA sequence is an sgRNA sequence targeting the p53 gene and / or the RB1 gene.

5. The Cre recombinase regulatory system according to claim 4, characterized in that The sgRNA sequence targeting the p53 gene is shown in SEQ ID NO.

4.

6. The Cre recombinase regulatory system according to claim 4, characterized in that The sgRNA sequence targeting the RB1 gene is shown in SEQ ID NO.

5.

7. The Cre recombinase regulatory system according to claim 1, characterized in that The sgRNA sequence is also preceded by a constitutive promoter, which is a CMV, MSCV or U6 promoter.

8. A cell containing the Cre recombinase regulatory system according to any one of claims 1 to 7.

9. A kit comprising the Cre recombinase regulatory system according to any one of claims 1 to 7.

Images